|
|
|
|
Vol. 53, Issue 2, 234-240, February 1998
Merck Research Laboratories, Rahway, New Jersey 07065 (T.M.F., R.-R.C.H, M.R.T, C.M., T.S., J.V., L.H.T.V.d.P.), and Department of Anatomy and Neurobiology, Washington University School of Medicine, St. Louis, Missouri 63110 (V.V.K., J.E.K)
| |
Summary |
|---|
|
|
|---|
The leptin receptor is a member of the class I cytokine receptor family and is involved in the control of appetite and body weight. The predicted amino acid sequence of the extracellular region of the cloned leptin receptor differs from that of many other cytokine receptors in that it contains two homologous segments representing potential ligand binding sites. After the analysis of various deletion and substitution mutants of the leptin receptor, we found that the first potential binding motif is not required for leptin binding and receptor activation, whereas modification of the second potential binding motif can lead to inactive receptor mutants. Further deletion analysis generated a minimal binding domain that retains high affinity leptin binding. The leptin binding domain thus has been localized to residues 323-640, which contain the second segment of cytokine receptor domain/fibronectin type 3 domain (residues 428-635). Coexpression of the active isoform of leptin receptor (OB-Rb) with an inactive mutant lacking high affinity leptin binding site led to suppression of the activity mediated by OB-Rb, suggesting that the leptin receptor may exist as a multimeric complex in the absence of leptin.
| |
Introduction |
|---|
|
|
|---|
The
study of mouse genetics has revealed several genetic markers that play
an important role in obesity. For example, the ob gene
encodes the protein hormone leptin, which is secreted by fat cells.
Mutations in the ob gene can abolish the expression of
functional leptin (Zhang et al., 1994
). The db
gene encodes a receptor for leptin, which is expressed in several
different tissues, including hypothalamus (Tartaglia et al.,
1995
; Chen et al., 1996
; Cioffi et al., 1996
; Lee
et al., 1996
). Several protein products are produced from
the db gene as a result of alternative splicing, including a
long form (OB-Rb) and a short form (OB-Ra). The only sequence
difference between OB-Rb and OB-Ra is that OB-Rb contains a large
intracellular domain (304 residues) with putative JAK binding sites and
STAT binding sites (Stahl and Yancopoulos, 1993
; Schindler and Darnell,
1995
; Ihle, 1996
), whereas OB-Ra contains a very short intracellular
domain (34 residues) with only one putative JAK binding site. Both
OB-Ra and OB-Rb bind leptin with the same affinity, whereas only OB-Rb
can elicit intracellular response (Tartaglia et al., 1995
;
Baumann et al., 1996
; Ghilardi et al., 1996
;
Rosenblum et al., 1996
). The fatty Zucker rats
are phenotypically similar to the db mice, but the genetic
defect in the fatty Zucker rats is a point mutation in the
rat OB-R gene (Chua et al., 1996
; Phillips et
al., 1996
). It has been proposed that activation of the
hypothalamic OB-Rb can lead to reduction in food intake and body weight
(Banks et al., 1996
; Glaum et al., 1996
; Schwartz
et al., 1996
).
Sequence analysis of OB-Rb indicated that it is a member of the class I
cytokine receptor family; this family includes GH-R, EPO-R,
interleukin-6 receptor, and GCSF-R. The extracellular region of these
receptors are characterized by the presence of multiple domains,
including CK, C2, and F3 (Fig. 1). Each
of these domains is characterized by unique consensus residues (Bazan,
1990
; Patthy, 1990
; Larsen et al., 1990
; Miyazaki et
al., 1991
; Callard and Gearing, 1994
). High resolution structure
for the GH-R and EPO-R provided a clear localization of the ligand
binding site (Livnah et al., 1996
; Wells and de Vos, 1996
).
The extracellular region of the GH-R is composed of two domains, a CK
domain and an F3 domain, and the combined CK-F3 domain forms the ligand
binding site.
|
In contrast to the GH-R, the extracellular region of the OB-R contains two repeating CK-F3 domains (Figs. 1 and 2). Such repeating CK-F3 domains are not commonly found in cytokine receptors, and the localization of the ligand binding site is not known. The current report provides experimental evidence indicating that the first CK-F3 domain (Fig. 1, gray symbols) of OB-R is not required for leptin binding and receptor activation, whereas the second CK-F3 domain (Fig. 1, black symbols) is the most likely leptin binding site. In addition, modification of the second CK-F3 domain can lead to diminished leptin binding, yet coexpression of the inactive mutant with the wild-type OB-Rb resulted in suppression of the maximal response mediated by OB-Rb. These data suggest that the leptin receptor may exist as a multimeric complex and leptin activates the receptor by inducing a conformational change.
|
| |
Materials and Methods |
|---|
|
|
|---|
Receptor mutants.
The human OB-Rb was cloned as described
previously (Tartaglia et al., 1995
) and subcloned into the
mammalian expression vector pcDNA3 at the BamHI and
XbaI sites (InVitrogen, San Diego, CA). The human OB-R
D(41-322) deletion mutant was generated by removing the nucleic acids
encoding residues 39-323 from the wild-type OB-Rb cDNA after cleavage
with the restriction enzymes SphI (at residue 38) and
ScaI (at residue 324). An adapter was generated by annealing
two oligonucleotides (5
-CCACCAAGT and 5
-ACTTGGTGGCATG), and the
adapter was ligated to the SphI and ScaI cut
human OB-Rb cDNA to regenerate residues 39, 40, and 323.
-GAACATGAATGCCATTTCCAGCCAATCTTCCTATTATC and 5
-
GGAAAATGCATTCAACTGTGTAGGCTGGATTGCTC) that amplified the region
encoding residues 500-632. This PCR fragment was cleaved by the
restriction enzyme BsmI. In a parallel experiment, the full-length cDNA encoding the wild-type human OB-Rb in pcDNA3 was
cleaved by BsmI at residues 419 and 499, followed by removal of the sequence encompassing residues 419-499 and ligation with the
PCR fragment encoding residues 500-632.
We generated the deletion mutant D(867-1165) using a PCR fragment
encoding residues 500-866 with two oligonucleotides
(5
-TTCCAGCCAATCTTCCTATTATC and 5
-
ACATCTCTAGACATTCTTTGGTGTGA-TATTAATAATG), which also contains a
XbaI site). This PCR fragment was cleaved with the
restriction enzymes EcoNI (at residue 640) and
XbaI (after residue 866), and the DNA fragment encoding
residues 640-866 was purified. In parallel, the human OB-Rb cDNA was
cleaved with EcoNI at residue 640 and with XbaI
downstream from the stop codon. The DNA encoding residues 640-1165 was
removed by gel purification, and the remaining receptor cDNA in the
pcDNA3 plasmid was ligated with the PCR fragment encoding residues
640-866. The D(867-1165) mutant thus contains SRGPYSIVSPKC after
residue 866, making it similar to the OB-Ra in length, but lacks any
potential JAK or STAT binding motif.
The ECD-OB-R mutant was generated by fusing residues 1-840 of OB-Rb
with the glycan-phosphatidylinositol signal sequence from the human
placenta alkaline phosphatase (HPAP-S peptide) as described previously
(Lin et al., 1990Binding assay.
COS cells in a 12-well plate were transfected
with 0.5 µg/well of plasmid DNA encoding either the wild-type OB-Rb
or a mutant and 5 µg of lipofectamine (GIBCO, Gaithersburg, MD). At
48 hr after transfection, the culture dish was washed with binding
buffer (Hanks' balanced salt solution supplemented with 0.5% bovine
serum albumin, 25 mM HEPES, 0.5%
NaN3). 125I-mouse leptin
(New England Nuclear Research Products, Boston, MA) was diluted to 0.1 nM in binding buffer, and 0.5 ml was added to each well.
The amount of cells in each well was appropriate so that <10% of the
added radiolabeled leptin was bound to the cell surface. Unlabeled
leptin was included in inhibition binding assay, with final
concentrations ranging from 10 pM to 100 nM. Recombinant human leptin was expressed in Escherichia coli
and refolded in glutathione via step dialysis (Rosenblum, et
al., 1996
). The cells were incubated at 4° for 3 hr, after which
the cells were washed four times with binding buffer and lysed with 0.05% sodium dodecyl sulfate. The amount of bound
125I-mouse leptin was determined in a
-counter. The data were fitted to the equation (cpm [L]
cpm
[l00 nM leptin])/(cpm [0]
cpm [l00 nM
leptin]) = IC50/([L] + IC50), where cpm [L] and cpm [0] represent
bound radioligand in the presence or absence of unlabeled ligand,
respectively; [L] represents the concentration of unlabeled ligand;
and IC50 represents the concentration of
unlabeled ligand that causes 50% inhibition of the specifically bound
radiolabeled ligand. The receptor expression level
(Bmax) was calculated as described
previously (DeBlasi et al., 1989
). Similar data were obtained using 125I-human leptin (New England
Nuclear Research Products).
Luciferase assay.
COS or CHO cells in 12-well plate were
transfected with 8 µg/well of lipofectamine (GIBCO) and 0.25 µg/well of each of the three plasmids: OB-Rb (or mutant), pAH32
(Rosenblum et al., 1996
), and pCH110 (a
-galactosidase
expression vector for normalizing transfection efficiency; Pharmacia,
Piscataway, NJ). For cotransfection experiments, 0.25 µg/well of each
of four plasmids were included: OB-Rb, mutant (or pcDNA3 for the
control), pAH32, and pCH110. At
36 hr after transfection, various
amounts of recombinant human leptin were added. Cells then were
incubated for 16 hr. Cell culture medium was removed, and cells were
washed with phosphate-buffered saline. Luciferase activity was
determined using a luciferase assay kit (Promega, Madison, WI) and a
Dynatech ML 3000 luminometer (Dynatech, Chantilly, VA) in cycle mode.
The
-galactosidase activity was determined using a
-galactosidase
assay kit (Promega). Luciferase activity in each well was corrected for
minor differences in the transfection efficiency by dividing the
relative light units obtained for each sample by the
-galactosidase
activity. The normalized data were fitted to the equation
y = [L]/([L] + EC50), in
which y represents the response relative to the maximal
response at 100 nM leptin, [L] represents the leptin
concentration, and EC50 represents the leptin
concentration that elicits half-maximal response.
Antibodies and Western blot.
A peptide corresponding to the
amino terminus of the human OB-Rb (NLSYPITPWRFKLSC, residues 23-37)
was used for antibody generation. The peptide was coupled to
maleimide-activated key limpet hemocyanin (Pierce, Rockford, IL) at the
cysteine residue and used for immunization. BALB/c mice were immunized
by intraperitoneal injection at several sites with 75 µg of key
limpet hemocyanin-peptide conjugate emulsified with complete Freund's
adjuvant. The animals were boosted three times at monthly intervals
with the same dose of antigen emulsified with incomplete Freund's
adjuvant. The serum titer of antipeptide antibodies was monitored by
solid-phase ELISA. Mice with the best immune response received a final
injection of antigen in saline 96 hr before fusion. Hybridoma cells
were prepared by fusion of splenocytes from immunized mice with the
myeloma cell line P3g8.6.5.3 using the polyethylene glycol method. The
growth medium of primary hybridoma cell lines was tested for
antipeptide antibodies by solid-phase ELISA. The specific antibody
producing hybridomas were cloned by the method of limiting dilution
(0.5 cell/well), propagated, and tested by solid-phase ELISA. The
monoclonal antibodies were produced as tissue culture supernatants.
Nine isolated hybridomas produced the identical isotype of IgG
(IgG1,
chain) and recognized the same
antigenic epitope of the immunizing peptide in solid-phase ELISA. The
tissue culture supernatant of monoclonal antibody 3G10.1 with titer
1:4500 in solid-phase ELISA was used in the current study.
| |
Results |
|---|
|
|
|---|
To test whether the first CK-F3 domain is required for leptin
binding, this region (residues 41-322) of the human OB-Rb was deleted,
generating the receptor mutant D(41-322). The ligand binding affinity
and receptor activation mediated by D(41-322) were determined after
transfection in COS cells. As shown in Fig. 3A and Table
1, D(41-322) binds recombinant human
leptin with the same affinity as the wild-type receptor. The activation
of the leptin receptor can be examined by cotransfecting the receptor cDNA with a luciferase reporter gene under the control of a minimal thymidine kinase promoter and STAT binding elements (Rosenblum et
al., 1996
). Activation of the leptin receptor leads to the phosphorylation of endogenous JAKs and STATs and results in the synthesis of luciferase. As shown in Fig. 3B and Table 1, leptin activated both the wild-type OB-Rb and the D(41-322) mutant with similar EC50 values (
0.5 nM) and
similar maximal response. These data demonstrate that the first CK-F3
domain is not required for leptin binding.
|
|
To investigate the role of the second CK-F3 domain in leptin binding, a
domain substitution was performed. A simple deletion of the second
CK-F3 domains was not performed because it would place the first CK-F3
domain at the same position as the second CK-F3 domain. To construct a
substitution mutant, the CK domain (which includes amino acids
420-496) within the second CK-F3 domain (Table 1, black triangle
and square) was removed and replaced with amino acids
composing the F3 domain (amino acids 500-632) of the second CK-F3
domain. This resulted in a new, F3-F3 repeat that replaces the second
CK-F3 domain while keeping the first CK-F3 domain intact. This mutant
was designated S(420-496)-to-(500-632). When expressed in COS cells,
this mutant exhibited no detectable binding of radiolabeled leptin at
0.2 nM, suggesting that the binding affinity
(Kd) of leptin was reduced
substantially. Because that the time required to wash the plate in the
binding assay is at least 5 sec and the diffusion-controlled
association rate constant is 108
M
l
sec
l, the Kd
value for the S(420-496)-to-(500-632) mutant is estimated to be >20
nM. The S(420-496)-to-(500-632) mutant did not
respond to leptin in the functional assay (Fig. 3B). These data are
consistent with the interpretation that the second CK-F3 domain is
critical for leptin binding. Despite the lack of functional activity,
this mutant was synthesized as detected by Western blotting (Fig.
4), and it inhibited the activation of
OB-Rb in coexpression experiments (see below).
|
To test the hypothesis that the second CK-F3 domain is indeed a leptin
binding site, a min-BD mutant was constructed after removal of residues
41-322 and 641-1165 from OB-Rb and fusion of the remaining sequence
(containing the membrane translocation signal sequence, C2 domain, and
second CK-F3 domain) to the glycan-phosphatidylinositol linkage signal
sequence so min-BD is anchored at the membranes (Table 1). This min-BD
mutant bound leptin with high affinity (Fig. 1). These data demonstrate
that a minimal sequence with
300 residues and containing the second
CK-F3 domain can function as a leptin binding site.
Previous studies indicated that both the short (OB-Ra) and long (OB-Rb)
forms of the cloned leptin receptor bind leptin with identical
affinity. To test whether the intracellular region and the associated
JAKs play a role in determining leptin binding affinity, another
deletion mutant, D(867-1165), was created by deleting all residues in
the intracellular domain (residues 867-1165). As shown in Table 1, the
D(867-1165) mutant bound leptin with the same affinity as wild-type
OB-Rb, indicating that the leptin binding affinity is independent of
the structure of the intracellular domain. Interestingly, the
expression level of D(867-1165) was
10-fold higher than that of
receptors with a large intracellular domain. As expected, the
D(867-1165) was inactive in stimulating the synthesis of luciferase
(Table 1). When the ECD of OB-Rb (residues 1-840) was fused to the
glycan-phosphatidylinositol linkage signal sequence, the lipid-anchored
ECD mutant still bound leptin with high affinity (Table 1).
To investigate further the subunit structure of a functional leptin receptor, coexpression of the wild-type OB-Rb and another receptor mutant was performed. Coexpression of OB-Rb with the inactive S(420-496)-to-(500-632) mutant led to a significant suppression of luciferase synthesis (Fig. 5B). The suppression by the S(420-496)-to-(500-632) mutant, which had no detectable leptin binding, was not due to an inhibition of OB-Rb synthesis because the coexpression did not affect the leptin binding affinity of OB-Rb and total receptor binding sites (Fig. 5A). Removal of the intracellular domain from the S(420-496)-to-(500-632) mutant generated the S-D(867-1165) mutant. Similar to the S(420-496)-to-(500-632) mutant, the S-D(867-1165) mutant also suppressed the activity of OB-Rb (Fig. 5B), indicating that such a suppression is not due to sequestration (or unproductive binding) of endogenous JAKs and STATs to receptor mutants with defective leptin binding site. The suppression also was specific to the OB-R mutant because coexpression of OB-Rb with the neurokinin-2 receptor (a G protein-coupled receptor) did not lead to any functional suppression. As expected, coexpression of the active D(41-322) mutant with the wild-type receptor did not lead to a suppression of the activation response compared with cotransfection of the wild-type with vector plasmid (Fig. 5B). These data indicate that an inactive receptor mutant, with a defect in the leptin binding site, can exert a dominant negative effect on OB-Rb.
|
To support the notion that the inactive leptin receptor variants exert a dominant negative effect, an increasing amount of mutant plasmid was added to a fixed amount of OB-Rb plasmid in cotransfection studies in CHO cells. CHO cells were used in the plasmid titration experiment because transfection of OB-Rb into CHO cells generated a much more robust luciferase response than that observed in COS cell transfection, thereby compensating the reduced protein expression level due to increased amounts of total DNA. As shown in Fig. 6, increasing the amount of inactive receptor DNA led to further reduction in the maximal response mediated by OB-Rb, which is consistent with a gene dosage effect of dominant negative suppression.
|
| |
Discussion |
|---|
|
|
|---|
All class I cytokine receptors are characterized by several highly
conserved domains in the extracellular region, including CK, C2, and
F3. Many cytokine receptors contain either one combined CK-F3 domain or
one combined CK-F3 domain plus additional F3 domains in the
extracellular region (Callard and Gearing, 1994
). For these receptors,
the CK-F3 domain seems to form the ligand binding site. High resolution
structural analysis of the GH-R and EPO-R (Livnah, et al.,
1996
; Wells and de Vos, 1996
) and mutational analyses of GCSF-R
(Fukunaga et al., 1991
) confirmed the localization of the
ligand binding site to the CK-F3 domain. However, a small number of
cytokine receptor subunits contain two repeating CK-F3 domains, such as
the leukemia inhibitory factor receptor
chain, interleukin-5
receptor
chain, and OB-Rb (Figs. 1 and 2). Although it has been
shown that one residue in the second CK-F3 domain of interleukin-5
receptor
chain is important for ligand binding (Woodcock et
al., 1996
), it is not clear whether the first CK-F3 domain is
required for ligand binding or whether both of the repeated CK-F3
domains contribute to ligand binding.
The results of the current study provided evidence for a model in which the leptin binding site is localized to the second CK-F3 domain in the OB-Rb. The D(41-322) mutant of the human OB-Rb is functionally similar to the wild-type OB-Rb, despite the deletion of approximately one third of the extracellular region. The mutant and the wild-type receptors exhibit the same functional activation dose-response curves. The lack of apparent cooperativity (Hill coefficient = 1 in Figs. 3B and 5B) in the dose-response curve for the wild-type OB-Rb is consistent with a model in which only one molecule of leptin binds to each leptin receptor. The similar activity observed with OB-Rb and the D(41-322) mutant suggests that leptin does not bind to the first CK-F3 domain. This conclusion also is consistent with data obtained from the S(420-496)-to-(500-632) mutant. The S(420-496)-to-(500-632) mutant encodes the first CK-F3 domain in the same spatial position as the wild-type OB-Rb, whereas the CK domain of the second CK-F3 domain has been removed and replaced with its F3 domain. However, the S(420-496)-to-(500-632) mutant does not respond to leptin at concentrations up to 1000 nM. It is possible that the domain substitution may impair binding indirectly through conformational effect. Nevertheless, a minimal leptin binding domain can be created, which exhibits high affinity binding and contains only the second CK-F3 domain. The binding activity of the D(41-322) and min-BD mutants and the defective activity of the S(420-496)-to-(500-632) mutant clearly indicate that the first CK-F3 domain is not required for binding and activation, and the leptin binding site can be localized to residues 323-640, which contains the second CK-F3 domain (residues 428-635).
Although the functional significance of the first combined CK-F3 domain
remains to be elucidated, examination of a predicted domain structure
of OB-Rb provided a possible explanation for why leptin does not bind
to the first CK-F3 domain. In GH-R and EPO-R, the connecting sequence
between the CK and F3 domains of the ligand binding site is very short
(Linvah et al., 1996
; Wells and de Vos, 1996
). On the other
hand, there is a long segment (residues 179-234) between the CK domain
and the F3 domain within the first CK-F3 domain in OB-Rb (Fig. 2). The
long connecting loop may confer a very high degree of flexibility,
preventing the formation of a stable leptin binding site.
Another important question regarding leptin receptor structure is the
subunit composition and activation mechanism. For example, GH-R,
GCSF-R, and EPO-R are activated through ligand-induced
homodimerization, whereas IL6-R and LIF-R are activated through
ligand-induced heteromultimerization. It has been reported recently
that carboxyl-terminal deletion mutants of OB-Rb exert a dominant
negative effect on the wild-type OB-Rb (White et al., 1997
).
Although these data are consistent with homo-oligomerization of OB-Rb,
they do not distinguish whether the leptin receptor is activated
through ligand-induced multimerization (Wells and de Vos, 1996
) or
ligand-induced conformational change (Kim, 1994
) because the
carboxyl-terminal deletion mutants bind leptin normally. In the current
study, we found that coexpression of OB-Rb with the inactive
S(420-496)-to-(500-632) mutant suppressed the functional response
mediated by OB-Rb. Because the S(420-496)-to-(500-632) mutant does
not have high affinity binding for leptin, these data do not seem to
support an activation mechanism through ligand-induced multimerization,
which would have predicted normal OB-Rb multimerization even in the
presence of the S(420496)-to-(500-632) mutant. Thus, it seems possible
that the leptin receptor exists as a preformed complex and the receptor
is activated through ligand-induced conformational change (Kim, 1994
).
This conclusion is consistent with the observation that the
extracellular domain of OB-Rb, when expressed alone as a soluble
protein, can exist in a dimeric form (Devos et al., 1997
).
The incomplete suppression of OB-Rb activity by the
S(420496)-to-(500-632) mutant even at a molar excess of mutant plasmid is consistent with the interpretation that these mutant receptors have
a lower association affinity toward OB-Rb (or another unknown subunit
in the receptor complex). It thus seems that both the ligand binding
domain and the intracellular domain may contribute to subunit assembly.
At least for gp130, a common signaling subunit for several cytokine
receptors, the ligand binding domain is required for intersubunit
association (Horsten et al., 1995
).
In summary, the results of the current study indicate that although OB-Rb contains two repeating CK-F3 domains, leptin apparently binds to the second CK-F3 domain (with potential contribution from the C2 domain). In addition, the dominant negative effect of an inactive mutant on the activation of OB-Rb indicates that the ratio of OB-Rb to OB-Ra can determine the signal output from cells expressing both OB-Rb and OB-Ra. These results provide a foundation on which further studies can be designed to elucidate the structural organization of the leptin receptor.
| |
Acknowledgments |
|---|
We thank Dr. R. Smith for support of this study; Drs. M. Phillips and F. Chen for providing the human OB-Rb cDNA; and Drs. G. Ciliberto, A. Lahm, and X.-M. Guan for helpful comments on the manuscript.
| |
Footnotes |
|---|
Received May 2, 1997; Accepted October 24, 1997
1 Current affiliation: Neurogen, Branford, CT 06405.
Send reprint requests to: Dr. T. M. Fong, Merck Research Laboratories, R80 M-213, P.O. Box 2000, Rahway, NJ 07065. E-mail: tung_fong{at}merck.com
| |
Abbreviations |
|---|
OB-Rb, long form of leptin receptor; C2, immunoglobulin C2; CK, cytokine receptor; ECD, extracellular domain; F3, fibronectin type 3; GH-R, growth hormone receptor; JAK, Janus kinase; OB-R, leptin receptor; OB-Ra, the most common short form of leptin receptor; min-BD, minimal binding domain; STAT, signal transducer and activator of transcription; EPO-R, erythropoietin receptor; GCSF-R, granulocyte colony-stimulating factor receptor; ELISA, enzyme-linked immunosorbent assay; CHO, Chinese hamster ovary.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
W. Kimber, F. Peelman, X. Prieur, T. Wangensteen, S. O'Rahilly, J. Tavernier, and I. S. Farooqi Functional Characterization of Naturally Occurring Pathogenic Mutations in the Human Leptin Receptor Endocrinology, December 1, 2008; 149(12): 6043 - 6052. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Peelman, H. Iserentant, A.-S. De Smet, J. Vandekerckhove, L. Zabeau, and J. Tavernier Mapping of Binding Site III in the Leptin Receptor and Modeling of a Hexameric Leptin{middle dot}Leptin Receptor Complex J. Biol. Chem., June 2, 2006; 281(22): 15496 - 15504. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Khan and J. K. Kolls Malnutrition in the Critically III: Don't Hold the Leptin Am. J. Respir. Crit. Care Med., January 15, 2006; 173(2): 140 - 141. [Full Text] [PDF] |
||||
![]() |
L. Zabeau, D. Defeau, H. Iserentant, J. Vandekerckhove, F. Peelman, and J. Tavernier Leptin Receptor Activation Depends on Critical Cysteine Residues in Its Fibronectin Type III Subdomains J. Biol. Chem., June 17, 2005; 280(24): 22632 - 22640. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Iserentant, F. Peelman, D. Defeau, J. Vandekerckhove, L. Zabeau, and J. Tavernier Mapping of the interface between leptin and the leptin receptor CRH2 domain J. Cell Sci., June 1, 2005; 118(11): 2519 - 2527. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Peelman, K. Van Beneden, L. Zabeau, H. Iserentant, P. Ulrichts, D. Defeau, A. Verhee, D. Catteeuw, D. Elewaut, and J. Tavernier Mapping of the Leptin Binding Sites and Design of a Leptin Antagonist J. Biol. Chem., September 24, 2004; 279(39): 41038 - 41046. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Yang, H. Ge, A. Boucher, X. Yu, and C. Li Modulation of Direct Leptin Signaling by Soluble Leptin Receptor Mol. Endocrinol., June 1, 2004; 18(6): 1354 - 1362. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ishida-Takahashi, S. Uotani, T. Abe, M. Degawa-Yamauchi, T. Fukushima, N. Fujita, H. Sakamaki, H. Yamasaki, Y. Yamaguchi, and K. Eguchi Rapid Inhibition of Leptin Signaling by Glucocorticoids in Vitro and in Vivo J. Biol. Chem., May 7, 2004; 279(19): 19658 - 19664. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zabeau, D. Defeau, J. Van der Heyden, H. Iserentant, J. Vandekerckhove, and J. Tavernier Functional Analysis of Leptin Receptor Activation Using a Janus Kinase/Signal Transducer and Activator of Transcription Complementation Assay Mol. Endocrinol., January 1, 2004; 18(1): 150 - 161. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Couturier and R. Jockers Activation of the Leptin Receptor by a Ligand-induced Conformational Change of Constitutive Receptor Dimers J. Biol. Chem., July 11, 2003; 278(29): 26604 - 26611. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Kim, P. N. Taylor, D. Young, S. Y. Karst, P. M. Nishina, and J. K. Naggert New Leptin Receptor Mutations in Mice: Leprdb-rtnd, Leprdb-dmpg and Leprdb-rlpy J. Nutr., May 1, 2003; 133(5): 1265 - 1271. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sandowski, N. Raver, E. E. Gussakovsky, S. Shochat, O. Dym, O. Livnah, M. Rubinstein, R. Krishna, and A. Gertler Subcloning, Expression, Purification, and Characterization of Recombinant Human Leptin-binding Domain J. Biol. Chem., November 22, 2002; 277(48): 46304 - 46309. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Fantuzzi and R. Faggioni Leptin in the regulation of immunity, inflammation, and hematopoiesis J. Leukoc. Biol., October 1, 2000; 68(4): 437 - 446. [Abstract] [Full Text] |
||||
![]() |
V. A. Barr, K. Lane, and S. I. Taylor Subcellular Localization and Internalization of the Four Human Leptin Receptor Isoforms J. Biol. Chem., July 23, 1999; 274(30): 21416 - 21424. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Brockmann, J. Kratzsch, C. S. Haley, U. Renne, M. Schwerin, and S. Karle Single QTL Effects, Epistasis, and Pleiotropy Account for Two-thirds of the Phenotypic F2 Variance of Growth and Obesity in DU6i x DBA/2 Mice Genome Res., December 1, 2000; 10(12): 1941 - 1957. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||