![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 53, Issue 2, 182-187, February 1998
Department of Pharmacological and Physiological Sciences, University of Chicago, Chicago, Illinois 60637
 |
Summary |
|---|
Top
Summary
Introduction
Procedures
Results
Discussion
References
|
|---|
Forskolin potently activates all cloned mammalian adenylyl cyclases
except type IX by interacting with two homologous cytoplasmic domains
(C1 and C2) that form the catalytic core. A
mutational analysis of the IIC2 protein (C2
domain from type II adenylyl cyclase) and forskolin analogs suggests
that Ser942 interacts with the 7-acetyl group of forskolin. The
C1/C2 complex has only one forskolin, one ATP,
and one binding site for the 
subunit of the G protein that
stimulates adenylyl cyclase (Gs
) and its structure may
be modeled using the three-dimensional structure of
(IIC2/forskolin)2. The Ser942 mutation defines
which forskolin in the (IIC2/forskolin)2
structure exists in C1/C2 complex. Thus, the
forskolin-binding site is close to the Gs-binding site but distal (15-20Å) from the catalytic site. Mutation from Leu912 of
IIC2 protein to tyrosine or alanine severely reduces
Gs activation and completely prevents forskolin
activation. The corresponding residue of Leu912 is Tyr1082 at type IX
isoform of adenylyl cyclase. Similar to recombinant type IX enzyme,
soluble adenylyl cyclase derived from mouse-type IX adenylyl cyclase is
sensitive to Gs activation but not to forskolin.
Changing Tyr1082 to leucine makes soluble type IX adenylyl cyclase
forskolin-responsive.
| |
Introduction |
|---|
|
Top
Summary
Introduction
Procedures
Results
Discussion
References
|
|---|
The
diterpene, forskolin, is a cardiac-enhancing drug isolated from the
Indian plant Coleus forskolhii and is a potent activator of
nearly all mammalian adenylyl cyclases (Seamon and Daly, 1986
; Laurenza
et al., 1989). Forskolin has been immobilized for the affinity purification of the detergent-solubilized adenylyl cyclase, leading to success in cloning the genes that encode mammalian adenylyl
cyclases (Pfeuffer et al., 1985; Krupinski et
al., 1989). The analysis of nine types of recombinant mammalian
adenylyl cyclases reveals that all adenylyl cyclases except type IX can
be potently activated by forskolin (Premont et al., 1996;
Tang et al., 1997).1 Mammalian adenylyl cyclases
consist of two homologous cytoplasmic domains (C1
and C2), each following one transmembrane domain
(M1 and M2) (Tang et
al., 1997; Taussig and Gilman, 1995; Sunahara et al.,
1996). The two cytoplasmic domains form the catalytic core; forskolin
binds and activates these core domains directly (Tang and Gilman, 1995;
Yan et al., 1996; Whisnant et al., 1996; Sunahara
et al., 1997; Scholich et al., 1997).
The three dimensional structure of the
IIC2/forskolin dimer, which resembles that of the
C1/C2 complex, has been
solved recently (Zhang et al., 1997; Yan et al.,
1997a) (Fig. 1). The
IIC2 structure consists of a 
substructure that is similar to the palm domain of prokaryotic DNA
polymerases including Escherichia coli DNA polymerase I and
Thermus aquaticus (Taq) polymerase (Artymiuk et al., 1997). The
C1/C2 complex binds
only one Gs, one ATP, and one forskolin
molecule based on equilibrium dialysis of the C1 and C2 domains
of type V and type II adenylyl cyclases, respectively (Dessauer
et al., 1997). The Gs-binding site
of adenylyl cyclase has been mapped to a region formed by the
2 and 3/4 region of C2 domain and the
amino terminus of the C1 domain. The Gs-binding site is distal (20-30Å) to the
catalytic (also ATP-binding) site, which is defined by our mutational
analysis (Yan et al., 1997b; Artymiuk et al.,
1997). The
(IIC2/forskolin)2 structure
has two forskolin molecules, which lie in the hydrophobic pocket in the
ventral cleft of the IIC2 dimer interface. Nine of 13 residues in the C2 domain involved in the
binding of forskolin to the IIC2 dimer are
conserved in the C1 domain. It remains to be
determined which of two forskolin molecules in
(IIC2/forskolin)2 binds at
the C1/C2 complex and
whether the interaction between forskolin and the
IIC2 dimer can serve as a model to study how forskolin binds to the
C1/C2 complex. In this
article, we use mutational analysis to address both questions.
|
| |
Experimental Procedures |
|---|
|
Top
Summary
Introduction
Procedures
Results
Discussion
References
|
|---|
Materials. Forskolin and its analogs were from Calbiochem (La Jolla, CA); restriction enzymes and Vent DNA polymerase were from New England Biolabs (Beverly, MA); Bradford reagent was from Bio-Rad (Hercules, CA); the enhanced chemiluminescence system was from Amersham (Arlington Heights, IL); and Ni-NTA resin was from Qiagen (Chatsworth, CA).
Plasmids.
The plasmids used to express mutant forms of
IIC2 were constructed as described except for
those used to express IIC2-L912A and
IIC2-L912Y, which were done using Quickchange
(Stratagene, La Jolla, CA) (Yan et al., 1997a). A plasmid
used to express IXC1 protein was constructed by
performing polymerase chain reaction using the primers
ATTACCATGGGGCAAAGATCTGGAAGTAGAG and
TGGGAAGCTTGAATTAATAATCTTTCATCAGGCTGTC, pSK-AC9 as the template, and
Vent DNA polymerase. The 1.3-kilobase polymerase chain reaction product
was isolated from agarose gel, digested with EcoRI and
HindIII, and cloned into pProEx-HAH6 that had been digested
with the same enzymes, resulting in the construct pProExHAH6-IXC1. For the expression of
IXC2, the 1.4 kb NcoI/XhoI fragment was cut out of pSK-AC9 and ligated to pProEx-HAH6 that was
digested with the same enzyme. Because the IXC2
coding sequences in the resulting plasmid were out of frame compared
with those that encoded the hexo-histidine tag, the resulting plasmid
and the primer CCGGATTACGCCGGAGATGTGGAGGCCGAC were used to do
site-directed mutagenesis for the construction of the plasmid that
could be used to express IXC2, resulting in
pProExHAH6-IXC2 (Kunkel, 1985). Kunkel's method
was used to construct IXC2 mutants from
pProExHAH6-IXC2 as the template; oligonucleotides
used for mutagenesis contained 10-12 complementary nucleotides
flanking each side of the target codon(s), which were replaced with the
appropriate codon (Kunkel, 1985). Mutations were confirmed by dideoxyl
nucleotide sequencing of phagemid DNA.
Expression and purification of recombinant C1 and
C2 protein from E. coli.
The expression
of wild-type and mutant forms of hexo-histidine-tagged
IC1 and IIC2 has been
described previously (Yan et al., 1996). The conditions for
expressing hexo-histidine-tagged IXC1 and
IXC2 wild-type and mutant proteins in E. coli BL21(DE3) cells were the same for expressing
IC1 and IIC2 (Yan et
al., 1996). Both IXC1 and
IXC2 proteins were purified using the Ni-NTA
column and Q-sepharose column and IXC1 was
further purified by Superdex 200 column. The conditions and buffers
used in purification of IXC1 and
IXC2 were similar to the purification of
IC1 and IIC2 (Yan et
al.,1996). The Gs-stimulated activity was
used to determine the protein peak in the fractions from Q-sepharose
and Superdex 200 columns (Pharmacia, Piscataway, NJ). The concentration of proteins was determined using Bradford reagent and bovine serum albumin as standard (Bradford, 1976).
Adenylyl cyclase assay.
The purification of
hexo-histidine-tagged Gs was performed as
described previously (Lee et al., 1994).
Gs was activated by 50 µM
AlCl3 and 10 mM NaF, and adenylyl
cyclase assays were performed at 30° for 20 min (Yan et
al., 1996; Salomon et al., 1976).
| |
Results |
|---|
|
Top
Summary
Introduction
Procedures
Results
Discussion
References
|
|---|
Ser942 of IIC2 protein is important in interacting with
forskolin.
We have constructed forskolin- and
Gs-sensitive soluble adenylyl cyclase from the
C1 domain of type I enzyme and the C2 domain of type II enzyme; such a system is
used in analyzing the forskolin-binding site (Tang and Gilman, 1995a;
Yan et al., 1996). All adenylyl cyclases except type IX are
potently activated by forskolin (Premont et al.,
1996).1 Sequence analysis reveals that eight
amino acids in the C2 domain are absolutely
conserved among forskolin-sensitive type I to VIII enzyme, and rutabaga
adenylyl cyclases, but differ in forskolin-insensitive mouse-type IX
enzyme (Yan et al., 1997a). By mutating six of these eight
residues to alanine in the C2 domain of type II
enzyme (IIC2), we found that E. coli
lysates containing mutant IIC2-S942A had relatively normal stimulation by Gs, but had
moderately reduced activation by
forskolin2 (not shown). This
difference is not caused by low expression because immunoblot analysis
indicated that lysate containing IIC2-S942A had
similar amounts of IIC2 compared with wild-type
IIC2 (not shown). Mutant
IIC2-S942A was purified to homogeneity (Fig.
2A). The purified protein was tested for
its Gs and forskolin activation when the
purified IC1 protein was added.
IIC2-S942A had nearly normal
Gs activation but about a 6-fold reduction in
forskolin activation (Fig. 3A, B). In the
presence of submaximal Gs, the maximal
forskolin-stimulated activity of IIC2-S942A was
similar to that of wild-type IIC2 (Fig. 3C). The
6-fold reduction in forskolin activation of
IIC2-S942A may be related to the apparent reduced
affinity indicated by the 6-fold increase in EC50
value (0.3 and 1.7 µM for wild type
IIC2 and IIC2-S942A,
respectively; Fig. 3C). Gs activation of the
IC1/IIC2 complex can be
greatly enhanced by forskolin; thus, the reduction in forskolin
activation should result in reduced Gs
activation. As expected, IIC2-S942A did have
reduced Gs activation when submaximal
forskolin (2 µM) was present (Fig. 3D).
|
|
- and 9-positions and the acetoxyl
group at the 7-position of forskolin are crucial for forskolin activation of adenylyl cyclase (Sutkowski et al., 1994). The
forskolin analog 1-deoxyforskolin did not activate
IC1+IIC2 complexes;
7-deacetyl- and 9-deoxyforskolin had reduced potency (Fig. 3, E and F;
not shown for 1-deoxyforskolin). These results are similar to those observed with membrane-bound adenylyl cyclase (Sutkowski et
al., 1994). When mixed with IC1, activation
of IIC2-S942A by 9-deoxyforskolin was reduced
about 3-7-fold compared with that of wild-type
IIC2, similar to the observed reduction in
activation by forskolin. In contrast, the activation of
IIC2-S942A by 7-deacetylforskolin was only about
2-3-fold less than that of wild-type IIC2. This corroborates the hydrogen bonding between the 7-acetyl group of
forskolin and the hydroxyl group of Ser942 observed in the IIC2/forskolin crystal structure (Zhang et
al., 1997).3
The (IIC2/forskolin)2
structure indicates that the 7-acetyl group of forskolin forms hydrogen
bonds with both the main and side chain of Ser942 (Zhang et
al., 1997) (Fig. 1). The model predicts that a Ser942-to-proline
mutation would disrupt hydrogen bonding in both the main and the side
chains to the 7-acetyl group of forskolin. Thus, such a mutation should
have a profound reduction in forskolin activation without a reduction
in Gs activation. IIC2-S942P had 25-30% reduction in
Gs activation when either lysate containing
IIC2-S942P or purified mutant protein was used (Fig. 3B). In contrast to the moderate reduction in
Gs stimulation, IIC2-S942P had a 20- to 40-fold reduction in
forskolin and 9-deoxyforskolin stimulation, substantially more than
that of IIC2-S942A.
IIC2-S942P had about 25% reduction in maximal
forskolin stimulation when activated with submaximal
Gs (Fig. 3C). The reduction in forskolin
activation is obvious in the EC50 values, not in
the Vmax values (Fig. 3C; the
EC50 values for wild-type
IIC2 and IIC2-S942P were
0.3 and 5.8 µM, respectively, and
Vmax values were 2.5 and 2.1 µmol/min/mg,
respectively). In the presence of forskolin (2 µM),
IIC2-S942P had significant reduction in
Gs activation, presumably because of the
drastically reduced forskolin activation of
IIC2-S942P mutant (Fig. 3D).
Based on equilibrium dialysis of the
VC1/IIC2 complex, there is
only one forskolin in the
C1/C2 complex (Dessauer
et al., 1997). Our data show that S942 of
IIC2 is essential in interacting with the
7-acetyl group of forskolin. Thus, the forskolin molecule binds the
site that is close to the Gs-binding site but
distal to the ATP-binding site (Fig. 1). Based on the
(IIC2/forskolin)2 model,
IIC2-S942A or IIC2-S942P
should not have significantly reduced activation by 7-deacetylforskolin
relative to wild-type IIC2. However, we observed
2- and 10-fold reductions when IIC2-S942A and
IIC2-S942P were stimulated by
7-deacetylforskolin, respectively. Possible reasons for such reductions
include changes in the local conformation at the forskolin-binding site
by Ser942 to the alanine or proline mutations and the structural
differences at the forskolin-binding site between the
C1/C2 complex and the
IIC2 dimer. Further experiments are required to
resolve this discrepancy.
Mutations near the forskolin-binding site affect both
Gs and forskolin activation of
C1/C2 complex.
We constructed and analyzed
two sets of IIC2 mutants that had mutations
surrounding forskolin (Fig. 1). Tyr899 is conserved among all the
mammalian adenylyl cyclases. Based on the
IC1/IIC2 model using
(IIC2/forskolin)2
structure, Tyr899 is located at the
C1/C2 interface and is in
contact with 13-methylenyl and 13-methyl groups of forskolin and Trp421
of C1 protein (Fig. 1). Thus, mutation at Tyr899
of IIC2 is likely to affect both interaction with
IC1 and forskolin. We constructed a
IIC2 mutant with the mutation of Tyr899 to Leu,
and IIC2-Y899L was expressed normally (not
shown). As expected, the purified IIC2-Y899L
protein had substantially higher reduction in forskolin stimulation
(~40-fold) than in Gs activation (6-fold)
compared with wild-type IIC2 (Fig.
4, A and B). Submaximal
Gs partially rescued forskolin activation (Fig. 4, A and C). We also mutated Phe898, which is conserved among all
mammalian adenylyl cyclase and seems to be involved in coordinating the
Gs-binding site. To our surprise, mutation of
Phe898 to Leu drastically reduced both Gs and
forskolin activation of IIC2-F898 (Fig. 4, A and
B). IIC2-F898 seemed to have reduced affinity to
forskolin depicted by the increased EC50 value of
forskolin activation in the presence of submaximal
Gs (Fig. 4C). The purified
IIC2 protein that had mutated both Tyr899 and
Phe898 to Leu had nearly no enzyme activity (Fig. 4).
|
-stimulated activity. Both mutant proteins
showed little forskolin stimulation unless Gs
(0.2 µM) was present (Fig. 4, B and C).
Tyr1082-to-leucine mutation converts type IX adenylyl cyclase to be
forskolin-sensitive.
Type IX adenylyl cyclase is
forskolin-insensitive. One or more mutations that render type IX enzyme
sensitive to forskolin would highlight the residue(s) important for
forskolin activation. To find such residue(s), we first constructed the
C1 and C2 domains from type
IX adenylyl cyclase (IXC1 and
IXC2, respectively) and tested whether they could
form the functional enzyme and exhibit the proper biochemical
properties.4
IXC1 and IXC2 proteins were
both tagged with the influenza hemoagglutinin epitope, and immunoblot
analysis showed that IXC1 and
IXC2 proteins had the expected 50- and 42-kDa
size (Fig. 2B). Small molecular-weight proteins were seen in the
lysates containing IXC1 and
IXC2 proteins, presumably proteolytic products.
E. coli lysates containing either IXC1
or IXC2 protein alone had no detectable adenylyl
cyclase activity. However, significant
Gs-stimulated enzyme activity was detected
when the two lysates were mixed together (not shown). Lysates
containing IXC1 and IXC2
protein did not exhibit forskolin sensitivity with or without
Gs (not shown). This result is consistent with
the observation that type IX adenylyl cyclase is
Gs-sensitive, but is insensitive to
stimulation by forskolin (Premont et al.,
1996).1
but not by forskolin
(Fig. 5A).
|
using either
E. coli lysates or purified proteins (Fig. 5A). Purified
IXC2-Y1082L, A1112S protein mixed with
IXC1 had weak but detectable forskolin
stimulation, whereas both IXC2-Y1082L and
IXC2-A1112S proteins mixed with
IXC1 did not (Fig. 5A). In the presence of
submaximal concentration of Gs, both
IXC2-Y1082L and
IXC2-Y1082L, A1112S, when mixed with
IXC1, had 10- to 15-fold stimulation by
forskolin, whereas wild-type IXC2 had no
observable forskolin stimulation (Fig. 5). Thus, Tyr1082 to leucine
mutation converts soluble type IX adenylyl cyclase into
forskolin-sensitive enzyme.
| |
Discussion |
|---|
|
Top
Summary
Introduction
Procedures
Results
Discussion
References
|
|---|
Soluble adenylyl cyclases derived from membrane-bound adenylyl
cyclases have proven to be an excellent tool for studying the biochemical properties of adenylyl cyclase. The
C1 and C2 domains from
their natural combination or from different isoforms (chimeric C1/C2) can form functional
soluble enzymes (Tang and Gilman, 1995; Yan et al., 1996;
Whisnant et al., 1996; Dessauer and Gilman, 1996; Scholich
et al., 1997; Yan et al., 1997a; Sunahara
et al., 1997).6
The three-dimensional structure of the IIC2
dimer/forskolin has been solved, providing a structural model of the
catalytic domain of adenylyl cyclases (Zhang et al., 1997).
Our mutational analysis for the Gs activation
site of IC1/IIC2 protein
indicates that the structure of the IIC2 dimer is
a reasonable representation of the
IC1/IIC2 protein (Yan
et al., 1997a). In this paper, we show that the
IIC2/forskolin model has successfully predicted the essential roles for Ser942, Tyr899, and Leu912 in forskolin sensitivity in either the
IC1/IIC2 or
IXC1/IXC2 model, indicating that the forskolin-binding region at the C2
domain predicted from the IIC2/forskolin model is
reasonably accurate. Forskolin binds to the site that is close to
Gs, which allows forskolin to synergistically
enhance Gs activation. Although the forskolin binding site is 15-20Å away from ATP-binding site, forskolin does affect ATP binding. Forskolin stimulation in the absence of manganese ion increases the Km value of Mg-ATP
10-fold for the native and recombinant type I, II, V, and rutabaga
adenylyl cyclases; the molecular mechanism remains elusive (Tang
et al., 1995).
Our result shows that Ser942 of type II adenylyl cyclase modulates the
enzyme's affinity for forskolin. Tyr1082 plays an active role in
preventing type IX adenylyl cyclase from being sensitive to forskolin,
although Ala1112 (the residue corresponding to Ser942 of type II
enzyme) may also be involved. It is interesting to note that the type
IX enzyme homolog from Drosophila melanogaster is
forskolin-sensitive and the corresponding Tyr1082 and Ala1112 of
D. melanogaster type IX enzyme are leucine and serine,
respectively (Iourgenko et al., 1997). These facts lead to
several questions. Why are the hydrophobic forskolin pockets conserved
among eight isoforms of mammalian adenylyl cyclases (type I to XIII)
and several fruit fly adenylyl cyclases? Why does mouse-type IX enzyme
have a different forskolin-binding pocket and its fruit fly homolog does not? One obvious answer is the existence of endogenous lipophilic compound(s) that can mimic the function of forskolin; if such a
molecule exists, it remains to be discovered.
| |
Acknowledgments |
|---|
We thank F. Antoni (MRC Brain Metabolism Unit, Edinburgh, Scotland, UK) for cDNA for mouse-type IX adenylyl cyclase, J. H. Hurley and L. R. Levin for helpful discussions, W. Epstein, C. Drum, and C. Skoczylas for the critical reading of the manuscript, and S. Mitchell and J. Siemion for help in the use of InsightII program.
| |
Footnotes |
|---|
Received July 17, 1997; Accepted October 29, 1997
This work was supported by National Institute of Health Grant GM53459, a University of Chicago Cancer Biology Program postdoctoral fellowship (S.-Z.Y.), and Howard Hughes Medical Institute Undergraduate Summer Research fellowship (R.K.A.)
S.-Z.Y. and Z.-H.H. contributed equally to this work.
1
Type IX adenylyl cyclase was insensitive to
forskolin when expressed in insect Sf9 cells, whereas a 2-fold
stimulation was observed by forskolin when type IX enzyme was
transiently expressed in human embryonic kidney 293 cells (Premont
et al., 1996). The discrepancy remains unresolved; the
possible hetero-oligomer formed between isoforms of mammalian adenylyl
cyclases may provide the explanation (Tang et al.,
1995b).
2 The six mutated residues are Q880, S881, L912, S942, S990, and N992. We did not test A1012 and S1032 of IIC2 (both are threonine in the type IX enzyme).
3 The observation suggesting the interaction between Ser942 of the type II enzyme and the 7-acetyl group of forskolin was obtained without prior knowledge of the molecular structure of IIC2/forskolin dimer.
4 IXC1 and IXC2 proteins contain aa 320-741 and aa 1011-1353 of mouse-type IX adenylyl cyclase, respectively.
5 IXC1 protein was not purified further because it was rather unstable and the enzyme activity was not preserved by quick freezing, even with 20% glycerol.
6 The soluble enzymes from the C1 and C2 domains of type II, VII, and VIII enzymes have also been constructed successfully (S-Z Yan, Z-H Huang, RS Shaw, and W-J Tang, unpublished observations).
Send reprint requests to: Dr. Wei-Jen Tang, Department of Pharmacology & Physiological Science, University of Chicago, MC 0926, 947 East 58th Street, Chicago, IL 60637. E-mail: tang{at}drugs.bsd.uchicago.edu
| |
Abbreviations |
|---|
Gs, the subunit of G
protein that stimulates adenylyl cyclase;
SDS, sodium dodecyl sulfate;
PAGE, polyacrylamide gel electrophoresis.
| |
References |
|---|
|
Top
Summary
Introduction
Procedures
Results
Discussion
References
|
|---|
subunits in Escherichia coli.
Methods Enzymol
237:
146-160[Medline]. with the cytosolic domains of mammalian adenylyl cyclase.
J Biol Chem
272:
22265-22271.
Biochemistry
33:
12852-12859[Medline]. and forskolin.
Science (Washington DC)
268:
1769-1772
regulation and underlying mechanisms.
Adv Second Messenger Phosphoprotein Res
32:
137-151. - and forskolin-activated enzyme in vitro.
J Biol Chem
271:
10941-10945 activation.
J Biol Chem
272:
18849-18854This article has been cited by other articles:
|
|
 |
|
  P. Michal, E. E. El-Fakahany, and V. Dolezal Muscarinic M2 Receptors Directly Activate Gq/11 and Gs G-Proteins J. Pharmacol. Exp. Ther., February 1, 2007; 320(2): 607 - 614. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Kolachala, V. Asamoah, L. Wang, S. Srinivasan, D. Merlin, and S. V. Sitaraman Interferon-{gamma} Down-regulates Adenosine 2b Receptor-mediated Signaling and Short Circuit Current in the Intestinal Epithelia by Inhibiting the Expression of Adenylate Cyclase J. Biol. Chem., February 11, 2005; 280(6): 4048 - 4057. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-Y. Kao, H.-L. Lai, M.-J. Hwang, and Y. Chern An Important Functional Role of the N Terminus Domain of Type VI Adenylyl Cyclase in G{alpha}i-mediated Inhibition J. Biol. Chem., August 13, 2004; 279(33): 34440 - 34448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. G. Cumbay and V. J. Watts Novel Regulatory Properties of Human Type 9 Adenylate Cyclase J. Pharmacol. Exp. Ther., July 1, 2004; 310(1): 108 - 115. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Haunso, J. Simpson, and F. A. Antoni Small Ligands Modulating the Activity of Mammalian Adenylyl Cyclases: A Novel Mode of Inhibition by Calmidazolium Mol. Pharmacol., March 1, 2003; 63(3): 624 - 631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. W. Dessauer, M. Chen-Goodspeed, and J. Chen Mechanism of Galpha i-mediated Inhibition of Type V Adenylyl Cyclase J. Biol. Chem., August 2, 2002; 277(32): 28823 - 28829. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. K. Sunahara and R. Taussig Isoforms of Mammalian Adenylyl Cyclase: Multiplicities of Signaling Mol. Interv., June 1, 2002; 2(3): 168 - 184. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-H. Lin, H.-L. Lai, Y.-Y. Kao, C.-N. Sun, M.-J. Hwang, and Y. Chern Protein Kinase C Inhibits Type VI Adenylyl Cyclase by Phosphorylating the Regulatory N Domain and Two Catalytic C1 and C2 Domains J. Biol. Chem., May 3, 2002; 277(18): 15721 - 15728. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Moorman and R. H. A. Plasterk Functional Characterization of the Adenylyl Cyclase Gene sgs-1 by Analysis of a Mutational Spectrum in Caenorhabditis elegans Genetics, May 1, 2002; 161(1): 133 - 142. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Scholich, S. Pierre, and T. B. Patel Protein Associated with Myc (PAM) Is a Potent Inhibitor of Adenylyl Cyclases J. Biol. Chem., December 7, 2001; 276(50): 47583 - 47589. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Xu, C. Isaacs, I. P. Hall, and C. W. Emala Human airway smooth muscle expresses 7 isoforms of adenylyl cyclase: a dominant role for isoform V Am J Physiol Lung Cell Mol Physiol, October 1, 2001; 281(4): L832 - L843. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. B. Jourdan, N. A. Mason, L. Long, P. G. Philips, M. R. Wilkins, and N. W. Morrell Characterization of adenylyl cyclase isoforms in rat peripheral pulmonary arteries Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1359 - L1369. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Defer, M. Best-Belpomme, and J. Hanoune Tissue specificity and physiological relevance of various isoforms of adenylyl cyclase Am J Physiol Renal Physiol, September 1, 2000; 279(3): F400 - F416. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Dhein, P. Rohnert, S. Markau, E. Kotchi-Kotchi, K. Becker, U. Poller, B. Osten, and O.-E. Brodde Cardiac beta-adrenoceptors in chronic uremia: studies in humans and rats J. Am. Coll. Cardiol., August 1, 2000; 36(2): 608 - 617. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H.-L. Lai, T.-H. Lin, Y.-Y. Kao, W.-J. Lin, M.-J. Hwang, and Y. Chern The N Terminus Domain of Type VI Adenylyl Cyclase Mediates Its Inhibition by Protein Kinase C Mol. Pharmacol., September 1, 1999; 56(3): 644 - 650. [Abstract] [Full Text]
|
|
|
|
|
|
J. H. Hurley Structure, Mechanism, and Regulation of Mammalian Adenylyl Cyclase J. Biol. Chem., March 19, 1999; 274(12): 7599 - 7602. [Full Text] [PDF]
|
|
|
|
 |
|
 F. A. Antoni, M. Palkovits, J. Simpson, S. M. Smith, A. L. Leitch, R. Rosie, G. Fink, and J. M. Paterson Ca2+/Calcineurin-Inhibited Adenylyl Cyclase, Highly Abundant in Forebrain Regions, Is Important for Learning and Memory J. Neurosci., December 1, 1998; 18(23): 9650 - 9661. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W.-J. Tang and J. H. Hurley Catalytic Mechanism and Regulation of Mammalian Adenylyl Cyclases Mol. Pharmacol., August 1, 1998; 54(2): 231 - 240. [Full Text]
|
|
|
|
|
|
G.-C. Wu, H.-L. Lai, Y.-W. Lin, Y.-T. Chu, and Y. Chern N-Glycosylation and Residues Asn805 and Asn890 Are Involved in the Functional Properties of Type VI Adenylyl Cyclase J. Biol. Chem., September 14, 2001; 276(38): 35450 - 35457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-Z. Yan, J. A. Beeler, Y. Chen, R. K. Shelton, and W.-J. Tang The Regulation of Type 7 Adenylyl Cyclase by Its C1b Region and Escherichia coli Peptidylprolyl Isomerase, SlyD J. Biol. Chem., March 9, 2001; 276(11): 8500 - 8506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Cao, A. V. Medvedev, K. W. Daniel, and S. Collins beta -Adrenergic Activation of p38 MAP Kinase in Adipocytes. cAMP INDUCTION OF THE UNCOUPLING PROTEIN 1 (UCP1) GENE REQUIRES p38 MAP KINASE J. Biol. Chem., July 13, 2001; 276(29): 27077 - 27082. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||
