MolPharm

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, W.-J.
Right arrow Articles by Kenakin, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, W.-J.
Right arrow Articles by Kenakin, T.

Vol. 53, Issue 2, 177-181, February 1998


ACCELERATED COMMUNICATION
Recombinant Human CXC-Chemokine Receptor-4 in Melanophores Are Linked to Gi Protein: Seven Transmembrane Coreceptors for Human Immunodeficiency Virus Entry into Cells

Wen-Ji Chen, Channa Jayawickreme, Chris Watson, Larry Wolfe, William Holmes, Robert Ferris, Susan Armour, Walter Dallas, Grace Chen, Larry Boone, Michael Luther, and Terry Kenakin

Departments of Molecular Sciences (W.-J.C., W.H., S.A.,W.D., M.L.), Receptor Biochemistry (C.J., C.W., L.W., G.C., T.K.), and Virology (R.F., L.B.), Glaxo Wellcome Research and Development, 5 Moore Drive, Research Triangle Park, North Carolina 27709

    Summary
Top
Summary
Introduction
Procedures
Results & Discussion
References

This article describes the transient expression of the CXC chemokine receptor-4 in Xenopus laevis melanophores and the resulting functional assay for the endogenous ligand for this receptor stromal cell-derived factor (SDF)-1alpha . Specifically, it will be shown that SDF-1alpha produces increased light transmittance in transfected cells that is consistent with the activation of Gi protein. This stimulus pathway is further implicated by the abolition of this response after pretreatment of the cells with pertussis toxin, a known method for the inactivation of Gi protein. The fact that SDF-1alpha does not produce responses in nontransfected cells and that treatment of the cells with 12G5, an antibody specific for the CXC chemokine receptor-4, eliminates this response indicates that this ligand produces responses by activation of this receptor in these cells. The possible relevance to human immunodeficiency virus (HIV) entry into cells was explored by observing the effects of SDF-1alpha on HIV-mediated cell fusion. It was found that SDF-1alpha blocked cell-to-cell fusion (as has been previously reported) at concentrations 1200-fold greater than those required to produce Gi protein mediated responses. The implications of the functional assay to screening for new drugs to block HIV-mediated fusion is discussed.

    Introduction
Top
Summary
Introduction
Procedures
Results & Discussion
References

The discovery that HIV-1 utilizes seven transmembrane receptors as coreceptors for viral fusion has introduced a new target into the therapeutic field of view. Studies on HIV-1 envelope-mediated cell fusion have identified a 46-kDa, integral membrane protein named "fusin" that serves as a cofactor for HIV fusion and entry (Feng et al., 1996). Fusin is a 352-amino-acid, seven-transmembrane receptor, the sequence of which is identical to a previously cloned orphan receptor denoted LESTR (leukocyte-derived seven-transmembrane domain receptor). Sequence comparison has shown that fusin (or LESTR) is a member of the CXC chemokine receptor family with a sequence homology to the CXCR2 receptor (Loetscher et al., 1994; Raport et al., 1996; Wells et al., 1996). The identification of SDF-1alpha (a CXC chemokine) as a ligand for fusin has led to the suggested classification of this receptor as CXCR4 in the chemokine receptor nomenclature system (Bleul et al., 1996; Oberlin et al., 1996).

This article describes the construction of a receptor assay in which the human CXCR4 couples to Gi-protein in recombinant Xenopus laevis melanophores. In these cells, melanosome dispersion can be affected via activation of adenylyl cyclase (Potenza et al., 1992; McClintock et al., 1993) or phospholipase C (Graminski et al., 1993), whereas melanosome aggregation results from the inhibition of adenylyl cyclase (Potenza et al., 1992; McClintock et al., 1993). Melanophore cells contain a wide range of Galpha -proteins (Jayawickreme et al., 1994); therefore, the expression of numerous foreign G protein-coupled receptors can be facilitated (Potenza et al., 1992, 1994; Karne et al., 1993; McClintock et al., 1993; Graminski et al., 1993 and 1994; Jayawickreme et al., 1994a, 1994b; Lerner, 1994). Because both states of intracellular melanosome distribution (dispersion or aggregation) are easily detectable, various G protein-coupled receptors have been studied by monitoring ligand-mediated melanosome translocation, either by measuring the change in light transmittance through the cells or by imaging the cell response (Potenza et al., 1992, 1994; Karne et al., 1993; McClintock et al., 1993; Graminski et al., 1993 and 1994; Jayawickreme et al., 1994a, 1994b; Lerner, 1994).

We will show that SDF-1alpha mediates responses through CXCR4 and Gi protein; thus, the assay can be used to study ligand/receptor interaction. Although the implications of this functional linkage to viral fusion are presently unclear, the assay has utility as an indicator of receptor conformational states, and therefore as a CXCR4 screen.

    Experimental Procedures
Top
Summary
Introduction
Procedures
Results & Discussion
References

Materials. Leibovitz (L-15) medium was purchased from Sigma Chemical (St. Louis, MO), BSA was obtained from Boehringer Mannheim (Indianapolis, IN) and pertussis toxin was obtained from Calbiochem (La Jolla, CA). 12G5 antibody was generously provided by Jim Hoxie (University of Pennsylvania, Philadelphia, PA). The full-length cDNAs for CXCR4 and SDF-1beta were kindly provided by Dr. Christine Power (Glaxo Wellcome, Geneva, Switzerland).

Construction of expression vectors. The full-length cDNA for CXCR4 was cloned by a reverse transcriptase-PCR strategy. The sets of primers used for PCR were designed according to the GeneBank accession number M99293. The full-length cDNA of human SDF-1beta was cloned by screening a human spleen cDNA library using the mouse SDF cDNA as a probe (R. B. Furness and C. Power, personal communication, 1997).

CXCR4 was subcloned as a HindIII/XbaI fragment into the melanophore expression vector, pJG3.6 (Graminski et al., 1993). CXCR4 plasmid DNA used for melanophore transfections was prepared by a modification of the triton-lysozyme method and double-banded in CsCl/ethidium bromide equilibrium gradients as described (Davis et al., 1994).

Oligonucleotide primers were designed for PCR amplification of the SDF-1alpha cDNA corresponding to the mature form of the protein (no signal sequence). One primer included the 5'-untranslated region of the bacteriophage T7 gene10A before the region coding for the amino terminus of SDF-1alpha . The sequences of primers are listed below: 5'-alpha : TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAAGCCCGTCAGCCTGAGCTACAG; 3'-alpha : ACGCGTCACTTGTTTAAAGCTTTCTCCAGGTACTC. The SDF-1alpha PCR fragment was inserted into the plasmid pCRII (InVitrogen, San Diego, CA) forming pCRII/SDF1alpha . An XbaI-SacI fragment was excised and inserted between the XbaI-SacI sites in pTX007, forming pTXSDFA9 (Dallas et al., 1992).

Expression and purification of SDF-1alpha . Strain BL21[DE3] expressing SDF-1alpha was grown until absorbance was 0.6 at 37°, and induced by 0.25 mM isopropyl beta -D-thiogalactoside for 3 hr. SDF-1alpha was purified to homogeneity using a three-column step procedure. The cell pellets were resuspended in a lysis buffer (50 mM HEPES, pH 7.4, 1 mM EDTA, 1 µg/ml aprotinin, 1 µg/ml leupeptin and 10 µM 4-amidinophenylmethanesulfonyl fluoride) and disrupted by a French pressure cell (SLM Instruments, Rochester, NY). After a low-speed centrifugation, the pellet was washed with lysis buffer and solubilized in a 8 M urea buffer (8 M urea, 20 mM dithiothreitol, and 1 mM EDTA) overnight. The solubilized material was loaded onto SP Sepharose columns and eluted with the same buffer containing M NaCl. The SDF-containing fractions were identified by SDS-polyacrylamide gel electrophoresis and pooled. After renaturation in a buffer containing 0.1 M Tris·HCl, pH 8.0 and 0.1 mM glutathione, the proteins were loaded onto two tandem HiTrap SP Sepharose columns (Pharmacia Biotech, Piscataway, NJ) and eluted by a NaCl gradient in 25 mM Tris·HCl, pH 8.0. The fractions containing SDF-1alpha were loaded onto a reversed-phase poros column and eluted with an acetonitrile gradient in 0.1% trifluoroacetic acid. The purified SDF-1alpha was speed-vacuum-dried to complete dryness, and then resuspended in phosphate-buffered saline (0.2 g/liter KCl, 0.2 g/liter KH2PO4, 8 g/liter NaCl, 2.16 g/liter Na2HPO4·7H2O) and stored at -80° until use.

Functional bioassay. Melanophores were maintained in cell cultures as described previously (Jayawickreme et al., 1994a, 1994b). Transient expression of CXCR4 plasmid DNA in melanophores was achieved after electroporation (Graminski et al., 1993; Jayawickreme et al., 1994). After electroporation, cells were seeded into flat-bottomed, 96-well, tissue culture plates (Falcon Plastics, Oxnard, CA) to a density of 40,000 cells/well in conditioned fibroblast medium and incubated at 27° for 24-48 hr.

The ligand mediated responses in recombinant melanophores were monitored by measuring the change in transmittance using an SLT Spectra plate reader (Austria). For each experiment, media was removed from the plates and replaced with 0.7× L-15/0.1% BSA containing test drugs. Soon after the addition of reagents, the zero time reading (Ti) was obtained. The plates were then placed in the dark and read at appropriate time intervals (Tf). The extent of the response was quantified as (1 - Tf/Ti) (Jayawickreme et al., 1994a; Potenza et al., 1994).

In the studies employing pertussis toxin, the transfected cells were incubated overnight (16-18 hr) in conditioned fibroblast medium with 1 µg/ml of pertussis toxin. Just before the assay, the media was removed and replaced with 0.7× L-15/0.1% BSA containing various reagents and/or drugs. In studies employing 12G5 antibody, the cells were incubated with antibody at a concentration of 16.9 µg/ml in 0.7× L-15/0.1% BSA media for 30 min before assaying.

Viral fusion assay. An HIV-mediated fusion assay was developed based on the coculture of human embryonic kidney 293 cells stably transfected with pHIVDelta RTBstEII (Kellam and Larder, 1994), designated 293Delta RT, and 1G5, a Jurkat T cell line containing a long terminal repeat-luciferase gene (Aguilar-Cordova et al., 1994). The 293Delta RT cells express HIV-1 gene products (except reverse transcriptase) and readily induce syncytia formation when co-cultured with CD4+/CXCR4+ cells (R. Ferris, and L. Boone, unpublished observations, 1997). The 1G5 cell line is susceptible to T cell line tropic HIV and, after infection, expresses luciferase from the transfected HIV long terminal repeat-luciferase reporter gene. Coculture of 293Delta RT cells with 1G5 cells results in fusion and tat-mediated activation of luciferase.

The ability of SDF-1alpha to block HIV-mediated cell-to-cell fusion was determined by measuring its effect on the activation of luciferase. 293Delta RT cells were plated at 5 × 104 cells/well (96-well cell culture plate) in RPMI 1640, 10% fetal bovine serum and allowed to grow overnight. 1G5 cells were added to a final concentration of 1 × 105cells/well in the same medium containing indicated concentrations of SDF-1alpha and coculture was continued for 5 hours. Media was removed and cells were lysed with 200 µl of lysis buffer (Luciferase Assay System; Promega, Madison, Wisconsin) for 20 min at room temperature followed by one freeze/thaw cycle. Luciferase activity was measured by incubating 20 µl of lysate with 50 µl of luciferase reagent (Promega) and reading them immediately in a luminometer (ML1000; Dynatech Laboratories, Chantilly, VA). Duplicate samples were averaged.

    Results and Discussion
Top
Summary
Introduction
Procedures
Results & Discussion
References

SDF-1alpha is a CXC chemokine produced by bone marrow stromal cells characterized by a typical four-cysteine motif (Baggiolini et al., 1994). There are two spliced forms of SDF-1, SDF-1alpha and SDF-1beta . The amino acid sequences of SDF-1alpha and -beta are identical for the first 89 amino acids, but SDF-1beta has four additional amino acids at the carboxyl terminus. This chemokine is known to have multiple biological activities [e.g., proliferation of B cell progenitors (Tashiro et al., 1993; Nagasawa et al., 1994) and production of lymphocyte migration (Bleul et al., 1996)]. To test the functional activities of SDF-1alpha , the cDNA for this protein was first cloned and expressed.

A T7 polymerase-based Escherichia coli expression system was used to express recombinant SDF-1alpha . pCRII is a plasmid designed for cloning PCR fragments with an unpaired A residue at each 3'-end. Because this plasmid also has a T7 promoter near the site of fragment insertion, we anticipated that by adding a ribosome binding region to the SDF-1alpha cDNA before cloning, the T7 promoter could be used to enhance expression. Results of the induction experiments with pCRII/SDF-1alpha in BL21[DE3] showed that initially (1 hr after induction), SDF-1alpha was one of the major proteins, but after 3 hr, it was almost totally degraded. We transferred the SDF-1alpha fragment from pCRII/SDF1alpha to pTX007, a plasmid we had used successfully for high level expression of a variety of proteins. When induced, BL21[DE3](pTXSDFA9) made SDF-1alpha to the extent that it was the major protein 1 hr after induction. The protein continued to accumulate and, over time, formed inclusion bodies. A three-step purification procedure was developed including the separation of renatured SDF-1alpha from denatured proteins. The purified proteins were analyzed on an SDS gel as shown in Fig. 1A. Amino-terminal sequence determination showed that the initiator methionine residue was not removed; therefore, recombinant SDF-1alpha differs from the native form. The deduced amino acid sequences of SDF-1alpha are shown in Fig. 1B.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 1.   A, SDS-polyacrylamide gel electrophoresis analysis of purified SDF-1alpha . SDF-1alpha was purified as described in Experimental Procedures. One microgram (lane 1) or 2 µg (lane 2) of purified protein was loaded onto a 4-20% SDS gel and stained with Coomassie Brilliant Blue. The protein molecular mass standards used were myosin, 200 kDa; beta -galactosidase, 116 kDa; phosphorylase B, 97 K; serum albumin, 66 K; ovalbumin, 45 kDa; carbonic anhydrase, 31 kDa; trypsin inhibitor, 22 kDa; lysozyme, 14 kDa; aprotinin, 6 kDa; and insulin beta  chain, 4 kDa. B, Deduced amino acids of purified recombinant protein.

SDF-1alpha has recently been shown to be a ligand for CXCR4 and to produce calcium responses in Chinese hamster ovary cells stably transfected with CXCR4 (Bleul et al., 1996; Oberlin et al., 1996). Accordingly, a functional assay for CXCR4 was established. SDF-1alpha produced a concentration-dependent aggregation response in melanophores transfected with CXCR4 cDNA. Fig. 2 shows the response to SDF-1alpha measured at timepoints 30 to 210 min. It can be seen that a steady state with SDF-1alpha was obtained after 90 min; the concentration producing ED50 was found to be 40 pM in the experiment shown. The mean ED50 from nine experiments is 53 ± 11 pM. One feature of Gi protein-coupled receptor effects in melanophores is the time-dependence of the response. Specifically, once Gi protein has been activated, the cell must reach a new steady state with respect to the altered cytosolic level of cyclic AMP; the time for this effect can vary. This property of melanophores makes temporal study of Gi-mediated responses important for the determination of the potency of agonists. The changing responses with time probably do not reflect the temporal interaction of SDF-1alpha and CXCR4, because the ED50 does not change after 30 min. Rather, the increased asymptotic response reflects the clearance of endogenous cyclic AMP in the presence of a new setpoint of Gi activation (Potenza et al., 1994). Although CXCR4 is similar to IL-8 receptors (CXCR1, CXCR2), IL-8 did not produce activation of CXCR-4 in melanophores (Fig. 2). No response to SDF-1alpha was observed in melanophores not transfected with CXCR4 or CXCR1 (data not shown). The involvement of Gi-protein in the response to SDF-1alpha was suggested by the fact that the ligand-mediated response is abolished in transfected cells treated with pertussis toxin (Fig. 3), a treatment that inactivates Gi protein.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2.   SDF-1alpha mediated receptor activity of CXCR-4 transiently transfected into melanophores. Effect of increasing concentrations of SDF-1alpha (abscissae as log scale) on melanophore responses (ordinates as 1 - (Tf/Ti) where Ti and Tf refer to transmittance through the well before and after addition of SDF-1alpha , respectively). A, Dose-response curves to SDF-1alpha obtained at various times of incubation: open circle , 30 min; triangle , 60 min; black-down-triangle , 90 min; diamond , 120 min; and black-square, 210 min. The lack of response to IL-8 in transfected cells also is shown (×).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of pretreatment of melanophores with pertussis toxin on SDF-1alpha mediated CXCR-4 receptor activity. Ordinates and abscissae as for Fig. 2. Responses shown in the cells pretreated (black-triangle) and not pretreated (bullet ) with pertussis toxin.

To further examine the interaction of SDF-1alpha with the CXCR4, experiments were done on melanophores pretreated with 12G5, a monoclonal antibody specific for CXCR4 (Endres et al., 1996). As shown in Fig. 4, pretreatment of transfected melanophores with 12G5 produced an inhibition of the SDF-1alpha response. The dose-response curve to SDF-1alpha was shifted to the right by a factor of 100 after treatment with 12G5 antibody.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of 12G5 antibody on responses to SDF-1alpha . Control responses (bullet ) and after 30-min incubation with 0.7× L-15/0.1% BSA containing 12G5 antibody (black-triangle, 16.9 µg/ml).

SDF-1alpha has been shown to block T cell trophic HIV-1 cell-to-cell fusion and infection (Oberlin et al., 1996). We wanted to determine the relative potency of SDF-1alpha as an agonist and its potency as an inhibitor of HIV-1 mediated cell-to-cell fusion, and verify that the amino-terminal methionine did not compromise the anti-HIV activity. Fusion was measured in a coculture system that utilizes a luciferase reporter system (Aguilar-Cordova et al., 1994). Preliminary experiments (not shown) indicated that luciferase activity increased continuously over the first 8-10 hr of coculture and could be completely blocked with soluble CD4 if present within the first 2 hr of coculture. We tested SDF-1alpha for the ability to block fusion in this assay; the data are shown in Fig. 5A. The induction of luciferase activity was blocked by SDF-1alpha in a concentration-dependent manner. An IC50 value of 23 ± 4 nM (n = 16) was calculated for SDF-alpha . Control experiments (not shown) indicated that SDF-1alpha had no direct inhibitory effect on luciferase gene expression or enzyme activity in cells that did not contain CXCR4.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of SDF-1alpha (A) and 12G5 antibody (B) on viral fusion. Ordinate axes, percent of control cell fusion; abscissae, logarithms of molar concentrations of SDF-1alpha (A) and 12-G5 antibody (B) and 52R2 antibody as control (µg/ml).

The monoclonal antibody for CXCR4, 12G5, shown to be an antagonist in the melanophore system, is also known to block HIV-1 mediated cell-to-cell fusion (McKnight et al., 1997). This result was confirmed in these studies (Fig. 5B), in which the IC50 was found to be 3.5 µg/ml (±1.1 µg/ml, n = 2) when the antibody was preincubated with cells for 1 hr before coculture. An isotype control antibody did not inhibit fusion over a range of concentrations up to 10 µg/ml.

The involvement of seven transmembrane receptors, such as CXCR4 in HIV viral fusion, has broad implications for the treatment of this disease. The discovery that seven transmembrane receptors are required for HIV-1 entry into cells offers a pharmacologically and chemically tractable target. Thus, if interaction of CXCR4 with either CD4 and/or the viral envelope (through gp120) can be disrupted, then the sequential process initiated by the tripartite protein interaction may stop fusion of cells (and subsequent viral entry). This is indicated by the blockade of viral fusion by SDF-1alpha . It is presently unclear whether activation of CXCR4 is required for the process of viral fusion, but the data showing that viral fusion is blocked by the 12G5 antibody, a ligand that does not produce responses in the melanophore system, indicates that this is not a requirement. This behavior is similar to the studies on chemokine receptor 5 as a coreceptor for HIV-mediated fusion where indirect evidence for the lack of receptor activation (with respect to G-protein) was obtained with CCR5/CCR2b receptor chimeras and mutants (Edinger et al., 1997; Farzan et al., 1997). In these studies, mutant receptors that were unable to mediate physiological responses facilitated viral fusion nevertheless.

Although receptor activation does not seem to be required for inhibition of viral fusion, the relationship between ligand occupancy and receptor activation is unclear. Specifically, if ligand occupation of CXCR4 is required to block viral fusion, then the concentration of CXCR4 agonist ligand useful for protection against HIV-1 infection may be considerably greater than the ED50 for Gi protein activation. This is attributable to the well-known disparity between physiological responses and receptor occupancy brought on by agonist intrinsic efficacy and amplification of signals through stimulus-response mechanisms (i.e., effective receptor reserve). This is suggested by the 434-fold increase in concentration of SDF-1alpha (over the ED50 for melanophore response) required to inhibit viral fusion. The fact that the dose-response curve to SDF-1alpha was shifted 100-fold to the right by 12G5 antibody indicates a considerable effective receptor reserve in this preparation for this ligand.

Under these circumstances, achieving a saturating receptor occupancy by SDF-1alpha may require considerably higher concentrations of SDF-1alpha than the pharmacologic ED50. A further unknown in the comparison of the two systems is the unknown receptor densities on the two cell lines. This latter factor may further distance the concentrations required to activate Gi proteins and prevent cell fusion. Further studies are required to elucidate the relationship between G protein activation by CXCR-4 and the role of this receptor as an HIV coreceptor for viral entry.

The ability to monitor CXCR4 function still has broad implications for the screening of receptor active ligands and therapeutic approaches in this area. Presently, the extent to which the screening of CXCR4 function in a seven-transmembrane receptor system will assist in finding drugs to inhibit viral fusion is unknown. The theoretical basis of this approach is that the melanophore/Gi-protein matrix will function as a detection system for CXCR4 conformational states and that these will translate into differences in the interaction of the CXCR4 receptor and proteins of the HIV viral coat.

    Acknowledgments

We wish to acknowledge Jay Levy and Carl Mackewicz for introducing us to the 1G5 reporter system and Randall Lanier and Richard Hazen for their help in establishing the system in-house. We also wish to thank Martin Rink and Jeff Robbins (GlaxoWellcome Research and Development) for scale up of SDF-1alpha . In addition, we appreciate the efforts of Tom Rimele for advice and support, Ken Queen for preparing the plasmids, Howard Sauls for data analysis, and Jill Haizlip for cell culture. We thank Brendan Larder (Glaxo-Wellcome) for providing the pHIVDelta RTBstEII clone. We also wish to thank James Hoxie of University of Pennsylvania for the gift of 12G5 antibody. Finally, we wish to thank Mrs. Donna McGhee for her expert assistance in the preparation of this manuscript.

    Footnotes

Received August 29. 1997; Accepted October 29, 1997

Send reprint requests to: Terry Kenakin, Ph.D., Department of Receptor Biochemistry, Glaxo Wellcome Research and Development, 5 Moore Drive, Research Triangle Park, NC 27709.

    Abbreviations

HIV-1, human immunodeficiency virus type 1; CXCRx, CXC chemokine receptor, where x is the receptor number; SDF, stromal cell-derived factor; BSA, bovine serum albumin; PCR, polymerase chain reaction; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid; SDS, sodium dodecyl sulfate; ED50, dose effective on 50% of the population.

    References
Top
Summary
Introduction
Procedures
Results & Discussion
References


0026-895X/98/020177-05$3.00/0
MOLECULAR PHARMACOLOGY, 53:177-181 (1998).
Copyright © 1998 by The American Society for Pharmacology and Experimental Therapeutics



This article has been cited by other articles:


Home page
J. Immunol.Home page
O. D. Schneider, A. A. Weiss, and W. E. Miller
Pertussis Toxin Signals through the TCR to Initiate Cross-Desensitization of the Chemokine Receptor CXCR4
J. Immunol., May 1, 2009; 182(9): 5730 - 5739.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Yoon, Z. Liang, X. Zhang, M. Choe, A. Zhu, H. T. Cho, D. M. Shin, M. M. Goodman, Z. Chen, and H. Shim
CXC Chemokine Receptor-4 Antagonist Blocks Both Growth of Primary Tumor and Metastasis of Head and Neck Cancer in Xenograft Mouse Models
Cancer Res., August 1, 2007; 67(15): 7518 - 7524.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
J. Juarez, R. Baraz, S. Gaundar, K. Bradstock, and L. Bendall
Interaction of interleukin-7 and interleukin-3 with the CXCL12-induced proliferation of B-cell progenitor acute lymphoblastic leukemia
Haematologica, April 1, 2007; 92(4): 450 - 459.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
E.-N. N'Diaye and E. J. Brown
The ubiquitin-related protein PLIC-1 regulates heterotrimeric G protein function through association with G{beta}{gamma}
J. Cell Biol., December 8, 2003; 163(5): 1157 - 1165.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kanda, Y. Mochizuki, and H. Kanetake
Stromal Cell-derived Factor-1alpha Induces Tube-like Structure Formation of Endothelial Cells through Phosphoinositide 3-Kinase
J. Biol. Chem., January 3, 2003; 278(1): 257 - 262.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
G. Chen, J. Way, S. Armour, C. Watson, K. Queen, C. K. Jayawickreme, W.-J. Chen, and T. Kenakin
Use of Constitutive G Protein-Coupled Receptor Activity for Drug Discovery
Mol. Pharmacol., January 1, 2000; 57(1): 125 - 134.
[Abstract] [Full Text]


Home page
J Biomol ScreenHome page
M. E. Nuttall, J. C. Lee, P. R. Murdock, A. M. Badger, F.-L. Wang, J. T. Laydon, G. A. Hofmann, G. R. Pettman, J. A. Lee, A. Parihar, et al.
Amphibian Melanophore Technology as a Functional Screen for Antagonists of G-Protein Coupled 7-Transmembrane Receptors
J Biomol Screen, October 1, 1999; 4(5): 269 - 277.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, W.-J.
Right arrow Articles by Kenakin, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, W.-J.
Right arrow Articles by Kenakin, T.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition

Copyright © 1998 by the American Society for Pharmacology and Experimental Therapeutics