Introduction

Top Summary Introduction Procedures Results Discussion References

Systemic injection of KA in the rat causes severe convulsions, seizure-induced brain damage, increased seizure susceptibility, and, after several weeks, spontaneous recurrent seizures (Ben-Ari, 1985; Sperk, 1994). These sequelae closely resemble those of human temporal lobe epilepsy. Therefore, KA-induced epilepsy has become a widely accepted animal model for this neurological disorder (Ben-Ari, 1985; Nadler, 1981). In this animal model, as in the human condition, the dentate gyrus of the hippocampus is presumed to be intimately involved in the generation of epileptic activity and exhibits characteristic neurochemical and histopathological changes (Sperk, 1994). Within granule cells of the dentate gyrus, immediate-early genes, neurotrophins, and various neuropeptides become strongly expressed during and after KA-induced seizures [for a review, see Sperk (1994)]. The expression of most of these molecules is transient. However, a persistent increase in the concentrations of NPY and its mRNA is seen in granule cell/mossy fibers (Bellmann et al., 1991; Sperk et al., 1992), and we recently proposed that this may represent a possible endogenous anticonvulsant mechanism (Greber et al., 1994; Sperk et al., 1992).

It is well accepted that in the hippocampus, NPY-Y₂ receptors are located mainly presynaptically on terminals of Schaffer collaterals (Dumont et al., 1996; Haas et al., 1987). They are prejunctionally innervated by NPY/GABA neurons (Haas et al., 1987; Milner and Veznedaroglu, 1992) and mediate presynaptic inhibition of glutamate release from Schaffer collaterals (Colmers et al., 1991; Greber et al., 1994; Haas et al., 1987). The same receptors seem to be minimally expressed on mossy fiber terminals (Dumont et al., 1996; Röder et al., 1996) .

We recently observed increased NPY receptor binding in various hippocampal subfields of rats subjected to KA-induced seizures (Röder et al., 1996). To investigate these changes in NPY receptor binding in detail, we applied in situ hybridization to study Y₂ receptor mRNA expression and determined kinetic parameters (K_d and B_max) for the binding of ¹²⁵I-PYY_3-36, a specific Y₂ receptor agonist, in the terminal areas of Schaffer collaterals (strata oriens/radiatum of CA1) and mossy fibers (hilus of the dentate gyrus). Furthermore, we investigated the changes in Y₂ receptor-mediated presynaptic inhibition of glutamate release from hippocampal slices ex vivo obtained 4 hr after KA injection.

	Experimental Procedures

Top Summary Introduction Procedures Results Discussion References

Materials. All buffer substances and salts, glucose, paraformaldehyde, acetic anhydride, formamide, acetonitrile, Entellan, and the HPLC columns (LiChrospher 100RP-18, 5 µm, 125 × 3 mm, for determination of glutamate and LiChrospher 100RP-8, 5 µm, 250 × 4 mm, for separation of radioiodinated peptides) were purchased from Merck (Darmstadt, Germany). KA, the constituents of the hybridization buffer (Ficoll, polyvinylpyrrolidone, bovine serum albumin, salmon sperm DNA, yeast tRNA, dithiothreitol, dextran sulfate), and bacitracin were obtained from Sigma Chemical (St. Louis, MO). Bovine serum albumin, chloramine T, and cresyl violet originated from Serva (Heidelberg, Germany). Oligonucleotides were custom synthesized by Microsynth (Balgach, Switzerland). NPY, NPY_13-36, [D-Trp³²]NPY, PYY, PYY_3-36, [Pro³⁴]PYY, and PP (all analogs of the human sequence) were purchased from Neosystems (Strasbourg, France). BIBP 3226 [N2-(diphenylacetyl)-N-[(4-hydroxyphenyl)methyl]-D-argininamide] was a gift from Dr. A. Zimmer (Dr. Karl Thomae GmBH, Biberach, Germany). Terminal deoxynucleotidyltransferase was purchased from Boehringer-Mannheim Biochemicals (Mannheim, Germany). [³⁵S]-Thio-dATP (1300 Ci/mmol; NEG 034H) and ¹²⁵I (2200 Ci/mmol; NEZ 033L) were obtained from DuPont-New England Nuclear (Boston, MA). The ¹²⁵I-microscales and max films for autoradiography were from Amersham (Buckinghamshire, UK). NTB-2 photoemulsion and photographic developer (D19) were from Kodak (Rochester, NY).

KA injection. Male Sprague-Dawley rats (250-350 g; Forschungsinstitut für Versuchstierzucht, Himberg, Austria) were housed at a constant temperature (23°) and relative humidity (60%) with a fixed 12-hr light/dark cycle and unlimited access to food and water. Procedures involving animals and their care were conducted in compliance with national laws and policies (EEC Council Directive 86/609, OJ L 358, 1, 12 December 1987; National Institutes of Health Guide for the Care and Use of Laboratory Animals, NIH Publication No. 85-23, 1985). The experiments were performed with the consent of the Committee for Animal Protection of the Austrian Ministry of Science.

Brain sections. For in situ hybridization and Y₂ receptor autoradiography, 20-µm-thick coronal sections of the dorsal hippocampus and horizontal sections of the ventral hippocampus were cut and thaw-mounted onto gelatin-coated slides. The sections were kept desiccated at 30° until their use in the respective experiments.

In situ hybridization. Two different synthetic oligonucleotide DNA probes were used (GAGTGAATGGCATCCAACCTCTGCTCACAGCGGAAGGCTGAGAGG and TGCTTGGAGATCTTGCTCTCCAGGTGGTAGACAATGCAACGATGTCGGTCC). The probes were complementary to different sequences of the rat Y₂ receptor mRNA (Dr. H. Herzog, personal communication, 1997) and highly homologous to the bases 1020-1064 and 451-501 of the recently published mouse cDNA, respectively (Nakamura et al., 1996). Essentially, the same results were observed with both probes; data obtained with the later one are shown. The oligonucleotides were labeled with [³⁵S]-thio-dATP (1300 Ci/mmol) via reaction with terminal deoxynucleotidyltransferase and precipitated with ethanol/sodium chloride. Matching sections from the same portion of the hippocampus of KA-treated rats and controls were assayed together. Frozen sections were rapidly immersed into 2% paraformaldehyde in phosphate-buffered saline (150 mM NaCl in 10 mM phosphate buffer, pH 7.2) for 10 min at room temperature, rinsed in phosphate-buffered saline, immersed in 0.25% acetic anhydride in 0.1 M triethylamine hydrochloride for 10 min, dehydrated by ethanol series, and delipidated with chloroform. They were hybridized at 42° for 18 hr with 50 fmol (1-1.5 × 10⁶ cpm) labeled oligonucleotide probe in 50 µl of hybridization buffer consisting of 50% formamide, 5× SSC (1× SSC = 150 mM NaCl, 15 mM sodium citrate, pH 7.2), 500 µg/ml salmon sperm DNA, 250 µg/ml yeast tRNA, 1× Denhardt's solution (0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin), 10% dextran sulfate, and 20 mM dithiothreitol. At the end of the incubation, the slides were briefly rinsed twice in 1× SSC/50% formamide. They were washed four times in 50% formamide in 2× SSC (42° for 15 min), rinsed in 1× SSC, and dipped briefly in water. The sections were then dipped in 70% ethanol, dried, and exposed to max films for 2 weeks. Subsequently, the slides were dipped in Kodak NTB-2 photosensitive emulsion (diluted 1:1 with distilled water), air-dried, and exposed for 6 weeks. The max films and dipped slides were developed with Kodak D19 developer. Sections were counter-stained superficially with cresyl violet, dehydrated, cleared in xylol, and coverslipped with Entellan. The corresponding radiolabeled sense DNA was used to exclude nonspecific hybridization of the probe. Sections prehybridized for 2 hr with an excess (1 nmol) of unlabeled probe were included as additional controls in some experiments.

Preparation of ¹²⁵I-PYY_3-36. PYY_3-36 was radiolabeled according to the procedure of Hunter and Greenwood (1962) as described previously in greater detail for NPY (Bellmann et al., 1991; Dumont et al., 1995). Briefly, 10 µg of PYY_3-36 was allowed to react with 1 mCi of ¹²⁵I (2200 Ci/mmol), 30 µg of chloramine T in 10 µl of H₂O, and 60 µl of 0.5 M phosphate buffer, pH 7.0, at room temperature for 45 sec. The reaction was stopped by the addition of 100 µl of 10% bovine serum albumin. The resulting mixture was separated on a C8 reverse-phase column (LiChrospher 100RP-8, 5 µm, 250 × 4 mm) by HPLC, which was eluted with 0.1 M tetraethyl-formiate buffer, pH 2.5, and acetonitrile (application of a linear gradient from 25% to 40% during 55 min) at a flow rate of 1.0 ml/min. Two major radioactive peptide peaks were recovered at 30% and 32% acetonitrile; they exhibited similar binding properties, and aliquots of the first peak were used. Because the terminal tyrosine becomes preferentially iodinated and migrates early on HPLC (Sheikh et al., 1989), the peak may contain monoiodinated [Tyr³⁶]¹²⁵I-PYY.

¹²⁵I-PYY_3-36 receptor autoradiography. Receptor binding was performed as described by Dumont et al. (1996). Slides containing either one brain section (time course study) or three sections placed on the same slide (kinetic analysis and displacement studies) were thawed and preincubated for 30 min at room temperature in 200 ml of Krebs-Henseleit-Tris buffer (118 mM NaCl, 4.8 mM KCl, 1.3 mM MgSO_4, 1.2 mM CaCl₂, 50 mM glucose, 15 mM NaHCO₃, 1.2 mM KH₂PO₄, 10 mM Tris, pH 7.3). The incubation was performed in Coplin jars containing 20 ml of the same buffer supplemented with 0.1% bovine serum albumin, 0.05% bacitracin, and ¹²⁵I-PYY_3-36. Time course studies were performed at 25 pM ¹²⁵I-PYY_3-36. Kinetic analysis of the receptor binding was performed in sections of the dorsal hippocampus of controls and 6 or 48 hr after KA injection. ¹²⁵I-PYY_3-36 was used at concentrations of 2.5, 5, 10, 15, and 25 pM. Displacement studies were performed at 25 pM ¹²⁵I-PYY_3-36. Thirty or 100 nM concentration of PYY, PYY_3-36, NPY_13-36, [D-Trp³²]NPY, [Pro³⁴]PYY, or PP or 5 or 15 µM concentration of the Y₁ antagonist BIBP 3226 was included in the incubation medium. Incubations were performed at room temperature for 2 hr. Unspecific binding was determined in the presence of 1 µM NPY; it was uniformly distributed throughout the section and was <5% (e.g., in Schaffer collaterals). The sections were dipped twice and then washed for 30 sec in ice-cold Krebs-Henseleit-Tris buffer, dipped in deionized water, and rapidly dried under a stream of cold air. They were exposed to max films for 10 days together with ¹²⁵I-microscales.

Quantification of in situ hybridization and receptor autoradiography and statistics. The autoradiograms were developed, digitized through the Appligene Image System (Illkirch, France), and analyzed using the public domain NIH Image program (written by Wayne Rasband at the National Institutes of Health and available from the Internet by anonymous FTP from zippy.nimh.nih.gov). For quantification of mRNA signals, absorbance was quantified in the strata granulosum and pyramidale. For each rat, values obtained for both sides were averaged. Data are given as mean values obtained from 3-6 animals per time interval and 12 age-matched control animals. For binding experiments, absorbance was measured in the strata oriens and radiatum of CA1 and in the hilus of the dentate gyrus. Absolute values were calculated by using a dose-response curve of the absorbance obtained through concomitant autoradiography of ¹²⁵I-microscales and expressed as fmol/mg of wet tissue weight. Specific binding was calculated by subtracting the unspecific binding, as determined in the presence of 1 µM NPY, from total binding. For the time course study, mean values obtained from pairs of hippocampi were averaged for each time interval after KA injection (3-6 rats/interval) and from 12 age-matched control animals killed concomitantly with the experimental animals. For displacement studies, mean values determined in three to six sections per animal were averaged. These values were used for calculating the mean values for 5 rats. Data are expressed as percentage of ¹²⁵I-PYY_3-36 binding in the presence of the respective unlabeled peptide analog of control binding obtained in the absence of cold ligands using sections from the same rats. Statistical analysis was done for time course and displacement studies by analysis of variance and the multiple-comparison Dunnett posteriori test.

Superfusion of hippocampal slices. Superfusion experiments were performed as described previously (Greber et al., 1994). Control and KA-treated rats (4 hr after treatment) were killed by decapitation. Their brains were rapidly removed and transferred into ice-cold Krebs-Henseleit-Tris buffer (118 mM NaCl, 4.8 mM KCl, 1.3 mM MgSO₄, 1.2 mM CaCl₂, 15 mM NaHCO₃, 1.2 mM KH₂PO₄, 10 mM Tris, 10 mM glucose, adjusted to pH 7.3 by gassing with 95% O₂/5% CO₂). Hippocampi were dissected keeping brains immersed in chilled buffer. Slices (300 µm) of the septal extension of the hippocampus were obtained using a McIllwain tissue chopper and placed in superfusion chambers at 34° (Greber et al., 1994). They were superfused at a flow rate of 1.0 ml/min with the above buffer and continuously gassed with 95% O₂/5% CO₂. Glutamate release was provoked by increasing the K⁺ concentration to 45 mM for 90 sec while the Na⁺ concentration was correspondingly reduced. Slices were stimulated twice (after 50 and 100 min, respectively). PYY_3-36 was included at concentrations of 0, 1, 3, 10, 30, or 100 nM together with 0.01% bovine serum albumin in the superfusion medium 8 min before and during the second K⁺ pulse. Fractions of 1.0 ml were collected, lyophilized, and used for determination of glutamate. Brain slices were finally sonicated in 1.0 ml of 0.1 M HClO₄. This homogenate was centrifuged and the supernatants were diluted 1:80 with 0.4 M NaBO₄ buffer, pH 8.4, for determination of tissue glutamate. Pellets were solubilized in 100 µl of 0.5 M NaOH (20 min, 90°) and assayed for protein content (Lowry et al., 1951) .

Determination of glutamate by HPLC. Glutamate was determined by HPLC and fluorimetric detection after precolumn derivatization with o-phtaldialdehyde as described in detail previously (Greber et al., 1994). Basal release rates were defined by the mean glutamate concentrations of two fractions before and two fractions after stimulation. Potassium stimulated glutamate release was calculated by the glutamate concentration in the two fractions obtained during stimulation with high K⁺ and subtraction of basal release. The ratio of potassium stimulated glutamate release during the second and the first stimuli (S₂/S₁) was calculated. Dose-response curves and EC₅₀ values were calculated by sigmoidal analysis using the computer program Origin 4.1.

	Results

Top Summary Introduction Procedures Results Discussion References

Behavioral and neuropathological changes. On injection of KA, rats exposed a typical limbic seizure syndrome, characterized by early staring, "wet dog shakes," and seizures ranging from mild forehead nodding to severe limbic convulsions with rearing and foaming at the mouth, as described in more detail previously (Sperk, 1994; Sperk et al., 1983). Maximal seizure activity was observed in >80% of the rats between 1 and 2 hr after KA injection and declined thereafter. Physically, the rats recovered entirely after 1 week. Rats exhibiting the full seizure syndrome were included in the study. These rats exposed typical neurodegenerative changes in the hippocampal formation (Beu-Ari, 1985; Sperk, 1994). Two days after injection of KA, neurodegeneration was evident by loss of interneurons of the dentate hilus (by 68 ± 9.9%; mean ± standard error) and pyramidal cells in CA1 (by 38 ± 12.5%), CA3a (by 53 ± 8.8%), and CA3c (by 75 ± 9.9%). At the early intervals (4-6 hr after KA injection), neuronal damage was not detected.

In situ hybridization of Y₂ receptor mRNA. In control rats, Y₂ receptor mRNA was expressed preferentially in the pyramidal cell layers of CA3 and CA2 of the dorsal and ventral hippocampus (Figs. 1, 2, and 3). Although the transcript was essentially absent in the CA1 pyramidal neurons and in granule cells of the dorsal hippocampus, it was observed in the respective neurons of the ventral hippocampus, indicating a septotemporal gradient of Y₂ mRNA expression. After KA injection, high concentrations of Y₂ receptor mRNA were found in granule cells of both extensions of the hippocampus (Figs. 1 and 2). Expression of the receptor mRNA was maximally increased after 24 hr in the dorsal (by 740%; Fig. 3) and after 48 hr in the ventral hippocampus (by 190%). It declined slowly thereafter but remained significantly elevated even 30 days after injection of the convulsant (Fig. 3). In the ventral hippocampus, the increase in Y₂ receptor mRNA in granule cells was preceded by an initial decrease (by 73% of control) in message 4-6 hr after KA injection (Figs. 1 and 2). In CA1, slight and transient expression of Y₂ receptor mRNA was detected after 24-48 hr (Fig. 1). No Y₂ receptor mRNA was detected in interneurons of the hippocampus.

View larger version (87K): [in this window] [in a new window]   Fig. 1.   Film autoradiograms of in situ hybridization of Y2 receptor mRNA in the dorsal (top) and ventral hippocampus (center and bottom) are shown for controls (Cont) and at various intervals after KA injection. In controls, Y2 receptor mRNA is highest in CA2/CA3. In the ventral hippocampus, the transcript is also detected in CA1 and the stratum granulosum. Arrowheads, marked increase in Y2 receptor mRNA in the granule cell layer after 12 and 48 hr (h) in the ventral and dorsal hippocampus, respectively, which is still present after 8 days (d) (shown for the ventral hippocampus). Scale bar, 2 mm.

View larger version (92K): [in this window] [in a new window]   Fig. 2.   High-magnification, dark-field photographs of photoemulsion-dipped sections of the ventral hippocampus after in situ hybridization of Y2 receptor mRNA. In controls (Cont), the highest mRNA concentrations are present in the pyramidal cell layer of CA2/CA3. Lower concentrations are found in CA1 and the granule cell layer. At 6 hr (h) after KA-induced seizures, a reduction in Y2 receptor mRNA is seen in the granule cell layer. At later intervals (24 hr), a marked increase in mRNA is seen in the same cells. At this interval, there is more message present in the suprapyramidal than in the infrapyramidal blade of the stratum granulosum. Scale bar, 20 µm.

View larger version (34K): [in this window] [in a new window]   Fig. 3.   Time course of Y2 receptor mRNA expression and 125I-PYY3-36 receptor binding after KA-induced seizures. A, Changes in Y2 receptor mRNA expression for granule and CA3 pyramidal cells of the dorsal hippocampus. Film autoradiograms were evaluated from three to six experimental animals per time interval and 12 age-matched control animals. Note the strong increase in Y2 receptor mRNA in the stratum granulosum after 12-24 hr (h), which persisted (although less prominently) up to 6 months (m). Mostly due to seizure-related neurodegeneration, concentrations of Y2 mRNA become decreased in CA3 pyramidal neurons at later intervals. A similar time course of changes was observed in the ventral hippocampus (data not shown). B, 125I-PYY3-36 receptor binding for the stratum oriens of CA1 and in the hilus of the dentate gyrus. Note the fast but transient increase in Y2 receptor binding in stratum oriens (presumably located prejunctionally on Schaffer collaterals). In the dentate hilus, 125I-PYY3-36 binding presumably is located on mossy fibers (see Discussion); it increases with some delay and remains elevated up to 6 months. In situ hybridization and 125I-PYY3-36 receptor binding were performed in sections of the same animals (three to six experimental animals per interval and 12 age-matched control animals). **p < 0.01, *p < 0.05, compared with control animals by analysis of variance and a Dunnett posteriori test.

Characterization of Y₂ receptor binding by displacement studies. Displacement studies using various peptide analogs at concentrations of 30 and 100 nM are summarized in Table 1. Although PYY, NPY_13-36, and PYY_3-36 potently inhibited ¹²⁵I-PYY_3-36 binding at a concentration of 30 nM, moderate (by 40-45%) inhibition was seen with [Pro³⁴]PYY and PP only at 100 nM. [D-Trp³²]NPY and the nonpeptidergic Y₁ receptor antagonist BIBP 3226 (at concentrations of 5 and 15 µM) did not significantly inhibit ¹²⁵I-PYY_3-36 binding.

Time course of changes in Y₂ receptor binding. In controls, Y₂ receptor binding was observed at high concentrations in the strata oriens and radiatum of CA1 to CA3 (Fig. 4). Considerably lower concentrations were observed in all other areas of the hippocampus, including the hilus and the molecular layer of the dentate gyrus. Only a thin band in the supergranular zone of the inner molecular layer of the dentate gyrus was labeled.

View larger version (63K): [in this window] [in a new window]   Fig. 4.   Y2 receptor autoradiography was performed using 25 pM 125I-PYY3-36 as radioligand. Receptor binding was enhanced in the strata radiatum and oriens of CA1 to CA3 6-24 hr after KA injection. Arrowheads, lasting increase in binding in the hilus of the dentate gyrus, as shown for 24 hr (h) and 8 days (d) after KA injection. Cont, controls. Scale bar, 2 mm.

Kinetic analysis of Y₂ receptor binding. The distinctly different expression of Y₂ receptor mRNA in granule cells versus CA3 pyramidal neurons and the different time courses of changes in Y₂ receptor binding in the hilus compared with the strata radiatum and oriens suggest different mechanisms of Y₂ receptor up-regulation in granule cells/mossy fibers and in CA3 pyramidal neurons/Schaffer collaterals. To investigate this in more detail, we conducted kinetic analysis of ¹²⁵I-PYY_3-36 receptor autoradiography 6 hr after KA injection in the strata oriens and radiatum of CA1 (representing terminal areas of Schaffer collaterals) and after 48 hr in the hilus of the dentate gyrus (a terminal area of mossy fibers that is not overlapping with Schaffer collaterals). Six hours after KA injection, a 2-fold increase in the affinity of ¹²⁵I-PYY_3-36 binding without a significant change in the number of receptor sites was observed in CA1 (Fig. 5A; Table 2). The change in K_d was transient and returned to control levels after 2 days (data not shown). In contrast, in the hilus of the dentate gyrus, a marked (9-fold) increase in the number of Y₂ receptor sites was detected 2 days after KA injection (Fig. 5B; Table 2). Binding affinity was unchanged in this area.

View larger version (26K): [in this window] [in a new window]   Fig. 5.   Kinetic analysis of receptor autoradiography of 125I-PYY3-36 binding to Y2 receptors. Binding was evaluated at various concentrations of the radioligand (A) in the stratum oriens of CA1 (representing binding in Schaffer collaterals) 6 hr (h) after KA injection (identical results were obtained for the stratum radiatum) and (B) in the hilus of the dentate gyrus (representative for presumable binding to mossy fibers) after 48 hr and the respective control rats. For details, see Experimental Procedures; for statistics, see Table 2.

Altered Y₂ receptor-mediated inhibition of glutamate release. This experiment was designed to investigate whether the increased Y₂ receptor affinity may result in increased efficacy of a Y₂ receptor agonist to inhibit glutamate release from Schaffer collaterals. The experiments were done in slices of the dorsal hippocampus from rats 4 hr after KA injection where they contained essentially no detectable Y₂ receptor mRNA or Y₂ receptor binding in the granule cell/mossy fiber system (Figs. 3 and 4). Thus, modulation of K⁺-stimulated glutamate release was primarily mediated through Y₂ receptors on Schaffer collaterals.

View larger version (20K): [in this window] [in a new window]   Fig. 6.   Dose-response curves for inhibition of K+-stimulated glutamate release by the Y2 receptor agonist PYY3-36 in slices of the dorsal hippocampus obtained 4 hr after KA injection and from control animals. EC50 values were 10.5 ± 0.61 and 4.2 ± 0.13 nM in control and KA-treated rats, respectively. At this interval, in the dorsal hippocampus Y2 receptors are not expressed in granule cells/mossy fibers; data therefore indicate a change in receptor affinity in Schaffer collaterals. Values are means of 5-10 independent release experiments per concentration (35 versus 37 experimental points obtained in slices of KA-treated rats and control animals, respectively). **, p < 0.001; *, p < 0.01 compared with control animals.

	Discussion

Top Summary Introduction Procedures Results Discussion References

In accordance with our previous study (Röder et al., 1996), the current results indicate a marked increase in Y₂ receptor binding in the hippocampus of rats after KA induced limbic seizures. Our data demonstrate that these changes are mediated by two regionally different mechanisms: (1) a fast increase in affinity of Y₂ receptors in the strata oriens and radiatum (presumably located there on Schaffer collaterals) and (2) de novo synthesis of Y₂ receptors in granule cells/mossy fibers.

Specificity of ¹²⁵I-PYY_3-36 as Y₂ receptor agonist. PP and [Pro³⁴]PYY, which are thought to be potent agonists at Y₄ and Y₅ sites in transfected cells (but do not bind significantly to Y₂ receptors), only weakly inhibited ¹²⁵I-PYY_3-36 binding (Bard et al., 1995; Blomqvist and Herzog, 1997; Gerald et al., 1996; Hu et al., 1994). In addition, the selective Y₅ receptor ligand [D-Trp³²]NPY did not inhibit this binding. On the other hand, the potent Y₂ agonist NPY_13-36, which exerts only moderate or no activity at Y₄ and Y₅ sites, was similarly active in displacing ¹²⁵I-PYY_3-36 binding as PYY or PYY_3-36. The moderate inhibition by the Y₁, Y₄, and Y₅ agonist [Pro³⁴]PYY and the lack of an effect of the nonpeptidergic, Y₁-selective receptor antagonist BIBP 3226 support the lack of binding of the radioligand to Y₁ receptors. Prominent displacement by PYY excludes binding to Y₃ receptors. There is no evidence for the presence of Y₆ receptors in the hippocampus (originally also referred to as Y₅ receptors; Weinberg et al., 1996). Taken together, these studies indicate that ¹²⁵I-PYY_3-36 under our conditions may bind mainly to Y₂ receptors. Furthermore, the affinities of PYY_3-36 to Y₅ and Y₄ receptors are 7-fold and >1000-fold lower than for Y₂ receptors, respectively (Bard et al., 1995; Blomqvist and Herzog, 1997; Gerald et al., 1996), and the distribution of Y₂ receptors is in excellent agreement with the in situ hybridization data using a Y₂-specific probe.

Increased affinity of Y₂ receptors in Schaffer collaterals. The dense binding sites for ¹²⁵I-PYY_3-36 within the strata oriens and radiatum could be located either on dendrites of pyramidal neurons or terminals of Schaffer collaterals arising from CA3. There is, however, considerable evidence for prejunctional Y₂ receptors located on Schaffer collaterals. Milner and Veznedaroglu (1992) demonstrated NPY-containing terminals near axon terminals in the stratum oriens of CA1 and CA3. Electrophysiological evidence for a presynaptic localization of Y₂ receptors on terminals of Schaffer collaterals and their presynaptic inhibitory action on glutamate release was provided previously (Colmers et al., 1985, 1991; Haas et al., 1987), and Y₂ receptors have been found especially enriched in the strata oriens and radiatum of CA1 to CA3 (Dumont et al., 1996) (Figs. 3 and 4). Further support for a presynaptic localization of Y₂ receptors on Schaffer collaterals comes from the in situ hybridization data. The highest concentrations of Y₂ receptor mRNA are contained in CA3 and CA2 neurons. The fact that minor amounts of Y₂ mRNA are also expressed in CA1 neurons of the ventral hippocampus and, 48 hr after KA injection in the dorsal hippocampus indicates either that some Y₂ receptors may be also present on dendrites of CA1 pyramidal neurons or, more likely, that they become targeted to terminals of CA1-subicular projection neurons.

Increased affinity of Y₂ receptors may facilitate presynaptic inhibition of glutamate release from Schaffer collaterals. The decreased EC₅₀ values found for PYY_3-36 in presynaptic inhibition of glutamate release are in good agreement with the increased affinity of Y₂ receptors in the binding studies and thus indicates a mechanism pertinent to the pathophysiology of KA-induced epilepsy. In control animals and 4 hr after KA injection, almost no Y₂ receptors are present on mossy fibers, and only a minor portion of Y₂ binding is present in the dentate molecular layer. Therefore, glutamate released from mossy fibers may largely contribute to the portion of glutamate release not responding to the Y₂ receptor agonist.

Elevated Y₂ receptor synthesis in granule cells/mossy fibers. In the stratum lucidum, Y₂ receptor binding to mossy fibers overlaps with the strong labeled area of Schaffer collaterals. Binding to mossy fibers was therefore investigated in the hilus of the dorsal dentate gyrus, in which essentially no Y₂ receptors are present in controls. Thus, the concomitant pronounced increases in Y₂ receptor mRNA concentration in granule cells and of the number of Y₂ receptor sites in the hilus of the dentate gyrus are clear indicators of newly synthesized receptors. Essentially no Y₂ receptor mRNA was observed in interneurons of the dentate gyrus of control and KA-treated rats, excluding an other possible localization of Y₂ receptor binding in the hilus. Y₂ receptor mRNA occurs rather early (already after 12 hr) and throughout the granule cell layer. It is not restricted to newly formed granule cells, which are found primarily at the inner surface of the granule cell layer and can be labeled after 3-13 days by incorporation of deoxyuridine (Parent et al., 1997) .

To which mechanisms in epileptogenesis do the changes in Y₂ receptors relate? Changes in Y₂ receptor binding and mRNA expression could be either initiated by the strong and repeated neuronal stimulation during or after acute KA-induced seizures or may be related to adaptive changes in the course of epileptogenesis (Sperk, 1994). Similar to the augmented expression of NPY in mossy fibers (Marksteiner et al., 1990), we are proposing extensive stimulation during epileptic seizures as a primary mechanism. Thus, increases in Y₂ binding in Schaffer collaterals are already maximal before extended neurodegeneration or subsequent plastic changes of mossy fibers are detected. Furthermore, we recently observed similar expression of Y₂ receptor mRNA and binding in granule cells/mossy fibers of electrically kindled rats that are devoid of neuronal damage (Gobbi et al., in press).

NPY may mediate an endogenous anticonvulsive action through Y₂ receptors. It is well established that the hippocampal formation plays a crucial role in the generation and propagation of seizures in temporal lobe epilepsy (Nadler, 1981; Sommer, 1880). In the hippocampus of control rats, NPY is contained within numerous GABAergic interneurons (Köhler et al., 1986). Some of these interneurons are terminating prejunctionally on Schaffer collaterals (Milner and Veznedaroglu, 1992). In CA3 and CA1, NPY inhibits glutamate release from these fibers through Y₂ receptors (Colmers et al., 1991). During the acute seizures, reaching their maximal extent 90 min after KA injection, a rapid decrease in NPY levels indicates pronounced release of the peptide (Bellmann et al., 1991). In conjunction with the rapid increase in Y₂ receptor affinity, this may represent an important mechanism for suppressing excessive glutamate release from Schaffer collaterals and counteracting the spread of excitation through the hippocampal circuits. The possible relevance of this mechanism is underscored by our current work on glutamate release ex vivo. Furthermore, NPY infused into the brain has a potent anticonvulsive action (Smialowska et al., 1996; Woldbye et al., 1996), and NPY-deficient mice exhibit an increased seizure susceptibility (Erickson et al., 1996) .