|
|
|
|
Vol. 53, Issue 2, 177-181, February 1998
Departments of Molecular Sciences (W.-J.C., W.H., S.A.,W.D., M.L.), Receptor Biochemistry (C.J., C.W., L.W., G.C., T.K.), and Virology (R.F., L.B.), Glaxo Wellcome Research and Development, 5 Moore Drive, Research Triangle Park, North Carolina 27709
| |
Summary |
|---|
|
|
|---|
This article describes the transient expression of the CXC chemokine
receptor-4 in Xenopus laevis melanophores
and the resulting functional assay for the endogenous ligand for this
receptor stromal cell-derived factor (SDF)-1
. Specifically, it will
be shown that SDF-1
produces increased light transmittance in
transfected cells that is consistent with the activation of
Gi protein. This stimulus pathway is further implicated by
the abolition of this response after pretreatment of the cells with
pertussis toxin, a known method for the inactivation of Gi
protein. The fact that SDF-1
does not produce responses in
nontransfected cells and that treatment of the cells with 12G5, an
antibody specific for the CXC chemokine receptor-4, eliminates this
response indicates that this ligand produces responses by activation of
this receptor in these cells. The possible relevance to human
immunodeficiency virus (HIV) entry into cells was explored by observing
the effects of SDF-1
on HIV-mediated cell fusion. It was found that
SDF-1
blocked cell-to-cell fusion (as has been previously reported)
at concentrations 1200-fold greater than those required to produce
Gi protein mediated responses. The implications of the
functional assay to screening for new drugs to block HIV-mediated
fusion is discussed.
| |
Introduction |
|---|
|
|
|---|
The
discovery that HIV-1 utilizes seven transmembrane receptors as
coreceptors for viral fusion has introduced a new target into the
therapeutic field of view. Studies on HIV-1 envelope-mediated cell
fusion have identified a 46-kDa, integral membrane protein named
"fusin" that serves as a cofactor for HIV fusion and entry (Feng
et al., 1996
). Fusin is a 352-amino-acid,
seven-transmembrane receptor, the sequence of which is identical to a
previously cloned orphan receptor denoted LESTR (leukocyte-derived
seven-transmembrane domain receptor). Sequence comparison has shown
that fusin (or LESTR) is a member of the CXC chemokine receptor family
with a sequence homology to the CXCR2 receptor (Loetscher et
al., 1994
; Raport et al., 1996
; Wells et
al., 1996
). The identification of SDF-1
(a CXC chemokine) as a
ligand for fusin has led to the suggested classification of this
receptor as CXCR4 in the chemokine receptor nomenclature system (Bleul
et al., 1996
; Oberlin et al., 1996
).
This article describes the construction of a receptor assay in which
the human CXCR4 couples to Gi-protein in
recombinant Xenopus laevis melanophores. In these cells,
melanosome dispersion can be affected via activation of adenylyl
cyclase (Potenza et al., 1992
; McClintock et al.,
1993
) or phospholipase C (Graminski et al., 1993
), whereas
melanosome aggregation results from the inhibition of adenylyl cyclase
(Potenza et al., 1992
; McClintock et al., 1993
).
Melanophore cells contain a wide range of
G
-proteins (Jayawickreme et al.,
1994
); therefore, the expression of numerous foreign G protein-coupled
receptors can be facilitated (Potenza et al., 1992
, 1994
;
Karne et al., 1993
; McClintock et al., 1993
; Graminski et al., 1993
and 1994
; Jayawickreme et
al., 1994a
, 1994b
; Lerner, 1994
). Because both states of
intracellular melanosome distribution (dispersion or aggregation) are
easily detectable, various G protein-coupled receptors have been
studied by monitoring ligand-mediated melanosome translocation, either
by measuring the change in light transmittance through the cells or by
imaging the cell response (Potenza et al., 1992
, 1994
; Karne
et al., 1993
; McClintock et al., 1993
; Graminski
et al., 1993
and 1994
; Jayawickreme et al.,
1994a
, 1994b
; Lerner, 1994
).
We will show that SDF-1
mediates responses through CXCR4 and
Gi protein; thus, the assay can be used to study
ligand/receptor interaction. Although the implications of this
functional linkage to viral fusion are presently unclear, the assay has
utility as an indicator of receptor conformational states, and
therefore as a CXCR4 screen.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
Leibovitz (L-15) medium was purchased from Sigma
Chemical (St. Louis, MO), BSA was obtained from Boehringer Mannheim
(Indianapolis, IN) and pertussis toxin was obtained from Calbiochem (La
Jolla, CA). 12G5 antibody was generously provided by Jim Hoxie
(University of Pennsylvania, Philadelphia, PA). The full-length cDNAs
for CXCR4 and SDF-1
were kindly provided by Dr. Christine Power
(Glaxo Wellcome, Geneva, Switzerland).
Construction of expression vectors.
The full-length cDNA for
CXCR4 was cloned by a reverse transcriptase-PCR strategy. The sets of
primers used for PCR were designed according to the GeneBank accession
number M99293. The full-length cDNA of human SDF-1
was cloned by
screening a human spleen cDNA library using the mouse SDF cDNA as a
probe (R. B. Furness and C. Power, personal communication, 1997).
cDNA corresponding to the mature form of the protein (no
signal sequence). One primer included the 5
-untranslated region of the
bacteriophage T7 gene10A before the region coding for the amino
terminus of SDF-1
. The sequences of primers are listed below:
5
-
:
TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAAGCCCGTCAGCCTGAGCTACAG; 3
-
: ACGCGTCACTTGTTTAAAGCTTTCTCCAGGTACTC. The SDF-1
PCR fragment was inserted into the plasmid pCRII (InVitrogen, San Diego, CA) forming
pCRII/SDF1
. An XbaI-SacI fragment was excised
and inserted between the XbaI-SacI sites in
pTX007, forming pTXSDFA9 (Dallas et al., 1992Expression and purification of SDF-1
.
Strain BL21[DE3]
expressing SDF-1
was grown until absorbance was 0.6 at 37°, and
induced by 0.25 mM isopropyl
-D-thiogalactoside for 3 hr. SDF-1
was purified to
homogeneity using a three-column step procedure. The cell pellets were
resuspended in a lysis buffer (50 mM HEPES, pH 7.4, 1 mM EDTA, 1 µg/ml aprotinin, 1 µg/ml leupeptin and 10 µM 4-amidinophenylmethanesulfonyl fluoride) and disrupted by a French pressure cell (SLM Instruments, Rochester, NY). After a
low-speed centrifugation, the pellet was washed with lysis buffer and
solubilized in a 8 M urea buffer (8 M urea, 20 mM dithiothreitol, and 1 mM EDTA) overnight.
The solubilized material was loaded onto SP Sepharose columns and
eluted with the same buffer containing 1 M NaCl. The
SDF-containing fractions were identified by SDS-polyacrylamide gel
electrophoresis and pooled. After renaturation in a buffer containing
0.1 M Tris·HCl, pH 8.0 and 0.1 mM
glutathione, the proteins were loaded onto two tandem HiTrap SP
Sepharose columns (Pharmacia Biotech, Piscataway, NJ) and eluted by a
NaCl gradient in 25 mM Tris·HCl, pH 8.0. The fractions
containing SDF-1
were loaded onto a reversed-phase poros column and
eluted with an acetonitrile gradient in 0.1% trifluoroacetic acid. The
purified SDF-1
was speed-vacuum-dried to complete dryness, and then
resuspended in phosphate-buffered saline (0.2 g/liter KCl, 0.2 g/liter
KH2PO4, 8 g/liter NaCl, 2.16 g/liter
Na2HPO4·7H2O) and stored at
80° until use.
Functional bioassay.
Melanophores were maintained in cell
cultures as described previously (Jayawickreme et al.,
1994a
, 1994b
). Transient expression of CXCR4 plasmid DNA in
melanophores was achieved after electroporation (Graminski et
al., 1993
; Jayawickreme et al., 1994
). After
electroporation, cells were seeded into flat-bottomed, 96-well, tissue
culture plates (Falcon Plastics, Oxnard, CA) to a density of 40,000 cells/well in conditioned fibroblast medium and incubated at 27° for
24-48 hr.
Tf/Ti)
(Jayawickreme et al., 1994aViral fusion assay.
An HIV-mediated fusion assay was
developed based on the coculture of human embryonic kidney 293 cells
stably transfected with pHIV
RTBstEII (Kellam and Larder,
1994
), designated 293
RT, and 1G5, a Jurkat T cell line containing a
long terminal repeat-luciferase gene (Aguilar-Cordova et
al., 1994
). The 293
RT cells express HIV-1 gene products (except
reverse transcriptase) and readily induce syncytia formation when
co-cultured with
CD4+/CXCR4+ cells (R. Ferris, and L. Boone, unpublished observations, 1997). The 1G5 cell
line is susceptible to T cell line tropic HIV and, after infection,
expresses luciferase from the transfected HIV long terminal
repeat-luciferase reporter gene. Coculture of 293
RT cells with 1G5
cells results in fusion and tat-mediated activation of luciferase.
to block HIV-mediated cell-to-cell fusion was
determined by measuring its effect on the activation of luciferase.
293
RT cells were plated at 5 × 104
cells/well (96-well cell culture plate) in RPMI 1640, 10% fetal bovine
serum and allowed to grow overnight. 1G5 cells were added to a final
concentration of 1 × 105cells/well in the
same medium containing indicated concentrations of SDF-1
and
coculture was continued for 5 hours. Media was removed and cells were
lysed with 200 µl of lysis buffer (Luciferase Assay System; Promega,
Madison, Wisconsin) for 20 min at room temperature followed by one
freeze/thaw cycle. Luciferase activity was measured by incubating 20 µl of lysate with 50 µl of luciferase reagent (Promega) and reading
them immediately in a luminometer (ML1000; Dynatech Laboratories,
Chantilly, VA). Duplicate samples were averaged.
| |
Results and Discussion |
|---|
|
|
|---|
SDF-1
is a CXC chemokine produced by bone marrow stromal cells
characterized by a typical four-cysteine motif (Baggiolini et
al., 1994
). There are two spliced forms of SDF-1, SDF-1
and SDF-1
. The amino acid sequences of SDF-1
and -
are identical for the first 89 amino acids, but SDF-1
has four additional amino acids at the carboxyl terminus. This chemokine is known to have multiple biological activities [e.g., proliferation of B cell progenitors (Tashiro et al., 1993
; Nagasawa et
al., 1994
) and production of lymphocyte migration (Bleul et
al., 1996
)]. To test the functional activities of SDF-1
, the
cDNA for this protein was first cloned and expressed.
A T7 polymerase-based Escherichia coli expression system was
used to express recombinant SDF-1
. pCRII is a plasmid designed for
cloning PCR fragments with an unpaired A residue at each 3
-end. Because this plasmid also has a T7 promoter near the site of fragment insertion, we anticipated that by adding a ribosome binding region to
the SDF-1
cDNA before cloning, the T7 promoter could be used to
enhance expression. Results of the induction experiments with pCRII/SDF-1
in BL21[DE3] showed that initially (1 hr after
induction), SDF-1
was one of the major proteins, but after 3 hr, it
was almost totally degraded. We transferred the SDF-1
fragment from
pCRII/SDF1
to pTX007, a plasmid we had used successfully for high
level expression of a variety of proteins. When induced,
BL21[DE3](pTXSDFA9) made SDF-1
to the extent that it was the major
protein 1 hr after induction. The protein continued to accumulate and,
over time, formed inclusion bodies. A three-step purification procedure
was developed including the separation of renatured SDF-1
from
denatured proteins. The purified proteins were analyzed on an SDS gel
as shown in Fig. 1A. Amino-terminal
sequence determination showed that the initiator methionine residue was
not removed; therefore, recombinant SDF-1
differs from the native
form. The deduced amino acid sequences of SDF-1
are shown in Fig.
1B.
|
SDF-1
has recently been shown to be a ligand for CXCR4 and to
produce calcium responses in Chinese hamster ovary cells stably transfected with CXCR4 (Bleul et al., 1996
; Oberlin et
al., 1996
). Accordingly, a functional assay for CXCR4 was
established. SDF-1
produced a concentration-dependent aggregation
response in melanophores transfected with CXCR4 cDNA. Fig.
2 shows the response to SDF-1
measured
at timepoints 30 to 210 min. It can be seen that a steady state with
SDF-1
was obtained after 90 min; the concentration producing
ED50 was found to be 40 pM in the
experiment shown. The mean ED50 from nine
experiments is 53 ± 11 pM. One feature of
Gi protein-coupled receptor effects in
melanophores is the time-dependence of the response. Specifically, once
Gi protein has been activated, the cell must
reach a new steady state with respect to the altered cytosolic level of
cyclic AMP; the time for this effect can vary. This property of
melanophores makes temporal study of Gi-mediated
responses important for the determination of the potency of agonists.
The changing responses with time probably do not reflect the temporal
interaction of SDF-1
and CXCR4, because the
ED50 does not change after 30 min. Rather, the
increased asymptotic response reflects the clearance of endogenous
cyclic AMP in the presence of a new setpoint of
Gi activation (Potenza et al., 1994
). Although CXCR4 is similar to IL-8 receptors (CXCR1, CXCR2), IL-8 did
not produce activation of CXCR-4 in melanophores (Fig. 2). No response
to SDF-1
was observed in melanophores not transfected with CXCR4 or
CXCR1 (data not shown). The involvement of
Gi-protein in the response to SDF-1
was
suggested by the fact that the ligand-mediated response is abolished in
transfected cells treated with pertussis toxin (Fig.
3), a treatment that inactivates
Gi protein.
|
|
To further examine the interaction of SDF-1
with the CXCR4,
experiments were done on melanophores pretreated with 12G5, a monoclonal antibody specific for CXCR4 (Endres et al.,
1996
). As shown in Fig. 4, pretreatment
of transfected melanophores with 12G5 produced an inhibition of the
SDF-1
response. The dose-response curve to SDF-1
was shifted to
the right by a factor of 100 after treatment with 12G5 antibody.
|
SDF-1
has been shown to block T cell trophic HIV-1 cell-to-cell
fusion and infection (Oberlin et al., 1996
). We wanted to determine the relative potency of SDF-1
as an agonist and its potency as an inhibitor of HIV-1 mediated cell-to-cell fusion, and
verify that the amino-terminal methionine did not compromise the
anti-HIV activity. Fusion was measured in a coculture system that
utilizes a luciferase reporter system (Aguilar-Cordova et al., 1994
). Preliminary experiments (not shown) indicated that luciferase activity increased continuously over the first 8-10 hr of
coculture and could be completely blocked with soluble CD4 if present
within the first 2 hr of coculture. We tested SDF-1
for the ability
to block fusion in this assay; the data are shown in Fig.
5A. The induction of luciferase activity
was blocked by SDF-1
in a concentration-dependent manner. An
IC50 value of 23 ± 4 nM
(n = 16) was calculated for SDF-
. Control
experiments (not shown) indicated that SDF-1
had no direct
inhibitory effect on luciferase gene expression or enzyme activity in
cells that did not contain CXCR4.
|
The monoclonal antibody for CXCR4, 12G5, shown to be an antagonist in
the melanophore system, is also known to block HIV-1 mediated
cell-to-cell fusion (McKnight et al., 1997
). This result was
confirmed in these studies (Fig. 5B), in which the
IC50 was found to be 3.5 µg/ml (±1.1 µg/ml,
n = 2) when the antibody was preincubated with cells
for 1 hr before coculture. An isotype control antibody did not inhibit
fusion over a range of concentrations up to 10 µg/ml.
The involvement of seven transmembrane receptors, such as CXCR4 in HIV
viral fusion, has broad implications for the treatment of this disease.
The discovery that seven transmembrane receptors are required for HIV-1
entry into cells offers a pharmacologically and chemically tractable
target. Thus, if interaction of CXCR4 with either CD4 and/or the viral
envelope (through gp120) can be disrupted, then the sequential process
initiated by the tripartite protein interaction may stop fusion of
cells (and subsequent viral entry). This is indicated by the blockade
of viral fusion by SDF-1
. It is presently unclear whether activation
of CXCR4 is required for the process of viral fusion, but the data
showing that viral fusion is blocked by the 12G5 antibody, a ligand
that does not produce responses in the melanophore system, indicates
that this is not a requirement. This behavior is similar to the studies on chemokine receptor 5 as a coreceptor for HIV-mediated fusion where
indirect evidence for the lack of receptor activation (with respect to
G-protein) was obtained with CCR5/CCR2b receptor chimeras and mutants
(Edinger et al., 1997
; Farzan et al., 1997
). In
these studies, mutant receptors that were unable to mediate
physiological responses facilitated viral fusion nevertheless.
Although receptor activation does not seem to be required for
inhibition of viral fusion, the relationship between ligand occupancy
and receptor activation is unclear. Specifically, if ligand occupation
of CXCR4 is required to block viral fusion, then the concentration of
CXCR4 agonist ligand useful for protection against HIV-1 infection may
be considerably greater than the ED50 for
Gi protein activation. This is attributable to
the well-known disparity between physiological responses and receptor
occupancy brought on by agonist intrinsic efficacy and amplification of signals through stimulus-response mechanisms (i.e., effective receptor
reserve). This is suggested by the 434-fold increase in concentration
of SDF-1
(over the ED50 for melanophore
response) required to inhibit viral fusion. The fact that the
dose-response curve to SDF-1
was shifted 100-fold to the right by
12G5 antibody indicates a considerable effective receptor reserve in
this preparation for this ligand.
Under these circumstances, achieving a saturating receptor occupancy by
SDF-1
may require considerably higher concentrations of SDF-1
than the pharmacologic ED50. A further unknown in
the comparison of the two systems is the unknown receptor densities on
the two cell lines. This latter factor may further distance the
concentrations required to activate Gi proteins
and prevent cell fusion. Further studies are required to elucidate the
relationship between G protein activation by CXCR-4 and the role of
this receptor as an HIV coreceptor for viral entry.
The ability to monitor CXCR4 function still has broad implications for the screening of receptor active ligands and therapeutic approaches in this area. Presently, the extent to which the screening of CXCR4 function in a seven-transmembrane receptor system will assist in finding drugs to inhibit viral fusion is unknown. The theoretical basis of this approach is that the melanophore/Gi-protein matrix will function as a detection system for CXCR4 conformational states and that these will translate into differences in the interaction of the CXCR4 receptor and proteins of the HIV viral coat.
| |
Acknowledgments |
|---|
We wish to acknowledge Jay Levy and Carl Mackewicz for
introducing us to the 1G5 reporter system and Randall Lanier and
Richard Hazen for their help in establishing the system in-house. We
also wish to thank Martin Rink and Jeff Robbins (GlaxoWellcome Research and Development) for scale up of SDF-1
. In addition, we appreciate the efforts of Tom Rimele for advice and support, Ken Queen for preparing the plasmids, Howard Sauls for data analysis, and Jill Haizlip for cell culture. We thank Brendan Larder (Glaxo-Wellcome) for
providing the pHIV
RTBstEII clone. We also wish to thank James Hoxie
of University of Pennsylvania for the gift of 12G5 antibody. Finally,
we wish to thank Mrs. Donna McGhee for her expert assistance in the
preparation of this manuscript.
| |
Footnotes |
|---|
Received August 29. 1997; Accepted October 29, 1997
Send reprint requests to: Terry Kenakin, Ph.D., Department of Receptor Biochemistry, Glaxo Wellcome Research and Development, 5 Moore Drive, Research Triangle Park, NC 27709.
| |
Abbreviations |
|---|
HIV-1, human immunodeficiency virus type 1; CXCRx, CXC chemokine receptor, where x is the receptor number; SDF, stromal cell-derived factor; BSA, bovine serum albumin; PCR, polymerase chain reaction; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid; SDS, sodium dodecyl sulfate; ED50, dose effective on 50% of the population.
| |
References |
|---|
|
|
|---|
CXC and CC chemokines.
Adv Immunol
55:
97-179[Medline].
-mediated signaling are independent functions of chemokine receptor CCR5.
J Biol Chem
272:
6854-6857
-melanocyte-stimulating hormone antagonists.
J Biol Chem
269:
29846-29854This article has been cited by other articles:
![]() |
O. D. Schneider, A. A. Weiss, and W. E. Miller Pertussis Toxin Signals through the TCR to Initiate Cross-Desensitization of the Chemokine Receptor CXCR4 J. Immunol., May 1, 2009; 182(9): 5730 - 5739. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yoon, Z. Liang, X. Zhang, M. Choe, A. Zhu, H. T. Cho, D. M. Shin, M. M. Goodman, Z. Chen, and H. Shim CXC Chemokine Receptor-4 Antagonist Blocks Both Growth of Primary Tumor and Metastasis of Head and Neck Cancer in Xenograft Mouse Models Cancer Res., August 1, 2007; 67(15): 7518 - 7524. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Juarez, R. Baraz, S. Gaundar, K. Bradstock, and L. Bendall Interaction of interleukin-7 and interleukin-3 with the CXCL12-induced proliferation of B-cell progenitor acute lymphoblastic leukemia Haematologica, April 1, 2007; 92(4): 450 - 459. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.-N. N'Diaye and E. J. Brown The ubiquitin-related protein PLIC-1 regulates heterotrimeric G protein function through association with G{beta}{gamma} J. Cell Biol., December 8, 2003; 163(5): 1157 - 1165. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kanda, Y. Mochizuki, and H. Kanetake Stromal Cell-derived Factor-1alpha Induces Tube-like Structure Formation of Endothelial Cells through Phosphoinositide 3-Kinase J. Biol. Chem., January 3, 2003; 278(1): 257 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Chen, J. Way, S. Armour, C. Watson, K. Queen, C. K. Jayawickreme, W.-J. Chen, and T. Kenakin Use of Constitutive G Protein-Coupled Receptor Activity for Drug Discovery Mol. Pharmacol., January 1, 2000; 57(1): 125 - 134. [Abstract] [Full Text] |
||||
![]() |
M. E. Nuttall, J. C. Lee, P. R. Murdock, A. M. Badger, F.-L. Wang, J. T. Laydon, G. A. Hofmann, G. R. Pettman, J. A. Lee, A. Parihar, et al. Amphibian Melanophore Technology as a Functional Screen for Antagonists of G-Protein Coupled 7-Transmembrane Receptors J Biomol Screen, October 1, 1999; 4(5): 269 - 277. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||