![]() |
|
|
Division of Molecular Genetics and Microbiology, Wellcome Research Laboratories, Research Triangle Park, North Carolina 27709 (R.S., A.C.K.), and Lineberger Cancer Research Center and Department of Microbiology-Immunology Univ. of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599 (G.M., J.T.)
| |
Summary |
|---|
|
|
|---|
Regulation of the human multidrug resistance gene
(hMDR1) was studied by mapping DNA elements in the
proximal promoter necessary for efficient transcription. Transient
transfection analysis in tumor cell lines (HCT116, HepG2, and Saos2) of
promoter deletions identified several regulatory domains. These cell
lines expressed hMDR1 mRNA. Removal of an element between +25 and +158
reduced promoter activity by 2-3-fold, whereas deletion of sequences
from ~
5000 to
138 base pairs gave a ~2-fold increase. The
activity of the hMDR1 promoter (
137 to +25) was comparable
in activity to the SV40 early promoter and enhancer combination.
Deletion of the hMDR1 promoter between
86 and
44 reduced
activity by 5-10-fold, identifying an important regulatory region.
This minimal region (
88 to
37) activated transcription when
inserted upstream of a synthetic promoter, suggesting that it acts
independently of other regulatory sequences. Two DNA elements within 85 base pairs of the transcriptional start site were required to confer efficient gene expression. A double-point mutation in the Y box (inverted CCAAT box) between
70 and
80 reduced activity of the promoter by 5-10-fold, and a single-point mutation at
52 within a
GC-rich element reduced activity by 3-fold. Thus, both the Y-box and GC
elements must each remain intact for optimal promoter activity. DNA-binding analyses suggest that the transcription factor NF-Y, but
not YB-1 or c/EBP, is most likely responsible for controlling the
activity of the Y-box element in these tumor cell lines. DNA-binding analyses also suggest that Sp1, alone or in combination with other nuclear factors, likely controls the activity of the GC element.
| |
Introduction |
|---|
|
|
|---|
Cancer chemotherapy is limited by the existence of inherent forms of multiple drug resistance or by the emergence of multiple drug resistance after chemotherapy. Inherent drug resistance is observed most frequently in solid tumors arising from tissues that normally overexpress the hMDR gene (hMDR1) product, notably colon, adrenal, liver, and kidney (1). One embodiment of inherent drug resistance may include regulation of the hMDR1 gene by tissue-specific factors, but few studies address their identification (2). More critical is the observation that activation of certain oncogenes like ras and raf (3) or inactivation of the tumor suppressor p53 (4) may serve to elevate hMDR1 expression. Acquired resistance develops in most hematological malignancies and breast and ovarian carcinomas after chemotherapy (5). Evaluation of clinical isolates from drug-resistant tumors confirms that expression of the hMDR1 gene is often elevated and correlates with a poor prognosis (6). Induction of the hMDR1 gene by a variety of toxic agents, including anticancer drugs, carcinogens, and heavy metals, is proposed as a mechanism important for the acquisition of multidrug resistance (7-10). The hMDR1 gene is also regulated by heat shock (7, 11) and UV irradiation (12), implying that hMDR1 promoter activation may be part of a general stress response in many cells.
Several lines of evidence implicate complex mechanisms for
transcriptional regulation of hMDR1 expression in cells.
However, the biochemical events responsible for controlling expression of the hMDR1 gene in human tumors remain to be elucidated.
The hMDR1 promoter has been cloned and sequenced (2, 13,
14). It belongs to a family of housekeeping genes that are without a
TATA box but do contain an initiator element at the transcriptional start site, an inverted CCAAT box (Y box) between
70 and
80, and a
number of recognition sites for transcription factors, including those
for Sp1, NF-Y (CP-1), YB-1, and YY-1. Sequences from +1 to +11 are
needed for accurate initiation at the major start site of transcription
(13, 15). A few studies begin to characterize the cis
elements and transcription factors responsible for hMDR1 promoter activity. One study shows that Sp1 interacts with a GC-rich region at
50 to control hMDR1 expression in a variant of KB cells selected to be drug resistant in culture (16). A phorbol
ester-responsive element overlaps this region of the promoter (17).
Other data show that deletion or mutation of the Y box also affects
promoter activity (12, 18), but the factors responsible for directing transcription through this cis element have not previously
been identified. The murine mdr1b promoter is regulated by
NF-Y and C/EBP
(19). A region in the proximal promoter upstream of
the Y-box (
110 to
103) binds a cellular factor and represents a negative element in KB 8-5 cells (16). Finally, deletion of an
overlapping region (
137 to
106) in Adriamycin-resistant K562 cells
causes a 3-fold increase in promoter activity (20).
To identify regulatory elements of the hMDR1 gene, we
constructed chimeric hMDR1 promoter-luciferase reporter
plasmids and evaluated their activity in three human tumor cell lines
that express hMDR1 mRNA without DNA amplification and without prior selection for drug resistance. Deletion analysis of a proximal promoter
construct (
137 to +158) revealed three regions important for promoter
activity in all three tumor cell lines: two regions lie upstream of the
transcription start site, and one lies downstream. Mutational analysis
provided evidence that the Y box and a GC box located at
52 with
respect to the transcriptional start site may cooperate to regulate
hMDR1 expression. DNA-binding studies identified two factors that
interact with these elements as NF-Y and Sp1. This study defines two
transcription factors that operate in cell lines derived from human
tumors having inherent multiple drug resistance and may lead to
insights for future design of inhibitors.
| |
Materials and Methods |
|---|
|
|
|---|
Plasmid DNA construction.
The plasmid
137/+158LUC
containing the hMDR1 proximal promoter was generated by PCR
amplification of specific sequences from EMBL MDR-1 phage DNA (22)
using primers containing restriction sites (underlined) for
XhoI (5
-primer)
(5
-CGCAGTTTCTCGAGGAATCAGCATTCAGTCAATCC) and
HindIII (3
-primer)
(5
-GGCAAGCTTAGTAGCTCCCAGCTTTGCGTGCCCCTAC). The PCR product
was digested with restriction enzymes XhoI and HindIII and subcloned into pBS-SK+ (Stratagene, La Jolla,
CA). The hMDR1 fragments were directionally subcloned into the
luciferase reporter plasmid pGL2 Basic (Promega, Madison, WI) to
generate
137/+158LUC. The hMDR1 promoter deletions were
similarly constructed using specific primers to synthesize the
indicated hMDR1 promoter fragments. Point mutations in the
hMDR1 promoter were generated in a two-step PCR
amplification protocol. In two PCR procedures, the overlapping primer
pairs 5
-CTGTGGTGAGGCTGAcTcGCTGGGCAGGAACAG and
5
-CTGTTCCTGCCCAGCgAgTCAGCCTCACCACAG (mutY1); and
5
-CTGTGGTGAGGCTGATgtGCTGGGCAGGAACAG and
5
-CTGTTCCTGCCCAGCacATCAGCCTCACCACAG (mutY2) containing base changes
shown in lowercase (and indicated in Table 1) were
paired with primers of wild-type sequence that defined the 5
- and
3
-ends of the final promoter fragment. The overlapping products of the first two reactions were amplified in a second PCR using only the
wild-type 5
- and 3
-end primers. These fragments were subcloned into
pGL2 Basic. The plasmid pTIluc (TATA-initiator) was constructed by
insertion of oligonucleotides with 5
-terminal XhoI and
3
-terminal HindIII ends containing the adenovirus major
late promoter TATA box and the terminal deoxynucleotidyl
transferase promoter initiator sequence:
5
-TCGACGGGCTATAAAAGGGGGTGGGGGGAGCTCGGCCCTCATTCTGGAGACG (32) into the XhoI/HindIII sites of the plasmid
pGL2Basic. Plasmid p52TIluc was generated by insertion of one copy of
5
-TCGAGTGAGGCTGATTGGCTGGGCAGGAACAGCGCCGGGGCGTGGGCTGAGCACAG (hMDR1 sequences
88 to
37), and complement, into the
XhoI site of pTIluc. The plasmids pLuc, pSVLuc, and pGL2C
were obtained from Promega. The relevant DNA sequences of all plasmid
constructs were verified.
|
Cell culture and transient transfections.
HCT116, HepG2,
KB3-1, and Saos2 cells were obtained from American Type Culture
Collection (Rockville, MD) and were maintained in DMEM with 10% fetal
bovine serum (Biologos, Naperville, IL) and 5% CO2. Cells
were plated at a density of 0.5-1.0 × 106/well in
six-well plates ~24 hr before transfection. HepG2 cells were seeded
onto wells that were precoated with Matrigel (Collaborative Research,
Bedford, MA). Plasmid DNAs (0.5 µg of promoter plasmid plus 1.5-2
µg of pUC19 plasmid for a total of 2-2.5 µg of DNA added per well)
were transfected into cells by lipofection using either DOTAP
(Boehringer-Mannheim, Indianapolis, IN) or Lipofectamine (Life
Technologies, Grand Island, NY). The amount of DNA and the cell density
required for optimal transfection efficiency were predetermined (data
not shown). Plasmid DNAs were diluted into 60 µl of HEPES-buffered
saline (20 mM HEPES, pH 7.4, 150 mM NaCl) or
100 µl of DMEM before mixing with either 15 µg of DOTAP in 60 µl
of HEPES-buffered saline or 24 µg of Lipofectamine in 100 µl of
DMEM, respectively. After a 15-30-min incubation at room temperature,
the DNA/lipid mixtures were diluted with DMEM/10% fetal bovine serum
(DNA/DOTAP) or with DMEM alone (DNA/Lipofectamine) and then applied to
the cells. After a 16-20-hr exposure, the mixture was replaced with
medium containing serum. Approximately 40 hr after transfection, the
cells were washed twice with cold phosphate-buffered saline and lysed
by the addition of buffer containing 25 mM glycylglycine,
pH 7.8, 15 mM MgSO4, 4 mM EGTA, 1 mM DTT and 1% Triton X-100 or 1× Cell Lysis Buffer
(Promega), which contains 25 mM Tris-phosphate, pH 7.8, 2 mM DTT, 2 mM
1,2-diaminocyclohexane-N, N,N
,N
-tetraacetic acid, 10% glycerol, and 1%
Triton X-100. Lysates were spun for 10 min at 4° in a microcentrifuge
and assayed immediately for luciferase activity.
Luciferase assay. Luciferase activity was measured in a 200-µl reaction containing 20-40 µl of cell extract, 25 mM glycylglycine, pH 7.8, 15 mM K2HPO4, pH 7.8, 15 mM MgSO4, 4 mM EGTA, 0.5 mM DTT, 1 mM ATP, and 80 µM luciferin. Cell extracts and 100 µl of a 2× reaction buffer (without ATP and luciferin) were combined in the wells of a microtiter plate. The luciferase reaction was initiated by autoinjection of 40 µl of 5 mM ATP and 40 µl of 0.4 mM luciferin using a Dynatech luminometer.
Nuclear extract preparation. HepG2 and HCT116 cells were washed with cold phosphate-buffered saline, and nuclear extracts were prepared (21). Extracts were dialyzed at 4° for 90 min in 20 mM HEPES, pH 7.9, 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 0.2 mM EGTA, 2 mM DTT, and 1 mM phenylmethylsulfonyl fluoride. Protein concentrations were determined using BioRad dye reagent.
Gel mobility shift assay.
The DNA sequence of
oligonucleotides used for gel shift analyses are shown in Table 1.
Approximately 5-10 fmol of double-stranded oligonucleotide labeled
with [
-32P]ATP was incubated in 10-µl reactions
containing nuclear extracts and 10 mM Tris·HCl, pH 7.2, 1 mM EDTA, 0.1% Triton X-100, 5% glycerol, 80 mM NaCl, 3 mM MgCl2, 4 mM DTT, and 2 µg of p(dI-dC) for Y-box binding analysis
and 20 mM HEPES pH 7.8, 50 mM KCl, 5 mM MgCl2, 1 µM ZnCl2,
500 ng of p[d(I-C)], 2 mM DTT, and 2% glycerol for GC-box binding analysis. Sp1 binding was analyzed in reactions containing 10 mM HEPES, pH 7.5, 100 mM NaCl,
1.5 mM MgCl2, 0.1% Triton X-100, 10 ng
p[d(I-C)], and Sp1 protein (Promega). Nuclear extracts and antibodies
were preincubated on ice for either 3 hr or 20 min for Y- or GC-box
DNA-binding analyses, respectively, followed by the addition of
radiolabeled DNA probes and incubation at either room temperature
(Y-box analyses) or 22-25° (GC-box analyses) for 20-30 min. The
reaction products were separated by electrophoresis at 4° (Y-box
analyses) or at room temperature (GC-box analyses) on 5%
polyacrylamide gels containing 0.5× Tris/borate/EDTA (1× = 89 mM Tris, 89 mM borate, and 1 mM
EDTA). Quantification was performed using a PhosphorImager (Molecular
Dynamics). The human YB-1 gene, a generous gift of Dr.
Benjamin Schwartz (Monsanto, St. Louis, MO), was cloned into an
Escherichia coli expression vector, and recombinant YB-1
protein was used to generate anti-YB-1 rabbit polyclonal serum (22).
Anti-NF-YA and NF-YB antibodies (38) and anti-YB-1 antibodies were
purified by Protein A/G chromatography. Antisera to c/EBP
, c/EBP
,
and c/EBP
(5) were kindly provided by Dr. Steve McKnight (University
of Texas Southwestern Medical Center, Dallas, TX), and Sp1 antibody
(PEP2)X was obtained from Santa Cruz Biochemicals (Santa Cruz, CA).
| |
Results |
|---|
|
|
|---|
The levels of hMDR1 mRNA and protein vary among normal human tissues (1). In this study, four tumor cell lines (HepG2, a hepatocellular carcinoma; HCT116, a colon carcinoma, KB3-1, an epidermoid carcinoma; and Saos2, an osteosarcoma) were analyzed for hMDR1 mRNA expression. The hMDR1 signal from mRNA of HepG2, HCT116, and Saos2 cells was detectable after 30 cycles of reverse transcription-PCR amplification (data not shown). In contrast, after 50 cycles, the level of hMDR1 cDNA derived from the drug-sensitive cell line KB3-1 was undetectable (data not shown). These results are consistent with previous determinations of very low or undetectable levels of hMDR1 mRNA in KB3-1 cells (1, 23).
The hMDR1 promoter contains regulatory elements both
upstream and downstream of the transcriptional initiation site.
The hMDR1 proximal promoter was analyzed to delineate the
regions necessary for efficient transcription. Deletion of DNA sequence from ~
5000 to
138 upstream of
137/+25LUC increased
transcription an average of 32% in HepG2 cells and an average of 68%
in HCT116 cells (data not shown). Deletion from
86 to
44 resulted
in an 8-fold and a 13-fold reduction in activity in HepG2 and HCT116 cells, respectively (Fig. 1). When the promoter was
deleted to
11, there was a modest additional decrease in activity in
both cell lines. In Saos2 cells, a similar reduction in
hMDR1 promoter activity was observed on deletion from
86
to
44 (~5-fold, data not shown). Deletion of sequences between +25
and +158 reduced the activity of the promoter by ~2-fold in all three
cells lines (Fig. 1, and Saos2, data not shown).
|
The hMDR1 proximal promoter contains several putative
transcription factor binding sites.
The hMDR1 promoter
contains no TATA box but contains an initiator element (24)
corresponding to the major start site of transcription (2, 13, 14, 25)
(Fig. 2). The DNA sequence from
86 to
44 is
essential for efficient transcription in HepG2, HCT 116 (Fig. 1), and
Saos2 cells. This region of the promoter contains an inverted CCAAT box
at
77 (Y-box) with a 13-of-14 match to the consensus binding site for
NF-Y and a GC-rich region containing four or five Sp1 consensus binding
sites (sites 1-4 are identified). Sp1 sites 1 and 4 match the Sp1
consensus G/T G/A GGC G/T G/A G/A G/T (26), whereas sites 2 and 3 adhere to the consensus at 8 of 9 positions. Downstream of the
transcriptional initiation site is a pyrimidine-rich tract containing a
recognition site for the transcription factor YY1.
|
Two elements of the hMDR1 proximal promoter are necessary for efficient gene expression. We prepared two mutants in the Y box (mutY1 and mutY2) and four mutants of the consensus Sp1 sites (site1m, site3m, site4m, and site1m3m4m) to investigate the functionality of the these sites. MutY1 resulted in a 36% reduction in hMDR1 promoter function in HepG2 cells and a 45% increase in HCT116 cells (Fig. 3). In contrast, mutY2 caused a consistent and severe reduction in promoter activity in both HepG2 and HCT116 cells.
|
52 (site3m) reduced activity an average of 60% in HepG2 cells and
65% in HCT116 cells, whereas the site4m and site1m mutations had
little effect. The triple-site mutant (site1m3m4m) reduced the activity
to levels comparable with the single-point mutant in site 3. The site3m
and mutY2 mutations each had a significant effect on promoter activity,
indicating that both the Y box and site 3 GC box must remain intact for
optimal activity.
Analysis of the activity of the hMDR1 promoter
element.
The 52 nucleotides spanning
88 to
37 were inserted
upstream of a heterologous, synthetic promoter to analyze the strength and independence of the hMDR1 proximal promoter.
Transfection of the p52TIluc construct into either HepG2 or HCT116
resulted in luciferase activities that were comparable to the activity of the element in its native context (Fig. 4). In
addition, the activities of the hMDR1 promoter driven
constructs were comparable to those of the strong early promoter and
enhancer of SV40 (Fig. 4).
|
NF-Y forms a complex with the hMDR1 promoter Y
box.
DNA binding experiments were performed with an hMDR1 Y-box
probe (
90 to
64) and nuclear extracts of HepG2 and HCT116 cells. Several protein/DNA complexes of similar migration were detected in
both extracts (Fig. 5A, lanes 1 and 5). All
complexes were specific to the hMDR1 probe, as competition with excess,
unlabeled DNA of wild-type sequence dramatically reduced binding of all complexes formed with both extracts (Fig. 5A, lanes 2 and
6). Incubation with an excess of a wild-type fragment from the MHC class II HLA-DRA Y box known to bind NF-Y (27, 28) reduced or
eliminated formation of complexes I and II and had minor effects on
some of the more rapidly migrating complexes (lanes 4 and
8). Mutation of the core CCAAT sequence to AACCT (mutY3),
previously shown to eliminate NF-Y binding to the Y box in the human
MHC DRA promoter (29), also eliminated competition of
complexes I and II (Fig. 5A, lanes 3 and 7). This mutation,
however, did not affect competition for formation of the faster
migrating complexes in both HCT116 (Fig. 5A, lane 7) and in
HepG2 extracts when used in greater excess (data not shown). These
results suggest that complexes I and II are CCAAT specific and have
DNA-binding characteristics of NF-Y.
|
, c/EBP
,
c/EBP
, and YB-1) had no detectable effect on complexes formed with
either HepG2 or HCT116 extracts (Fig. 5B, lanes 8-10, 12, and
16). The slight increase in intensity of complexes I and II in the
presence of the C/EBP antibodies is a nonspecific effect that is also
seen with normal whole-serum controls (data not shown). Whole serum
alone produced no DNA binding activity on these probes (data not
shown). These data are consistent with NF-Y binding to the hMDR1 Y-box
probe to form complexes I and II. Neither Sp1 antibody (lane
11) nor normal serum (lane 13) affected migration of the
complexes.
A single, specific protein/DNA complex was formed when recombinant YB-1
was incubated with a double-stranded hMDR1 Y-box DNA probe (Fig. 5C,
lane 1). In the presence of excess, wild-type DNA, the YB-1
complex was significantly reduced (lane 2), whereas the
mutY1 and mutY2 competitors were slightly less effective at reducing
the signal (lanes 3 and 4, respectively). There was no evidence of a YB-1-specific complex formed in either HepG2 or HCT116
extracts, nor did antibody to YB-1 affect complex formation (Fig. 5B,
lanes 12 and 16).
A specific complex containing Sp1 forms on an essential element of the hMDR1 promoter. Gel mobility shift analyses were performed with four DNA probes (Table 1) spanning Sp1 consensus sites 3 and 4 (34, 3m4, 34m, and 3m4m). HCT116 nuclear extract formed two complexes on the wild-type hMDR1 DNA probe spanning both sites 3 and 4 (complexes A and B, Fig. 6A, lane 2). These complexes were formed at reduced levels when the probes contained the single-point mutation in site 3 (20% of wild-type) (3m4, lane 3) or the triple-point mutation in sites 3 and 4 (5-10% of wild-type) (3m4m, lane 5). The double-point mutation in site 4 (34m) did not affect formation of either complex (>100% of wild-type) (lane 4), indicating that protein is binding predominantly to site 3. Purified Sp1 protein formed two complexes on the wild-type hMDR1 DNA probe spanning sites 3 and 4, having an apparently identical pattern of electrophoretic migration to complexes A and B formed with the HCT116 nuclear extract (Fig. 6B, lane 1). These complexes were sensitive to the same point mutations in the Sp1 consensus sites 3 and 4 as were those formed with HCT116 extract (Fig. 6B, lanes 2-4). When higher amounts of Sp1 were used, only the upper complex was formed (lane 6).
|
62 to
87 and spanning Sp1 consensus sites 1 and 2 was weak in comparison to its binding to a DNA fragment spanning
sites 3 and 4.2 These data suggest that Sp1
interaction with consensus sites 1 and 2 is poor or absent. Further
support was obtained when nuclear extracts failed to form complexes
susceptible to supershift by Sp1 antiserum with the hMDR1 Y-box DNA
probe that includes these sites (Fig. 5B, lane 11).
| |
Discussion |
|---|
|
|
|---|
The transcriptional activity of the proximal hMDR1
promoter was evaluated in three tumor cell lines that express
hMDR1 and do not have amplified forms of the gene. We chose
to evaluate hMDR1 promoter function in human tumor cells,
rather than drug resistant lines selected in vitro, to
evaluate the properties of the promoter in cells that conform more
closely to those of clinical isolates. This report provides the first
evidence in a single study that both the Y box and the
52 GC box must
remain functional for efficient transcription from the hMDR1
proximal promoter (Fig. 3). This is also the first study to mutate the GC boxes spanning the region between
86 and
44, which functions to
regulate the hMDR1 promoter, and to identify NF-Y and Sp1 as components of the complexes formed on the promoter.
Our data are consistent with those from hMDR1 promoter/CAT constructs evaluated in SW620 colon carcinoma and 2780 ovarian carcinoma cells (13, 18). A double-point mutation in the Y box was previously reported to ablate promoter activity in the 2780 ovarian cancer cell line (18). Our data on this same mutation (mutY2) in two additional tumor cell lines (Fig. 3) reinforce the importance of the Y box for transcriptional regulation of the hMDR1 promoter. The mutY1 mutation is reported to block detectable binding of CP1/NF-Y in HeLa extracts to an adenovirus major late promoter CCAAT box (30). Such a mutation in the hMDR1 promoter decreased promoter function as well as the formation of both DNA/protein complexes I and II in HepG2 cells. This mutation resulted in formation of a complex with slightly faster migration than complex I in HCT116 cell extracts and produced a small but reproducible increase in promoter function, suggesting cell-specific variations.
This report is the first to identify NF-Y as a factor likely to form a
functional interaction with the Y box in the hMDR1 promoter.
The murine mdr1b promoter requires cooperation of NF-Y and
c/EBP
for optimal activity (19). A number of factors interact with
inverted CCAAT boxes, or Y boxes, including NF-Y, YB-1, and c/EBP.
Their binding sites are related but do not generally share a common
sequence consensus (30). CCAAT elements like the one in the
hMDR1 promoter occupy fixed locations in promoters (
60 to
80) (31). Several pieces of data reported here support the identification of the Y box factor regulating hMDR1 expression as NF-Y.
The hMDR1 Y box most closely fits the consensus sequence for NF-Y
(13/14 match) (32), and tumor cell nuclear extracts formed complexes
with a MHC DRA Y-box promoter probe (Fig. 5) that comigrated with
complexes identified here as well as elsewhere to contain NF-Y (27,
28). The two specific complexes formed on the hMDR1 promoter
DNA probe were uniquely competed by a DRA Y-box oligonucleotide and
were supershifted by anti-NF-YA and NF-YB antisera. The binding profile
of the NF-Y complex to the mutY2 DNA probe correlated well with
activity in the functional assay (Fig. 3). Finally, antisera to YB-1
and c/EBP failed to alter migration of any complexes formed in extracts
prepared from these three tumor cell lines. An earlier study identified
YB-1 binding to an hMDR1 Y-box probe in drug-resistant KB variants (33). In those experiments, YB-1 was believed to respond to environmental stress. Our data in tumor cells expressing
hMDR1 exclude YB-1 as the factor interacting with the Y box
by showing that two mutations that effect promoter function do not
affect binding of recombinant YB-1.
An earlier study in KB cells identified two GC elements: one between
110 and
103 and one between
59 and
45 (16). The region of the
promoter between
86 and
44 is GC rich, having at least four
consensus Sp1 sites (Fig. 2). A point mutation at
52 in site 3 reduced promoter activity by 60-70%. This is the first report to show
that mutation of other flanking GC sites had little or no effect on
promoter strength (Fig. 3). The activities of promoters bearing either
the Y-box double-point mutant, mutY2, or the
52 single-point mutant
were reduced to a level comparable to that of the
43 deletion
construct. Therefore, the Y box and
52 GC box are both necessary for
efficient transcription.
The transcription factor Sp1 is ubiquitous and enhances transcription
from a number of viral and cellular promoters that contain at least one
GC box whose postioning relative to that of upstream regulatory
elements can be critical. DNA-binding and mutational analyses provided
in this report show that only the single GC box positioned at
52
(site 3) is essential for efficient transcription. Nuclear extracts
from HCT116 tumor cells formed specific protein/DNA complexes on an
hMDR1 promoter DNA fragment spanning two Sp1 consensus sites
(Fig. 6), and these comigrate with those formed by purified Sp1.
Nuclear extracts formed weak interactions with a DNA probe spanning
only site 4, and a mutation in site 4 that blocked binding of
recombinant Sp1 had no effect on promoter activity.
Sp1 and WT-1 (34) share overlapping DNA-binding consensus with the
transcription factor EGR1. Recombinant EGR1 binds to an
hMDR1 promoter probe spanning the
52 GC box (16), and EGR1 participates in the control of hMDR1 expression in certain phorbol ester-sensitive cell lines (17). There are examples in which EGR1 and
Sp1 compete for binding to overlapping binding sites (35); therefore,
additional layers of regulation of the hMDR1 promoter
through the Y-box and
52 GC-box elements will form the basis for
further investigation.
NF-Y regulates transcription of a variety of genes, including some that
are constitutive, tissue specific, or developmentally or cell-cycle
regulated (36). The data in this report provide supporting evidence
that NF-Y and Sp1 interact with the Y box and
52 GC box,
respectively. Cooperative interactions have been observed between NF-Y
and Sp1 on the human invariant chain promoter, and there is precedent
for formation of protein/protein contacts between NF-Y and other
transcription factors located at a distance, such as X box factors on
the MHC II promoter (27), p67 serum response factor on the
-actin
promoter (36), and c/EBP on the albumin promoter (37). Further
experimentation is needed to determine whether NF-Y and Sp1 cooperate
to regulate the hMDR1 promoter.
A number of studies show that an element just upstream of the Y box
(
198 to
89) negatively influences hMDR promoter activity (13, 16, 20); however, the exact position of the negative element may
vary in different cell lines. Deletion from
137 to
86 had opposing
effects in HCT116 and HepG2 cells in the current study. These data
taken together indicate that a number of factors may interact with this
region of the promoter and that there may be tissue-specific
variations.
The deletion analyses of the hMDR1 promoter described in
this report and in others (13, 18) differ from those using KB epidermoid variants in two important ways. The most dramatic loss in
promoter activity reported in KB8-5 cells is between
73 and
51,
which corresponds to a GC box recognized by Sp1 (16). Another study
with KB cells reported that the major element required for UV induction
corresponds to sequences upstream of the Y box (
136 to
78) (12).
Deletion of this element has no detectable effect on uninduced promoter
activity in KB cells. Thus, the Y box may be less important in KB cells
for constitutive promoter activity than it is in other solid tumor
cells lines, like HCT116, HepG2, Saos2 (vide infra), and
SW620 (18). Instead, the Y box may be part of a stress response in
certain cells. An element between
136 and
76 is responsible for
heat shock induction in stably transfected KB cells, adding support to
this speculation (11). A UV-inducible factor from KB cell extracts
binds to a Y-box probe (12) and has a molecular weight similar to that
of the NF-YA subunit (40 kDa) (27, 38) and the Y-box binding protein
YB-1 (42 kDa) (39). Although speculative, the inducible Y-box factor in
KB cells may not be the same as the factor identified here as NF-Y in
tumor cell lines having inherently high levels of hMDR1 expression.
Part of the regulation of hMDR1 expression in tumors may arise from
activation of transcription by constitutive factors like NF-Y and Sp1
or by alternative inductive factors interacting with the Y-box. Our
data support this speculation and show that a 52-base pair element
spanning the Y- and GC-boxes are sufficient for efficient transcription
of the hMDR1 promoter in three different tumor cell lines
expressing this important drug resistance gene.
| |
Acknowledgments |
|---|
We thank Dr. K. Khono (Kyushu University Medical School, Japan)
for EMBL-MDR-1 and EMBL-MDR-2
phage clones, Patricia Parker for
technical assistance, Steve McKnight for c/EBP antisera, and Bill
Phelps for critical reading of the manuscript.
| |
Footnotes |
|---|
Received January 30, 1996; Accepted February 18, 1997
1 Current affiliation: BioChem Pharma, Inc., Laval, Quebec, Canada, H7V 4A7.
2 A. Merritt and A. C. King, unpublished observations.
This work was supported by Burroughs Wellcome Co. and Grants CA48185, CA37172, and AI27430 from the National Cancer Institute and National Institute of Allergy and Infectious Diseases (J.T.) and a predoctoral training grant from the National Institutes of Health (G.M.).
Send reprint requests to: Dr. Rebecca Sundseth, AndCare, P.O. Box 14566, Research Triangle Park, NC 27709.
| |
Abbreviations |
|---|
hMDR, human multidrug resistance;
DMEM, Dulbecco's modified Eagle's medium;
EGTA, ethylene glycol
bis(
-aminoethyl
ether)-N,N,N
,N
-tetraacetic
acid;
HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid;
PCR, polymerase chain reaction;
DTT, dithiothreitol;
DOTAP, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium
methylsulfate;
SV, simian virus;
LU, light units.
| |
References |
|---|
|
|
|---|
| 1. |
Fojo, A. T.,
K. Ueda,
D. J. Slamon,
D. G. Poplack,
M. M. Gottesman, and
I. Pastan.
Expression of a multidrug-resistance gene in human tumors and tissues.
Proc. Natl. Acad. Sci. USA
84:265-269 (1987) |
| 2. |
Kohno, K.,
S. Sato,
T. Uchiumi,
H. Takano,
S. Kato, and
M. Kuwano.
Tissue-specific enhancer of the human multidrug-resistance (MDR1) gene.
J. Biol. Chem.
265:19690-19696 (1990) |
| 3. |
Burt, R. K.,
S. Garfield,
K. Johnson, and
S. S. Thorgeirsson.
Transformation of rat liver epithelial cells with v-H-ras or v-raf causes expression of MDR-1, glutathione-S-transferase-P and increased resistance to cytotoxic chemicals.
Carcinogenesis
9:2329-2332 (1988) |
| 4. |
Chin, K.-V.,
K. Ueda,
I. Pastan, and
M. M. Gottesman.
Modulation of activity of the promoter of the human MDR1 gene by ras and p53.
Science (Washington D. C.)
255:459-462 (1992) |
| 5. | Harris, A. L. and D. Hochhauser. Mechanisms of multidrug resistance in cancer treatment. Acta Oncol. 31:205-213 (1992)[Medline]. |
| 6. | Chan, H. S., G. Haddad, P. S. Thorner, G. DeBoer, Y. P. Lin, N. Ondrusek, H. Yeger, and V. Ling. P-glycoprotein expression as a predictor of the outcome of therapy for neuroblastoma. N. Engl. J. Med. 325:1608-1614 (1991)[Abstract]. |
| 7. |
Chin, K.-V.,
S. Tanaka,
G. Darlington,
I. Pastan, and
M. M. Gottesman.
Heat shock and arsenite increase expression of the multidrug resistance (mdr1) gene in human renal carcinoma cells.
J. Biol. Chem.
265:221-226 (1990) |
| 8. |
Fairchild, C. R.,
S. P. Ivy,
T. Rushmore,
G. Lee,
P. Koo,
M. E. Goldsmith,
C. E. Myers,
E. Farber, and
K. H. Cowan.
Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas.
Proc. Natl. Acad. Sci. USA
84:7701-7705 (1987) |
| 9. | Kioka, N., Y. Yamano, T. Komano, and K. Ueda. Heat-shock responsive elements in the induction of the multidrug resistance gene (MDR1). FEBS Lett. 301:37-40 (1992)[Medline]. |
| 10. | Kohno, K., S. Sato, H. Takano, K. Matsuo, and M. Kuwano. The direct activation of human multidrug resistance gene (MDR1) by anticancer agents. Biochem. Biophys. Res. Commun. 165:1415-1421 (1989)[Medline]. |
| 11. | Miyazaki, M., K. Kohno, T. Uchiumi, H. Tanimura, K. Matsuo, M. Nasu, and M. Kuwano. Activation of human multidrug resistance-1 gene promoter in response to heat shock stress. Biochem. Biophys. Res. Commun. 187:677-684 (1992)[Medline]. |
| 12. | Uchiumi, T., K. Kohno, H. Tanimura, K. Matsuo, S. Sato, Y. Uchida, and M. Kuwano. Enhanced expression of the human multidrug resistance 1 gene in response to UV light irradiation. Cell Growth Diff. 4:147-157 (1993)[Abstract]. |
| 13. |
Madden, M. J.,
C. S. Morrow,
M. Nakagawa,
M. E. Goldsmith,
C. R. Fairchild, and
K. H. Cowan.
Identification of 5 and 3 sequences involved in the regulation of transcription of the human mdr1 gene in vivo.
J. Biol. Chem.
268:8290-8297 (1993) |
| 14. |
Ueda, K.,
I. Pastan, and
M. M. Gottesman.
Isolation and sequence of the promoter region of the human multidrug-resistance (P-glycoprotein) gene.
J. Biol. Chem.
262:17432-17436 (1987) |
| 15. | Cornwell, M. M. The human multidrug resistance gene: sequences upstream and downstream of the initiation site influence transcription. Cell Growth Diff. 1:607-615 (1990)[Abstract]. |
| 16. |
Cornwell, M. M. and
D. E. Smith.
Sp1 activates the MDR1 promoter through one of two distinct G-rich regions that modulate promoter activity.
J. Biol. Chem.
268:19505-19511 (1993) |
| 17. | McCoy, C., D. E. Smith, and M. M. Cornwell. 12-O-Tetradecanoylphorbol-13-acetate activation of the MDR1 promoter is mediated by EGR1. Mol Cell. Biol. 15:6100-6108 (1995)[Abstract]. |
| 18. |
Goldsmith, M. E.,
M. J. Madden,
C. S. Morrow, and
K. H. Cowan.
A Y-box consensus sequence is required for basal expression of the human multidrug resistance (mdr1) gene.
J. Biol. Chem.
268:5856-5860 (1993) |
| 19. | Yu, L., Q. Wu, C.-P. Huang Yang, and S. Band Horwitz. Coordination of transcription factors, NF-Y and C/EBPB, in the regulation of the mdr1b promoter. Cell Growth Diff. 6:1505-1511 (1995)[Abstract]. |
| 20. |
Ogura, M.,
T. Takatori, and
T. Tsuruo.
Purification and characterization of NF-R1 that regulates the expression of the human multidrug resistance (MDR1) gene.
Nucleic Acids Res.
20:5811-5817 (1992) |
| 21. |
Swick, A. G.,
M. C. Blake,
J. W. Kahn, and
J. C. Azizkhan.
Functional analysis of GC element binding and transcription in the hamster dihydrofolate reductase gene promoter.
Nucleic Acids Res.
17:9291-9304 (1989) |
| 22. |
MacDonald, G. H.,
Y. Itoh-Lindstrom, and
J. P.-Y. Ting.
The transcriptional regulatory protein YB-1, promotes single-stranded region in the DR promoter.
J. Biol. Chem.
270:3527-3533 (1995) |
| 23. |
Noonan, K. E.,
C. Beck,
T. A. Holzmayer,
J. E. Chin,
J. S. Wunder,
I. L. Andrulis,
A. F. Gazdar,
C. L. Willman,
B. Griffith,
D. D. Von Hoff, and
I. B. Roninson.
Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction.
Proc. Natl. Acad. Sci. USA
87:7160-7164 (1990) |
| 24. | Smale, S. T. and D. Baltimore. The "initiator" as a transcription control element. Cell. 57:103-113 (1989)[Medline]. |
| 25. |
Ueda, K.,
D. P. Clark,
C. Chen,
I. B. Roninson,
M. M. Gottesman, and
I. Pastan.
The human multidrug resistance (mdr1) gene.
J. Biol. Chem.
262:505-508 (1987) |
| 26. |
Faisst, S. and
S. Meyer.
Compilation of vertebrate-encoded transcription factors.
Nucleic Acids Res.
20:3-26 (1992) |
| 27. |
Wright, K. L.,
T. L. Moore,
B. J. Vilen,
A. M. Brown, and
J. P.-Y. Ting.
Major histocompatibility complex class II-associated invariant chain is up-regulated by cooperative interactions of Sp1 and NF-Y.
J. Biol. Chem.
270:20978-20986 (1995) |
| 28. |
Zeleznik-Le, N. J.,
J. C. Azizkhan, and
J. P.-Y. Ting.
Affinity-purified CCAAT-box-binding protein (YEBP) functionally regulates expression of a human class II major histocompatibility complex gene and the herpes simplex virus thymidine kinase gene.
Proc. Natl. Acad. Sci. USA
88:1873-1877 (1991) |
| 29. |
Sherman, P. A.,
P. V. Basta,
T. L. Moore,
A. M. Brown, and
J. P.-Y. Ting.
Class II box consensus sequences in the HLA-DR gene: transcriptional function and interaction with nuclear factors.
Mol. Cell. Biol.
9:50-56 (1989) |
| 30. | Chodosh, L. A., A. S. Baldwin, R. W. Carthew, and P. A. Sharp. Human CCAAT-binding proteins have heterologous subunits. Cell 53:11-24 (1988)[Medline]. |
| 31. | Bucher, P. Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J. Mol. Biol. 212:563-578 (1990)[Medline]. |
| 32. | Dorn, A., J. Bollekens, A. Staub, C. Benoist, and D. Mathis. A multiplicity of CCAAT box-binding proteins. Cell. 50:863-872 (1987)[Medline]. |
| 33. | Asakuno, K., K. Kohno, T. Uchiumi, T. Kubo, S. Sato, M. Isono, and M. Kuwano. Involvement of a DNA binding protein, MDR-NF1/YB-1, in human MDR1 gene expression by actinomycin D. Biochem. Biophys. Res. Commun. 199:1428-1435 (1994)[Medline]. |
| 34. |
Rauscher, F. J., III,
J. F. Morris,
O. E. Tournay,
D. M. Cook, and
T. Curran.
Binding of the Wilms' tumor locus zinc finger protein to the EGR-1 consensus sequence.
Science (Washington D. C.)
250:1259-1262 (1990) |
| 35. |
Cao, X.,
R. Mahendran,
G. R. Guy, and
Y. H. Tan.
Detection and characterization of cellular EGR-1 binding to its recognition site.
J. Biol. Chem.
268:16949-16957 (1993) |
| 36. |
Danilition, S. L.,
R. M. Frederickson,
C. Y. Taylor, and
N. G. Miyamoto.
Transcription factor binding and spacing constraints in the human beta-actin proximal promoter.
Nucleic Acids Res.
19:6913-6922 (1991) |
| 37. |
Milos, P. M. and
K. S. Zaret.
A ubiquitous factor is required for C/EBP-related proteins to form stable transcription complexes on an albumin promoter segment in vitro.
Genes Dev.
6:991-1004 (1992) |
| 38. | Hooft van Huijsduijnen, R., X. Y. Li, D. Black, H. Matthes, C. Benoist, and D. Mathis. Co-evolution from yeast to mouse: cDNA cloning of the two NF-Y (CP-1/CBF) subunits. EMBO J. 9:3119-3127 (1990)[Medline]. |
| 39. |
Spitkovsky, D. D.,
B. Royer-Pokora,
H. Delius,
F. Kisseljov,
N. A. Jenkins,
D. J. Gilbert,
N. G. Copeland, and
H.-D. Royer.
Tissue restricted expression and chromosomal localization of the YB-1 gene encoding a 42 kD nuclear CCAAT binding protein.
Nucleic Acids Res.
20:797-803 (1992) |
This article has been cited by other articles:
![]() |
M. M. Shareef, B. Brown, S. Shajahan, S. Sathishkumar, S. M. Arnold, M. Mohiuddin, M. M. Ahmed, and P. M. Spring Lack of P-Glycoprotein Expression by Low-Dose Fractionated Radiation Results from Loss of Nuclear Factor-{kappa}B and NF-Y Activation in Oral Carcinoma Cells Mol. Cancer Res., January 1, 2008; 6(1): 89 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tabe, M. Konopleva, R. Contractor, M. Munsell, W. D. Schober, L. Jin, Y. Tsutsumi-Ishii, I. Nagaoka, J. Igari, and M. Andreeff Up-regulation of MDR1 and induction of doxorubicin resistance by histone deacetylase inhibitor depsipeptide (FK228) and ATRA in acute promyelocytic leukemia cells Blood, February 15, 2006; 107(4): 1546 - 1554. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Takane, D. Kobayashi, T. Hirota, J. Kigawa, N. Terakawa, K. Otsubo, and I. Ieiri Haplotype-Oriented Genetic Analysis and Functional Assessment of Promoter Variants in the MDR1 (ABCB1) Gene J. Pharmacol. Exp. Ther., December 1, 2004; 311(3): 1179 - 1187. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kuwano, Y. Oda, H. Izumi, S.-J. Yang, T. Uchiumi, Y. Iwamoto, M. Toi, T. Fujii, H. Yamana, H. Kinoshita, et al. The role of nuclear Y-box binding protein 1 as a global marker in drug resistance Mol. Cancer Ther., November 1, 2004; 3(11): 1485 - 1492. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. Chen, S. Sale, T. Tan, R. P. Ermoian, and B. I. Sikic CCAAT/Enhancer-Binding Protein {beta} (Nuclear Factor for Interleukin 6) Transactivates the Human MDR1 Gene by Interaction with an Inverted CCAAT Box in Human Cancer Cells Mol. Pharmacol., April 1, 2004; 65(4): 906 - 916. [Abstract] [Full Text] |
||||
![]() |
H. Tanaka, N. Ohshima, M. Ikenoya, K. Komori, F. Katoh, and H. Hidaka HMN-176, an Active Metabolite of the Synthetic Antitumor Agent HMN-214, Restores Chemosensitivity to Multidrug-Resistant Cells by Targeting the Transcription Factor NF-Y Cancer Res., October 15, 2003; 63(20): 6942 - 6947. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Scotto and R. A. Johnson Transcription of MDR1: A Therapeutic Target Mol. Interv., June 1, 2001; 1(2): 117 - 125. [Abstract] [Full Text] [PDF] |
||||