|
|
|
|
Vol. 53, Issue 2, 202-212, February 1998
Lehrstuhl für Zellphysiologie, Ruhr-Universität Bochum, D-44780 Bochum, Germany (S.L., N.L., C.H.R.W., G.G., H.H.), and Max-Planck-Institut für Psychatrie, Klinisches Institut, D-80804 München, Germany (R.R.)
| |
Summary |
|---|
|
|
|---|
Polymerase chain reaction and rapid amplification of cDNA ends were used to isolate cDNAs encoding a 5-hydroxytryptamine3 (5-HT3) receptor subunit and its splice variants from guinea pig intestine. The amino acid sequence predicted from this cDNA is 81% homologous to the murine 5-HT3 receptor subunits cloned from NCB20 and N1E-115 cells. The splice variants code for two proteins differing by a deletion of six amino acids located in the large intracellular loop between transmembrane domains M3 and M4. For characterization, the cloned 5-HT3 cDNA was expressed in HEK 293 cells, and the electrophysiological and pharmacological properties of the recombinant ion/channel/receptor complex were investigated by patch clamping. Our data reveal that the cloned cDNAs code for guinea pig 5-HT3 receptors, which functionally assemble as homo-oligomers. The kinetic behavior of the ion channel and its sensitivity to several agonists and antagonists were markedly different from those of the cloned 5-HT3 receptors from mouse and human under similar experimental conditions. The agonists used were 5-hydroxytryptamine, 2-methyl-5-hydroxytryptamine, 1-phenylbiguanide (PBG), m-chlorophenylbiguanide, and the antagonists tropisetron and metoclopramide. In addition, 5-HT, PBG, and tropisetron were investigated through radioligand binding to isolated membranes. Compared with the human and murine 5-HT3 receptors, the guinea pig receptor showed prolonged desensitization kinetics. In addition, the guinea pig 5-HT3 receptor did not respond to the selective 5-HT3 receptor agonist PBG. Construction of chimeric receptors between guinea pig and human 5-HT3 receptor sequences localized the differences in desensitization kinetics to the carboxyl-terminal domain and the ligand binding site to the amino-terminal domain of the receptor protein. Molecular determinants of the PBG binding site of the human 5-HT3 receptor were localized to a 28-amino-acid spanning region adjacent to the M1 region.
| |
Introduction |
|---|
|
|
|---|
5-HT3Rs
belong to the superfamily of ligand-gated ion channels that mediate
fast synaptic transmission in the peripheral and central nervous
systems (Peters et al., 1992
; Yakel, 1992
). These channels
are composed of five identical or homologous subunits and their
functional diversity generally is attributed to the presence of several
different subunits that can coassemble to yield receptors with specific
pharmacological and physiological properties (Betz, 1990
). No such
diversity has emerged for 5-HT3Rs. A single
5-HT3 inotropic receptor subunit
(5-HT3R-A) was cloned 6 years ago from the NCB20
neuroblastoma cell line (Maricq et al., 1991
), but despite
evidence for both pharmacological and biophysical variations between
tissues and species, no further 5-HT3R subunits,
like different
or
subunits, have been identified. 5-HT3R-A cDNA and a splice variant have been
cloned from additional neuroblastoma cell lines and from mouse, rat,
and human tissues. These subunits form functional homo-oligomeric
5-HT3Rs when expressed in oocytes or HEK 293 cells (Maricq et al., 1991
; Hope et al., 1993
;
Werner et al., 1994
; Miyake et al., 1995
).
Electrophysiological recordings from neurons and neuroblastoma cell
lines have established that the 5-HT3R is a
cation-selective channel with similar permeability to
Na+ and K+, although its
conductance differs among preparations (Yakel, 1992
). Although
alternative splicing in mouse and rat generates two receptor isoforms,
there is no evidence that this contributes to functional diversity
(Hope et al., 1993
; Werner et al., 1994
; Miquel
et al., 1995
). The electrophysiological evidence in favor of
5-HT3R heterogeneity is supported by
pharmacological studies, which suggest the existence of receptor
subtypes in different species such as rat, rabbit, and guinea pig that
differ in their affinities for antagonists (Peters et al.,
1992
).
In guinea pig, 5-HT3Rs in various tissues have
been subject to extensive pharmacological characterization. The
receptor from colon and vagus nerve exhibits considerably lower
sensitivity to all 11 antagonists tested compared with the respective
tissues in rat (Butler et al., 1990
). In contrast to
receptors from mouse, rat, and human, PBG does not act as an agonist in
guinea pig.
Within the central nervous system, the
5-HT3R is expressed predominantly in neurons in
the area postrema and mesolimbic system (Kilpatrick et al.,
1987
, 1988
; Tecott et al., 1993
). Thus,
5-HT3Rs seem to be a potential target for the
development of drugs for the treatment of nausea and behavioral
disorders (Aput, 1993
). 5-HT3R antagonists
prevent emesis induced by cytostatic drugs that are commonly used in
cancer therapy (Gralla et al., 1991
). Moreover, based on
animal models and preliminary clinical studies, it has been suggested
that 5-HT3R antagonists display anxiolytic (Rodgers et al., 1995
) and atypical antipsychotic (Costall
et al., 1993
; Zoldan et al., 1993
; Warburton
et al., 1994
) properties.
In the present study, we isolated cDNA for two splice variants of the 5-HT3R from guinea pig intestine. The electrophysiological and pharmacological properties of the recombinant receptor from guinea pig were compared with those from mouse and human. Functional expression and electrophysiological and pharmacological characterizations of the recombinant and chimeric 5-HT3R subunits were obtained in HEK 293 cells by patch-clamp measurements. In addition, pharmacological data were obtained in radioligand binding studies.
| |
Materials and Methods |
|---|
|
|
|---|
mRNA isolation and cDNA synthesis.
mRNA was isolated from
adult guinea pig small intestine with the Pharmacia (Vienna, Austria)
QuickPrep Micro mRNA Purification Kit. cDNA was constructed by using an
oligo(dT) primer with a T7-promotor sequence at its 5
-end (P7
TTCGAAATTAATACGACTCACTATAGGGAGAT20) or a
gene-specific primer (P4 CAGGAGCTCCCAC/TTCICCC/TTGA/GTT) and 200 units
of Moloney murine leukemia virus RT (GIBCO BRL, Paisley, Scotland).
(The nucleotide sequences of guinea pig 5-HT3R cDNAs have been submitted to GenBank with accession numbers AF006461 and AF006462, respectively.)
PCR.
Nucleotide sequences derived from the previously
reported mouse 5-HT3 subunit (Maricq et
al., 1991
) were used to design PCR primers (P1
ATCCTCGAGGTGGATGAGAAGAACCAA/GGT and P2
TTCATCGATGGCTGCAGTGGTTA/G/C/TCCCAT). P7 primed cDNA and 50 pmol of
primers P1 and P2 were incubated in Taq buffer (20 mM Tris·HCl, pH 8.4, 50 mM KCl, GIBCO BRL)
containing 0.2 mM concentrations of dNTPs and 2.5 units of
Taq DNA polymerase (GIBCO BRL). Thirty-five cycles (94°
for 1 min, 55° for 1 min, 72° for 1 min) were performed with a
programmable thermocycler. One fifth of the reaction products were
analyzed by gel electrophoresis. The amplified fragment was digested
with XhoI and ClaI, subcloned into pBluescript II
KS+ (Stratagene, Heidelberg, Germany), and
sequenced with PRISM Ready Reaction DyeDeoxy Terminator Cycle
Sequencing Kit and an ABI 373 Version 2.0.1 DNA Sequencer (Applied
Biosystems, Foster City, CA).
5
- and 3
-RACE.
Isolation of 5
- and 3
-termini of guinea
pig 5-HT3R cDNA was done according to the method
described for human 5-HT3R by Lankiewicz et
al. (1997)
. Briefly, primers were designed on the basis of sequence information obtained with sequenced guinea pig PCR products. For the amplification of 3
-ends, 0.5 µg of P7 primed cDNA and 50 pmol of primer P3 (CCACCAAGACTGATGAC) and T7-primer
(AATTAATACGACTCACTATAGG) were cycled 30 times (94° for 1 min, 50°
for 1 min, 72° for 1.5 min, 2.5 units of Taq-polymerase).
The specific reaction product was purified with
Streptavidin-Paramagnetic Particles (Promega, Madison, WI) and
biotinylated internal primer P2, reamplified (30 times: 94° for 1 min, 50° for 1 min, 72° for 1 min, 2.5 units of
Taq-polymerase, 50 pmol of P3 and T7), cloned blunt end into pBluescript II KS+ (Stratagene), and sequenced.
For 5
-RACE, cDNA was constructed with the gene-specific primer P4, and
a poly(dA) tail was added with terminal transferase. The next step was
one cycle of PCR with 10 pmol of P7 at 94° for 1 min, 40° for 1.5 min, and 72° for 2.5 min and 2.5 units of Taq-polymerase
followed by 30 cycles with 50 pmol of primer P5
(ACAGAATTCTGIACA/GTCA/GAAIGGA/GAA) and T7 at (94° for 1 min, 50°
for 1 min, 72° for 1 min). The specific reaction product was purified
with Streptavidin-Paramagnetic Particles (Promega) and biotinylated
internal primer P1, reamplified 30 times (94° for 1 min, 50° for 1 min, 72° for 1 min, 2.5 units of Taq-polymerase, 50 of
pmol P5, 50 pmol of T7), cloned, and sequenced as described.
PCR detection of alternative splicing. The specific oligonucleotides P9 (ATTGGATCCAGACCATCTTCATTGTGCA/GGCTG) and P2 were designed to anneal to cDNA sequence corresponding to the long cytosolic loop between M3 and M4. PCR was done with cDNA from guinea pig cortex, intestine, spleen, liver, and muscle and NG108-15 cells. Amplification was done for 30 cycles (94° for 1 min, 60° for 1 min, 72° for 30 sec, 2.5 units of Taq-polymerase). The PCR products were resolved on a 2.5% agarose gel (Boehringer-Mannheim Biochemica, Mannheim, Germany).
Construction of recombinant plasmids
p5-HT3GPs, p5-HT3GPl,
and p5-HT3H.
The recombinant plasmids
p5-HT3GP carrying the entire protein coding
sequence of guinea pig 5-HT3R splice variants
were constructed as follows. PCR was done with intestine P7 primed cDNA
as template and the primers P6 (CCCAAGCTTGCCACCATGGTGCTGTGGCTCCAGCTG)
containing a HindIII restriction side followed by a
consensus sequence for the initiation of translation in vertebrates
(Kozak, 1989
) and the first 21 nucleotides from the coding region of
guinea pig 5-HT3R and P8
(TACCTT/CGACCAATCCTAT/CT/CCT/ATAGATCTTCGT) containing an
XbaI restriction side. The cDNA was amplified by 40 cycles (1 min for 94°, 1 min for 65°, 2 min for 72°) using 2.5 units of
Pfu-Polymerase (Stratagene). The reaction product was
digested with HindIII and XbaI, subcloned into an
eucaryotic expression vector (pRc/CMV; InVitrogen, San Diego, CA), and
sequenced on both strands. The expression plasmid
p5-HT3H for the human
5-HT3R was constructed in the same manner as
above using oligo(dT)-primed cDNA from human colon and primers P9 (5
)
CCCAAGCTTGTCGCTATGCTGCTGTGGGTC and P10 (3
)
CATCTAGACTTGGCTTGTGATTGCTGAGATG (Miyake et al., 1995
; Lankiewicz et al., 1997
).
Construction of chimeric receptors.
Random chimeric cDNA was
constructed essentially as described previously (Klug et
al., 1991
). For chimeras with guinea pig cDNA at the 5
-end,
primers (50 pmol) were used that fit the 5
region of
5-HT3GPs (P6) and the 3
region of 5-HT3H cDNA (P10). For the reverse
chimeras, we used primers P9 and P8 fitting the 3
region of
5-HT3GPs and the 5
region
of 5-HT3H cDNA, respectively. Chimeric cDNA was
amplified in 2 cycles (45 sec at 94°, 1 sec at 50°) to generate
incomplete PCR products, followed by 20 cycles (45 sec at 94°, 45 sec
at 60°, 2 min at 72°) using 0.125 unit of Pfu-polymerase
(Stratagene) and 2.5 units of Taq-polymerase and a mixture
of 1 ng of HindIII cut
p5-HT3GPs and
p5-HT3H as the template. The reaction product was
digested with HindIII and XbaI and subcloned into
an eucaryotic expression vector (pRc/CMV; InVitrogen). The
"switch-point" was mapped by restriction digestion with
PstI, and chimeric cDNAs of interest were sequenced on both strands. The resulting pE4 contained the 5
-end of
5-HT3GPs up to position 792 (Fig. 1) fused to the 3
end of
5-HT3H beginning at position 865 (Miyake et
al., 1995
). pC1 is a combination of the
5-HT3H 5
-end up to position 724 and
5-HT3GPs 3
-end beginning at position 876. The switch-point was defined as the first detectable nucleotide of B in an A×B chimera.
|
Functional expression in HEK 293 cells.
Culture and
transfection of HEK 293 cells was done as described previously (Gorman
et al., 1990
). Cells were grown in minimum essential medium
supplemented with 10% fetal calf serum in 5% CO2. Transfection was accomplished by mixing 15 µg of expression vector and 250 µl of 250 mM
CaCl2. The material was added dropwise to 250 µl of 2× HEPES-buffered saline. The precipitate then was added to
20% confluent HEK 293 cells and allowed to incubate for 5 hr before
washing the cells twice with phosphate-buffered saline (0.2 g/liter
KCl, 0.2 g/liter KH2PO4, 8.0 g/liter NaCl, 1.15 g/liter Na2HPO4). Stable cell lines were
established by selection with 500 µg/ml G418.
Electrophysiology and solutions.
Transfected HEK 293 cells
stably expressing the recombinant 5-HT3Rs [human
(H), mouse (Ml), guinea pig
(GPl and GPs)] were recorded in the whole-cell voltage-clamp configuration (Hamill et
al., 1981
) under visual control using an inverted microscope (Zeiss, Jena, Germany). The cells were kept in an external solution containing: 145 mM NaCl, 10 mM glucose, 1 mM EGTA, and 10 mM HEPES, pH adjusted to 7.3 with NaOH. Patch electrodes were pulled from borosilicate glass (Clark
Electromedical Instruments, Pangbourne, England) using a horizontal
pipette puller (DMZ Universal Puller; Zeitz-Instruments, Augsburg,
Germany) to yield pipettes with resistances of 3-6 M
. Pipettes were
filled with a solution containing 145 mM CsCl, 10 mM glucose, 10 mM HEPES, and 1 mM
EGTA, pH adjusted to 7.2 with CsOH.
Substance application. After establishment of the whole-cell configuration, the cells were lifted from the substrate, and 5-HT or 5-HT3R agonists or antagonists were applied at the indicated concentrations using a fast superfusion device. A piezotranslator-driven double-barreled application pipette was used to expose the lifted cell to 5-HT (agonist)-free or 5-HT (agonist)-containing external solution (flow rate, 200 µl/min). A 2-sec agonist pulse was delivered every 60 sec unless otherwise stated. To study the inhibitory properties of the antagonists, they were presented at the indicated concentration in both 5-HT-free and 5-HT (10 µM)-containing solutions. 5-HT; the agonists 2-Me-5-HT, PBG, and mCPBG; and the antagonists metoclopramide and tropisetron (Sigma, Deisenhofen, Germany; RBI, Köln, Germany) were dissolved in an external solution.
Data acquisition and analysis.
Current signals were recorded
at a holding potential of
50 mV with an EPC-9 amplifier using the
Pulse software on a Macintosh Centris 650 computer. The data were
analyzed using PulseFit (Heka, Lamprecht, Germany) and IgorPro
(Wavemetrics, Lake Oswego, OR) software.
Binding of the radioligand [3H]GR65630 to membrane
fractions of cells expressing the 5-HT3R.
HEK 293 cells stably expressing the human or guinea pig
5-HT3R were grown as described above. The cells
were harvested, washed with phosphate-buffered saline, and homogenized
in 5 volumes of 0.32 M sucrose, 50 mM
Tris·HCl, and 1 mM EDTA, pH 7.5, containing the protease
inhibitors aprotinin (10 µg/ml), pepstatin (0.75 µg/ml),
benzamidine (0.1 mM), phenylmethylsulfonyl fluoride (0.5 mM), and
trans-epoxysuccinyl-L-leucylamido-(4-guanidino)-butane (1 µM) as described previously (Maricq et al.,
1991
). After centrifugation at 750 × g for 10 min, the
supernatant fraction was recentrifuged at 100,000 × g
for 45 min. The resulting pellet was resuspended in 50 mM
Tris·HCl, and 1 mM EDTA, pH 7.5, containing the same protease inhibitors described above. For ligand binding experiments,
200 µg of protein was incubated in microtiter plates in a total volume of 250 µl at 37° for 30 min with the indicated
concentrations of [3H]GR65630 (64 Ci/mM; New England Nuclear Research Products, Boston, MA).
Bound ligands were separated from free ligands by washing with ice-cold
assay buffer (50 mM Tris·HCl, 1 mM EDTA, pH
7.5) and rapid filtration through Whatman GF/B filters with a Titertek cell harvester (Nunc, Wiesbaden, Germany). Radioactivity was determined by liquid scintillation spectroscopy. Nonspecific binding was determined in the presence of 10 µM MDL 72222. Specific
binding represented 65-80% of the total binding. Binding data were
analyzed with the EBDA and LIGAND programs, which provide a nonlinear, least-squares regression analysis (Munson and Rodbard, 1980
). This
weighted curve-fitting program assumes binding according to the law of
mass action to independent classes of binding sites.
| |
Results |
|---|
|
|
|---|
Structure of guinea pig 5-HT3R-A.
Using primers P1
and P2 (Fig. 1) deduced from conserved regions of known
5-HT3Rs, we were able to isolate a 959-bp cDNA
fragment from guinea pig small intestine mRNA through RT-PCR that was
63% homologous to the partial cDNA sequence coding for the murine 5-HT3R (Maricq et al., 1991
). The RACE
technique was used to obtain the full-length cDNA sequence (Lankiewicz
et al., 1997
). Missing 3
- and 5
-termini of the
5-HT3 cDNA were amplified from small intestine
cDNA as described in Materials and Methods. Four independent cDNA
clones of the 3
-end of 813 bp were isolated. The clones were equal in
sequence except for some inhomogeneity at position 2067 in the
3
-untranslated region. The number of guanosines varied from 10 to 13, and the subsequent adenosine occurred in only one clone. Four
independent cDNA clones of the 5
-end were isolated. Sequencing showed
that the isolated fragments varied in length by four nucleotides; this
may be caused by incomplete cDNA synthesis.
- and 3
-RACE products. The sequence contains a 5
- and
3
-nontranslated region and a complete ORF of 1473 nucleotides. The
translation initiation site was assigned to the ATG at position 133, which is surrounded by an almost perfect ribosome-binding consensus
sequence (Kozak, 1989
-end encoding a short polypeptide of 16 amino
acids. Similar ORFs can be found in the cDNA coding for human
5-HT3R (Miyake et al., 1995
-untranslated region has a poly(A)+ termination
signal at position 2076 followed by a poly(A)+
tract 14 nucleotides downstream.
The large ORF of the guinea pig 5-HT3R encodes
for a protein of 484 amino acids
(5-HT3Rs) or 490 amino
acids (5-HT3Rl),
respectively. Both encode the same mature polypeptide except for a
deletion of 6 amino acids in
5-HT3Rs. Amino acid
sequence comparison reveals 81% homology to the mouse and rat
5-HT3R splice variants and 86% homology to the
human 5-HT3R (Fig.
2). The structural features correspond to
other ligand-gated ion channels (Stroud et al., 1990
-aminobutyric
acidA receptor channels. Four potential sites for
N-glycosylation (Marshall, 1972
|
Alternative Splicing
To analyze alternative splicing, we performed RT-PCR experiments
with primers P2 and P9 (Fig. 1) flanking the position of the deletion.
mRNA extracted from different guinea pig tissues was analyzed and
compared with the murine cell line NG108-15, which is known to express
both forms (Emerit et al., 1995
). PCR resulted in fragments
of 207 and 225 bp, respectively, as predicted from the nucleotide
sequences of the splice variants. Gel electrophoresis of these PCR
products revealed that both forms of the 5-HT3R
occur together in murine NG108-15 cells and guinea pig cortex,
intestine, and liver but not in guinea pig spleen and muscle. Fig.
3 shows that
5-HT3Rl has a lower level
of expression compared with
5-HT3Rs. This finding is
supported by investigation of subcloned PCR fragments (p5-HT3GP plasmids). Restriction analysis
revealed that only 4 of 40 clones contain cDNA for the
5-HT3Rl.
|
Electrophysiological Recordings
HEK 293 cells expressing 5-HT3Rs from mouse (Ml), human (H), or guinea pig (GPl or GPs), respectively, were recorded in the whole-cell voltage-clamp configuration. 5-HT (10 µM) induced currents that developed fast, reached a maximum, and decreased with characteristic decay constants (Fig. 4, column 1).
|
To characterize the 5-HT3Rs of mouse, human, and guinea pig in more detail, we investigated the activation and desensitization kinetics as well as the reversal potential of the 5-HT-induced currents.
Activation kinetics of 5-HT-induced currents. The activation kinetics of murine, human, and guinea pig 5-HT3Rs were dose dependent (i.e., the currents developed faster with increasing 5-HT concentrations). We compared the rise time [time to reach the maximum of the current (i.e., time to peak)] of 10 µM 5-HT-induced currents. Currents induced by 10 µM 5-HT developed quickly in cells transfected with murine and human 5-HT3Rs but slower in cells expressing guinea pig 5-HT3Rs (Table 1).
|
Current/voltage relationship. The 5-HT-induced currents of murine, human, and guinea pig 5-HT3Rs reversed polarity at holding potentials close to 0 mV (Table 1). Given our ionic conditions for the pipette and bath solutions (see Materials and Methods), the resulting reversal potential predicts 5-HT-induced currents through nonselective cation channels. The current/voltage relationship of all investigated 5-HT3Rs showed no pronounced rectification (Fig. 5), indicating equal permeability for Na+ and Cs+ ions.
|
Desensitization kinetics of 5-HT-induced currents.
In the
continuous presence of the agonist 5-HT, the induced currents declined
with time (i.e., desensitized). Murine and human 5-HT3Rs showed a rather fast desensitization
kinetics that were best fit by single- and double-exponential
functions, respectively. The application of 10 µM 5-HT to
cells expressing murine 5-HT3Rs induced currents
that declined with time constants of
fast = 155 ± 60 msec and
slow = 1226 ± 169 msec in cells showing double-exponential time courses and with
= 1047 ± 79 msec in cells showing monoexponential time courses of
desensitization. Currents through human 5-HT3Rs declined with time constants of
fast = 280 ± 49 msec and
slow = 2313 ± 659 msec in cells showing double-exponential time courses and with
= 639 ± 68 msec in cells showing monoexponential time courses of
desensitization. The desensitization kinetics of guinea pig
5-HT3Rs showed a more linear decrease (Fig. 4)
and could not be fit with an exponential function. For this reason, we
calculated the decrease in amplitude after 2 sec of 5-HT-application.
The data presented in Table 1 show rather fast desensitization of 5-HT-induced currents in HEK 293 cells expressing murine and human 5-HT3Rs, in contrast to only slight
desensitization of both types of the guinea pig
5-HT3Rs. In addition, we investigated the
presensitization characteristics of the human and
GPs 5-HT3Rs. We evaluated
the amplitude of the response to application of 300 µM
5-HT in various background concentrations of 5-HT. The presensitization
EC50 value (IC50) was
0.2 ± 0.002 µM for human and 0.5 ± 0.008 µM for GPs 5-HT3Rs (n = 5).
50 mV).
Pharmacology of Human, Murine, and Guinea Pig 5-HT3Rs
Agonists at 5-HT3Rs. We investigated the potencies of the 5-HT3R agonists 5-HT, 2-Me-5-HT, PBG, and mCPBG. The expressed 5-HT3Rs of all species responded to 5-HT and the 5-HT3R agonist 2-Me-5-HT in a dose-dependent way and with very similar apparent affinities (Fig. 6; for EC50 values, see Table 2). The agonists PBG and mCPBG discriminated between the 5-HT3Rs of the various species. In murine 5-HT3Rs, mCPBG in nanomolar concentration induced marked responses, whereas in human 5-HT3Rs, micromolar concentration of mCPBG is required. At least, the guinea pig 5-HT3Rs GPl and GPs showed a 10-fold lower apparent affinity for mCPBG.
|
|
90 and +50 mV (data not shown). Reducing the agonist
concentration at the end of the application removed channel block and
led to a pronounced "off response": ions were able to permeate
through the still opened but no longer blocked channel. The subsequent
decline in the current indicates channel closing due to receptor
inactivation.
The murine 5-HT3R had a four times higher
apparent affinity for PBG than did the human
5-HT3R. The guinea pig
5-HT3Rs (GPl and
GPs) did not respond to PBG, even in millimolar
concentrations. We also found that PBG did not antagonize guinea pig
5-HT3Rs (data not shown).
Antagonists at 5-HT3Rs. We also tested the effectiveness of the competitive 5-HT3R antagonists metoclopramide and tropisetron (Fig. 7). The murine and human 5-HT3Rs were most sensitive to tropisetron and metoclopramide, whereas the guinea pig 5-HT3Rs had 10 times lower apparent affinities (for IC50 values, see Table 2).
|
Radioligand Binding Studies
Radioligand binding studies of recombinant human and guinea pig 5-HT3R were performed with membrane preparations of HEK 293 cells stably transfected with receptor cDNA. The 5-HT3R-selective radioligand [3H]GR65630 specifically bound to membranes from cells expressing human 5-HT3R with a KD value of 2.56 ± 1.2 nM and a Bmax value of 4915 ± 1632 fmol/mg of protein and bound to membranes from cells expressing 5-HT3GPl with a KD value of 3.08 ± 1.2 nM and a Bmax value of 324 ± 112 fmol/mg of protein (data not shown). To assess the binding potency of 5-HT3R agonists and antagonists, we performed competition studies. As shown in Fig. 8A, the antagonist tropisetron and the agonists 2-Me-5-HT, PBG, and mCPBG displaced from human 5-HT3R with KI values of 4.82 ± 1.3 nM, 989 ± 412 nM, 22 ± 4 µM, and 243 ± 112 nM, respectively. The specific binding of [3H]GR65630 to membranes from cells expressing 5-HT3GPl was displaced by tropisetron, 2-Me-5-HT, and mCPBG with KI values of 23 ± 7 nM, 1.2 ± 0.4 µM, and 6.2 ± 1 µM. PBG in concentrations of <100 µM did not displace [3H]GR65630 (Fig. 8B).
|
Chimeric 5-HT3Rs
To investigate the molecular determinants for the species differences in desensitization kinetics and ligand binding properties, we constructed chimeric receptors between human and GP 5-HT3R sequences. Molecular cloning produced, among others, two chimeric receptors, E4 and C1, which consisted of the guinea pig amino terminus and the human carboxyl-terminal domain (E4) and the human amino-terminal domain and the guinea pig carboxyl terminus (C1), respectively (Fig. 9, E amd F). The "switch points" are indicated in Fig. 2 (5-HT3GPs numbering: E4, amino acid 220; C1, amino acid 248). Both the E4 and C1 5-HT3Rs contained a human 5-HT3R-derived 28-amino-acid-spanning sequence adjacent to the M1 domain. Transient expression of the E4 or C1 receptor plasmids in HEK 293 cells produced functional 5-HT3R channels, which were sensitive to 5-HT and PBG (Fig. 9). The dose-response relationship yielded EC50 values of 1.3 ± 0.08 µM 5-HT and 21.8 ± 1.4 µM PBG for C1 receptors and 1.28 ± 0.06 µM 5-HT and 19.3 ± 7.2 µM PBG for E4 receptors, respectively. In addition, the application of 10 µM 5-HT induced fast desensitizing (human-like) currents in E4 and slow desensitizing (guinea pig-like) currents in C1 receptor-expressing HEK cells (Table 1).
|
| |
Discussion |
|---|
|
|
|---|
Significant efforts by workers in several laboratories using
cloning (by homology or expression) and/or purification have not
revealed more than one subunit of the 5-HT3R.
Recently, a splice variant of the murine 5-HT3R-A
was identified in N1E-115 mouse neuroblastoma cells (Hope et
al., 1993
) showing a deleted region of six amino acids within the
putative cytoplasmic loop between M3 and M4 compared with the original
NCB20 clone (Maricq et al., 1991
). RT-PCR experiments
performed with primers flanking this region showed that both isoforms
occur in all murine cell lines (N1E-115, NCB20, NG108-15; Hope
et al., 1993
; Werner et al., 1994
). Analysis of a
mouse genomic clone suggested that these isoforms are generated by the
alternative use of acceptor splice sites (Uetz et al.,
1994
). We report here the corresponding sequences of the guinea pig
5-HT3R-A cDNA and show evidence for alternative splicing in different tissues of guinea pig as a method of generating two different 5-HT3R-A mRNAs coding for long
(5-HT3R-Al) and short (5-HT3R-As) forms. The
physiological relevance of the two alternative spliced subunits in
rodents still is unclear. Besides the action of the partial agonist
2-Me-5-HT, significant differences could not be detected between the
pharmacological properties of the murine splice variants. Recent
investigations suggest the involvement of the splice variants in
neuronal development (Miquel et al., 1995
). The relative
expression of the long form of 5-HT3R-A mRNA in
the hippocampus and cerebral cortex of rat was found to be significantly higher prenatally than postnatally.
The full-length sequences of the guinea pig
5-HT3R-A cDNAs reported here confirm the
ligand-gated ion channel features found previously in the
5-HT3R-A subunit cloned from NCB20 cells (Maricq et al., 1991
). The high homology (81% and 86%) to the
murine and human receptor, respectively, indicates that despite the
electrophysiological and pharmacological differences, the guinea pig
5-HT3R does not define a novel class of
5-HT3Rs in terms of homology classification.
The electrophysiological and pharmacological data for 5-HT3R from guinea pig, human, and mouse were determined in the same cellular background to avoid artifacts resulting from the expression system (e.g., oocytes versus mammalian cells), different modifications, or specific subunit composition characteristic for a given tissue.
The KI values obtained from radioligand competition studies qualitatively support the EC50/IC50 values determined through patch-clamp experiments. The quantitative differences between affinity and apparent affinity may be due in part to methodological reasons. Electrophysiological studies determine receptor function in the living cells, whereas binding studies carried out with membrane preparations measure strictly receptor/ligand affinities.
Our data show that mCPBG is less potent for the guinea pig
5-HT3R than for that of human and mouse. The
derivative PBG is neither agonistic nor antagonistic for guinea pig
5-HT3Rs stably expressed in HEK 293 cells. These
data are confirmed by the observation that PBG failed to bind to
5-HT3R protein in isolated membranes. PBG showed
no effect on 5-HT3Rs of guinea pig in functional
assays (Butler et al., 1990
; Blier and Bouchard, 1993
). The
antagonists metoclopramide and tropisetron are less active on the
guinea pig 5-HT3R that on the receptors of mouse
and human in electrophysiological and radioligand binding assays. These
findings correspond to the data obtained by functional characterization
of 5-HT3Rs in guinea pig muscle myenteric plexus
and vagus nerve preparations (Butler et al., 1990
), in which
all 11 antagonists exhibited a markedly lower affinity for guinea pig
than for rat receptors.
Binding and electrophysiological studies revealed that the properties
of the recombinantly expressed 5-HT3R from guinea
pig do not significantly differ from those in native tissues (Butler et al., 1990
; Kilpatrick and Tyers, 1992
). These data are in
line with the assumption that the native 5-HT3R
is a homo-oligomer; a similar molecular structure is suggested for the
neuronal
7 acetylcholine receptor (Sargent, 1993
). This does not
contradict the findings that cloned and native receptors differ in
single-channel conductances; modulation of single-channel conductances
in 5-HT3Rs in N1E-115 cells has been shown by the
action of protein kinase C (Van Hooft and Vijverberg, 1995
).
Binding sites for agonists of the 5-HT3R are
postulated to occur on the large extracellular amino-terminal domain
from homology to the nicotinic acetylcholine receptor (Barnard, 1992
).
Comparison of the guinea pig with human and mouse
5-HT3R-A sequences reveals that only few amino
acids are unique to guinea pig.
To investigate the molecular determinants for the species differences
in desensitization kinetics and ligand binding properties, we
constructed chimeric receptors between human and guinea pig 5-HT3R sequences. Molecular cloning produced two
chimeric receptors, E4 and C1, which consisted of the guinea pig amino
terminus and the human carboxyl-terminal domain (E4) or the human
amino-terminal domain and the guinea pig carboxyl terminus (C1),
respectively. Both the E4 and C1 5-HT3Rs
contained a human 5-HT3R-derived
28-amino-acid-spanning sequence adjacent to the M1 domain. Functional
expression of the E4 or C1 receptor plasmids in HEK 293 cells produced
5-HT3R channels that were sensitive to 5-HT and
PBG. Accepting the hypothesis that the ligand binding site is located
at the amino-terminal domain (Eisele et al., 1993
), the
apparent PBG sensitivity of the E4 receptor (guinea pig/human) suggests
that at least parts of the PBG binding site are located between the
switching points of E4 and C1.
The application of 10 µM 5-HT-induced fast desensitizing
(human-like) currents in E4 and slow desensitizing (guinea pig-like) currents in C1 receptor-expressing HEK 293 cells indicates that the
desensitization kinetics might be delegated to the carboxyl-terminal part of the receptor subunit. Others, however, found the tertiary and
quaternary structures of the whole receptor molecule were responsible
for the kinetics of the current (Eisele et al., 1993
).
Chimeric receptors from guinea pig and human therefore are a suitable tool for detailed mapping of agonist and antagonist binding sites. It is tempting to speculate that the reduced sensitivity of the guinea pig 5-HT3R for all antagonists tested in comparison to its normal sensitivity for 5-HT is caused by partially overlapping sites for agonist and antagonist binding.
Our data show that the 5-HT3Rs from human and guinea pig differ markedly in their pharmacological properties and suggest that the guinea pig is not a suitable experimental animal for the development of new 5-HT3 agonists or antagonists with clinical relevance.
| |
Acknowledgments |
|---|
The authors thank Drs. A. Maricq and D. Julius for the generous gift of the p5-HT3R-A plasmid, B. Abstreiter and H. Bartel for technical assistance, Dr. E.-J. Speckmann and Dr. Klemnauer for the human biopsy probes, and Dr. B. Ache for valuable comments on the manuscript.
| |
Footnotes |
|---|
Received June 20, 1997; Accepted October 9, 1997
This work was supported in part by the Gerhard-Heß-Programm of the Deutsche Forschungsgemeinschaft (R.R.).
Send reprint requests to: Dr. Hanns Hatt, Fakultät für Biologie, Lehrstuhl für Zellphysiologie, Ruhr-Universitätsstr. 150, D-44780 Bochum, Germany. E-mail: hatt{at}cphys.ruhr-uni-bochum.de
| |
Abbreviations |
|---|
5-HT3R, 5-hydroxytryptamine3 receptor;
5-HT, 5-hydroxytryptamine;
PBG, 1-phenylbiguanide;
mCPBG, m-chlorophenylbiguanide;
2-Me-5-HT, 2-methyl-5-hydroxytryptamine;
RT, reverse transcriptase;
EGTA, ethylene glycol bis(
-aminoethyl
ether)-N,N,N
,N
-tetraacetic
acid;
HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid;
PCR, polymerase chain reaction;
ORF, open reading frame;
RACE, rapid
amplification of cDNA ends;
HEK, human embryonic kidney.
| |
References |
|---|
|
|
|---|
-leaders of mRNAs as regulators of translation.
Trends Biochem Sci
19:
159-164[Medline]. This article has been cited by other articles:
![]() |
R. Zhang, N. A. White, F. S. Soti, W. R. Kem, and T. K. Machu N-Terminal Domains in Mouse and Human 5-Hydroxytryptamine3A Receptors Confer Partial Agonist and Antagonist Properties to Benzylidene Analogs of Anabaseine J. Pharmacol. Exp. Ther., June 1, 2006; 317(3): 1276 - 1284. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Eisensamer, M. Uhr, S. Meyr, G. Gimpl, T. Deiml, G. Rammes, J. J. Lambert, W. Zieglgansberger, F. Holsboer, and R. Rupprecht Antidepressants and Antipsychotic Drugs Colocalize with 5-HT3 Receptors in Raft-Like Domains J. Neurosci., November 2, 2005; 25(44): 10198 - 10206. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schnizler, B. Saeger, C. Pfeffer, A. Gerbaulet, U. Ebbinghaus-Kintscher, C. Methfessel, E.-M. Franken, K. Raming, C. H. Wetzel, A. Saras, et al. A Novel Chloride Channel in Drosophila melanogaster Is Inhibited by Protons J. Biol. Chem., April 22, 2005; 280(16): 16254 - 16262. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Beene, K. L. Price, H. A. Lester, D. A. Dougherty, and S. C. R. Lummis Tyrosine Residues That Control Binding and Gating in the 5-Hydroxytryptamine3 Receptor Revealed by Unnatural Amino Acid Mutagenesis J. Neurosci., October 13, 2004; 24(41): 9097 - 9104. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Sessoms-Sikes, M. E. Hamilton, L.-X. Liu, D. M. Lovinger, and T. K. Machu A Mutation in Transmembrane Domain II of the 5-Hydroxytryptamine3A Receptor Stabilizes Channel Opening and Alters Alcohol Modulatory Actions J. Pharmacol. Exp. Ther., August 1, 2003; 306(2): 595 - 604. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-T. Liu, S. Rayport, Y. Jiang, D. L. Murphy, and M. D. Gershon Expression and function of 5-HT3 receptors in the enteric neurons of mice lacking the serotonin transporter Am J Physiol Gastrointest Liver Physiol, December 1, 2002; 283(6): G1398 - G1411. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. N Sudweeks, J. A van Hooft, and J. L Yakel Serotonin 5-HT3 receptors in rat CA1 hippocampal interneurons: functional and molecular characterization J. Physiol., November 1, 2002; 544(3): 715 - 726. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Machu, M. E. Hamilton, T. F. Frye, C. L. Shanklin, M. C. Harris, H. Sun, T. E. Tenner Jr., F. S. Soti, and W. R. Kem Benzylidene Analogs of Anabaseine Display Partial Agonist and Antagonist Properties at the Mouse 5-Hydroxytryptamine3A Receptor J. Pharmacol. Exp. Ther., December 1, 2001; 299(3): 1112 - 1119. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lobitz, G. Gisselmann, H. Hatt, and C. H. Wetzel A Single Amino-Acid in the TM1 Domain Is an Important Determinant of the Desensitization Kinetics of Recombinant Human and Guinea Pig {alpha}-Homomeric 5-Hydroxytryptamine Type 3 Receptors Mol. Pharmacol., April 1, 2001; 59(4): 844 - 851. [Abstract] [Full Text] |
||||
![]() |
L. J. Steward, F. G. Boess, J. A. Steele, D. Liu, N. Wong, and I. L. Martin Importance of Phenylalanine 107 in Agonist Recognition by the 5-Hydroxytryptamine3A Receptor Mol. Pharmacol., June 1, 2000; 57(6): 1249 - 1255. [Abstract] [Full Text] |
||||
![]() |
A. D. Spier and S. C. R. Lummis The Role of Tryptophan Residues in the 5-Hydroxytryptamine3 Receptor Ligand Binding Domain J. Biol. Chem., February 25, 2000; 275(8): 5620 - 5625. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J Gunthorpe, J. A Peters, C. H Gill, J. J Lambert, and S. C R Lummis The 4'lysine in the putative channel lining domain affects desensitization but not the single-channel conductance of recombinant homomeric 5-HT3A receptors J. Physiol., January 15, 2000; 522(2): 187 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Dubin, R. Huvar, M. R. D'Andrea, J. Pyati, J. Y. Zhu, K. C. Joy, S. J. Wilson, J. E. Galindo, C. A. Glass, L. Luo, et al. The Pharmacological and Functional Characteristics of the Serotonin 5-HT3A Receptor Are Specifically Modified by a 5-HT3B Receptor Subunit J. Biol. Chem., October 22, 1999; 274(43): 30799 - 30810. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Wetzel, M. Oles, C. Wellerdieck, M. Kuczkowiak, G. Gisselmann, and H. Hatt Specificity and Sensitivity of a Human Olfactory Receptor Functionally Expressed in Human Embryonic Kidney 293 Cells and Xenopus Laevis Oocytes J. Neurosci., September 1, 1999; 19(17): 7426 - 7433. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhou and J. J. Galligan Synaptic Activation and Properties of 5-Hydroxytryptamine3 Receptors in Myenteric Neurons of Guinea Pig Intestine J. Pharmacol. Exp. Ther., August 1, 1999; 290(2): 803 - 810. [Abstract] [Full Text] |
||||
![]() |
S. J. Coultrap, H. Sun, T. E. Tenner Jr., and T. K. Machu Competitive Antagonism of the Mouse 5-Hydroxytryptamine3 Receptor by Bisindolylmaleimide I, a "Selective" Protein Kinase C Inhibitor J. Pharmacol. Exp. Ther., July 1, 1999; 290(1): 76 - 82. [Abstract] [Full Text] |
||||
![]() |
A. G. Hope, D. Belelli, I. D. Mair, J. J. Lambert, and J. A. Peters Molecular Determinants of (+)-Tubocurarine Binding at Recombinant 5-Hydroxytryptamine3A Receptor Subunits Mol. Pharmacol., June 1, 1999; 55(6): 1037 - 1043. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||