|
|
|
|
Vol. 53, Issue 4, 630-637, April 1998
and/or
Enhances
Transcription of the Human Endothelial Nitric Oxide Synthase Gene
Department of Pharmacology, Johannes Gutenberg University, 55101 Mainz, Germany (H.L., T.W., I.I.-B., U.F., H.K.),
Department of
Physiological Chemistry,
| |
Summary |
|---|
|
|
|---|
In primary human umbilical vein endothelial cells (HUVECs), incubation
with phorbol-12-myristate-13-acetate (PMA) enhanced basal and
bradykinin-stimulated nitric oxide production. In the HUVEC-derived
cell line EA.hy 926, PMA and phorbol-12,13-dibutyrate stimulated
endothelial nitric oxide synthase (NOS III) mRNA expression in a
concentration- and time-dependent manner. Maximal mRNA expression (3.3-fold increase) was observed after 18 hr. NOS III protein and
activity were increased to a similar extent. The specific protein
kinase C (PKC) inhibitors bisindolylmaleimide I (1 µM), Gö 6976 [12-(2cyanoethyl)-6,7,12,13-tetrahydro-13-methyl-5-oxo-5H-indolo[2,3-a]pyrrolo-[3,4-c]carbazole] (1 µM), Ro-31-8220
[3-[1-[3(amidinothio)propyl-1H-inoyl-3-yl]3-(1-methyl-1H-indoyl-3-yl) maleimide
methane sulfonate] (1 µM), and chelerythrine (3 µM) did not change NOS III expression when applied alone,
but they all prevented the up-regulation of NOS III mRNA produced by
PMA. Of the PKC isoforms expressed in EA.hy 926 cells (
,
I,
,
,
,
,
, and µ), only PKC
and PKC
showed changes in
protein expression after PMA treatment. Incubation of EA.hy 926 cells with PMA for 2-6 hr resulted in a translocation of PKC
and PKC
from the cytosol to the cell membrane, indicating activation of these
isoforms. After 24 hr of PMA incubation, both isoforms were down-regulated. The time course of activation and down-regulation of
these two PKC isoforms correlated well with the PMA-stimulated increase
in NOS III expression. When human endothelial cells (ECV 304 or EA.hy
926) were transiently or stably transfected with a 3.5-kb fragment of
the human NOS III promoter driving a luciferase reporter gene, PMA
stimulated promoter activity up to 2.5-fold. On the other hand, PMA did
not change the stability of the NOS III mRNA. These data indicate that
stimulation of PKC
, PKC
, or both by active phorbol esters
represents an efficacious pathway activating the human NOS III promoter
in human endothelium.
| |
Introduction |
|---|
|
|
|---|
Isoform
III of NOS (NOS III, ecNOS, eNOS) was identified first in endothelial
cells (Förstermann et al., 1991
; Pollock et al., 1991
) but also is expressed in some other cell types, such as
epithelial cells (Shaul et al., 1994
; Tracey et
al., 1994
; Förstermann and Kleinert, 1995
; Sakai et
al., 1996
). Although NOS III is classified as a constitutively
expressed NOS isozyme, its expression can be regulated by a variety of
stimuli, such as cytokines (e.g., tumor necrosis factor-
,
transforming growth factor-
1), bacterial lipopolysaccharide,
oxidized lipoproteins, estrogens, shear stress, growth status, and
hypoxia (Busse and Fleming, 1995
; Förstermann and Kleinert, 1995
;
Harrison et al., 1996
).
NO generated by endothelial NOS III is involved in blood pressure
regulation (Huang et al., 1995
; Rees et al.,
1989
) and exerts protective effects in the cardiovascular system such
as inhibition of platelet aggregation and adhesion, prevention of
leukocyte adhesion to the vascular wall, and reduction on vascular
smooth muscle proliferation (for reviews, see Förstermann
et al., 1994
; Moncada and Higgs, 1995
; Gibbons and Dzau,
1996
). Decreased endothelial NO production has been seen in
pathophysiological conditions such as atherosclerosis, diabetes, and
hypertension (for reviews, see Förstermann et al.,
1994
; Moncada and Higgs, 1995
; Gibbons and Dzau, 1996
). In view of the
protective effects of NO, stimuli and mechanisms that increase NOS III
activity, expression, or both are of significant interest.
PKC represents a family of closely related serine/threonine kinases
(Nishizuka, 1992
; Hug and Sarre, 1993
) that plays a key role in
different cellular signal transduction pathways (Nishizuka, 1988
).
Reports on the regulation of NOS activity by PKC are controversial. PKC
inhibitors have been shown to reduce purinoceptor-stimulated (Brown
et al., 1996
) and angiotensin II-stimulated (Saito et
al., 1996
) NO synthesis in bovine endothelial cells. Phorbol
esters that activate PKC have been shown to induce NO synthesis in
isolated rat aorta (Sakata and Karaki, 1990
). On the other hand, the
application of phorbol esters inhibited endothelium-dependent
vasodilator responses evoked by acetylcholine (Rubanyi et
al., 1989
). In porcine endothelial cells, PKC activation reduced
the bradykinin-stimulated release of NO, and calphostin C, a PKC
inhibitor, augmented the NO release (Hecker et al., 1993
). A
study performed with bovine aortic endothelial cells suggested that
down-regulation or inhibition of PKC could increase endothelial NOS III
expression (Ohara et al., 1995
). This prompted us to
investigate the importance of the different PKC isoforms in NOS III
expression in human endothelial cells. Our study provides evidence that
activation rather than inhibition of PKC up-regulates the activity of
the human NOS III promoter.
| |
Materials and Methods |
|---|
|
|
|---|
Reagents.
BIM, Chel, Gö
[12-(2-cyanoethyl)-6,7,12,13-tetrahydro-13-methyl-5-oxo-5H-indolo-[2,3-a]pyrrolo-[3,4-c]carbazole], PMA,
PDBu, 4
PDD, and staurosporine were purchased from Calbiochem (San
Diego, CA). Ro
[3-[1-[3-(amidinothio)propyl-1H-inoyl-3-yl]-3-(1-methyl-1H-indoyl-3-yl)maleimide methane sulfonate] was a generous gift of Dr. D. Bradshaw (Roche Research Center, London, UK). Isotopes were obtained from Amersham (Braunschweig, Germany). Restrictions enzymes, polynucleotide kinase,
Taq polymerase, dNTPs, Ficoll (type 400), oligonucleotides, and oligo(dT) primer were purchased from Pharmacia (Vienna, Austria). Luciferase and
-galactosidase assay systems were obtained from Promega (Madison, WI) and Tropix (Bedford, MA), respectively. Superscript reverse transcriptase was obtained from GIBCO BRL (Gaithersburg, MD). DNase I, DOTAP, RNase A, RNase T1, T3, and T7 RNA
polymerase were purchased from Boehringer-Mannheim Biochemica (Mannheim, Germany). An antibody specific for PKC
was purchased from
Upstate Biotechnology (Lake Placid, NY). Antibodies specific for
PKC
I and PKC
were generous gifts of Peter
Parker (ICRF, London, UK). Antibodies specific for
PKC
II, PKC
, PKC
, PKC
, PKC
, and
PKCµ were purchased from Santa Cruz Biochemicals (Santa Cruz, CA).
The antibody to PKC
was from Transduction Laboratories (Lexington,
KY). 3-Isobutyl-1-methylxanthine and bradykinin were purchased from
Sigma Chemie (Deisenhofen, Germany).
Cell culture.
HUVECs were isolated as described previously
(Wohlfart et al., 1997
) and grown in Iscove's minimal
essential medium containing glutamine (2 mM), penicillin
(100 IU/ml), streptomycin (100 µg/ml), and Biotect protection medium.
Human endothelial cells EA.hy 926 (Edgell et al., 1983
) and
ECV304 (Takahashi et al., 1990
) cells (American Type Culture
Collection, Rockville, MD) were grown in Dulbecco's modified Eagle's
medium (Sigma) with 10% fetal calf serum, 2 mM
L-glutamine, 1 mM sodium pyruvate, 100 IU/ml
penicillin, 100 µg/ml streptomycin, and 1× HAT (hypoxanthine,
amethopterin/methotrexate, thymine) (Edgell et al., 1983
).
For NOS III mRNA analyses, confluent EA.hy 926 cells were incubated for
18 hr with PMA (0.1-1000 nM), PDBu (100 nM),
4
PDD (100 nM), BIM (1 µM), Gö (1 µM), Ro (1 µM), Chel (3 µM),
or staurosporine (1-100 nM), alone or in combination. To
determine the time course of NOS III mRNA increases in response to PMA,
confluent EA.hy 926 cells were incubated with 100 nM PMA for 2, 6, 10, 18, or 24 hr. For determination of the stability of the
NOS III mRNA in the presence of PMA, cells were incubated with or
without PMA for 18 hr; then 10 µg/ml actinomycin D was added to the
medium, and the cells were incubated for additional 6, 12, 24, or 48 hr.
Determination of cellular NOS activity through measurement of
intracellular cGMP accumulation.
Measurements of cGMP levels in
HUVECs were made as described previously (Wohlfart et
al., 1997
). Briefly, HUVECs were incubated for 20 hr with or
without 10 nM PMA. Then, the cells were washed twice with
HEPES/Tyrode's solution (prewarmed at 37°) and preincubated for 15 min with 3-isobutyl-1-methylxanthine (0.1 mM) and
superoxide dismutase (20 units/ml). Then, cells were stimulated with
bradykinin (10 nM; Sigma) for 3 min. The reaction were
stopped by rapid removal of the incubation medium and extraction of the
cells with an ice-cold mixture of 1 N formic acid/acetone
(15:85, v/v). After removal of the solvent, cGMP was determined using a
specific radioimmunoassay (DuPont-New England Nuclear, Boston, MA).
Cloning of a human NOS III cDNA fragment.
Two micrograms of
total RNA from EA.hy 926 cells were annealed with 0.5 µg of an
oligo(dT) primer (Pharmacia) and reverse-transcribed with Superscript
RT (GIBCO BRL) according to the manufacturer's instructions.
RT-generated cDNAs encoding for human NOS III were amplified using PCR.
Oligonucleotide primers for NOS III were GACATTGAGAGCAAAGGGCTGC (sense)
and CGGCTTGTCACCTCCTGG (antisense) corresponding to positions
3111-3133 and 3518-3536 of the human NOS III cDNA (Marsden et
al., 1992
). PCR was performed in a 100-µl volume containing 1×
Taq polymerase buffer (Pharmacia), 0.2 mM concentration of dNTPs, 1.5 mM MgCl2,
2 units of Taq-polymerase, 50 pmol of oligonucleotide
primers, and RT products (10% of the RT reaction). After an initial
denaturation step at 95° for 5 min, 30 cycles were performed (1 min
at 95°, 1 min at 60°, and 1 min at 72°), followed by a final
10-min extension step at 72°. The PCR products (30 µl) were
analyzed on a 1.5% agarose gel containing 0.1 mg/ml ethidium bromide.
The amplified cDNA fragments (426 bp) were cloned into the
EcoRV site of pCR-Script (Stratagene) using the Sure Clone
Ligation Kit (Pharmacia), generating the cDNA clone pCR-NOS III-Hu. DNA
sequences of the cloned PCR product were determined from plasmid
templates using the dideoxy chain termination method
(T7Sequencing Kit; Pharmacia).
Preparation of antisense RNA probes.
To generate
radiolabeled antisense RNA probes for RNase protection assays, pCR-NOS
III-Hu and pCR-
-actin-Hu (Kleinert et al., 1996
) were
linearized with SmaI or BstEII, extracted with phenol-chloroform, and concentrated by ethanol precipitation. Then, 0.5 µg of each DNA was in vitro transcribed using T7/T3 RNA
polymerase (Pharmacia) and [
-32P]UTP. After
a 1-hr incubation, the template DNA was degraded with DNase I for 45 min. The radiolabeled RNA was purified using NucTrap probe purification
columns (Stratagene).
RNA extraction and RNase protection analyses.
Total RNA was
isolated from EA.hy 926 cells by guanidinium
thiocyanate-phenol-chloroform extraction (Chomczynski and Sacchi, 1987
). RNase protection assays were performed with a mixture of RNase A
and RNase T1 according to the manufacturer's instructions (Boehringer-Mannheim). Briefly, after denaturation, 20 µg of total RNA (prepared as described above) was hybridized with 200,000 cpm
labeled NOS III antisense RNA probe and 40,000 cpm labeled
-actin
antisense RNA probe at 51° for 16 hr in a volume of 40 µl of
hybridization buffer [40 mM PIPES, pH 6.7, 1 mM EDTA, 400 mM NaCl, 50% formamide]. The
mixture was digested by the addition of 300 µl of digestion buffer
(10 mM Tris·HCl, pH 7.4, 300 mM NaCl, 5 mM EDTA) containing 3.5 µg of RNase A and 37.5 units of RNase T1 for 30 min at 30°. The reaction was stopped by proteinase K
digestion (70 µg/sample in 70 µl of 7.15 mM Tris·HCl,
pH 7.4, 7.15 mM EDTA, and 2.85% SDS for 15 min at 37°)
and phenol extraction. The reaction products were concentrated by
ethanol precipitation and analyzed by electrophoresis on denaturing
urea-polyacrylamide gels (8 M urea/6% polyacrylamide). The
electrophoresis buffer was 1× TBE (1.08% Tris, pH 8.3, 0.55% boric
acid, and 20 mM EDTA). The gels were electrophoresed for
1-2 hr, dried, and exposed to X-ray films. Densitometric analyses were
performed using a PhosphorImager (Bio Rad, Hercules, CA). The protected
RNA fragments of NOS III and
-actin were 280 and 108 nucleotides,
respectively. The density of each NOS III band was normalized with the
corresponding
-actin band.
Determination of NOS activity by the conversion of
L-arginine to L-citrulline.
Approximately
106 EA.hy 926 cells (untreated or incubated for
18 hr with 100 nM PMA, 100 nM PDBu, or 100 nM 4
PDD) were washed with 5 ml of PBS and scraped into 1 ml of PBS. After centrifugation (100 × g, 5 min,
4°), the cell pellet was resuspended in 50 µl of lysis buffer (50 mM Tris·HCl, pH 7.4, 1% Nonidet P-40, 1 mM dithiothreitol, 10 µg/ml leupeptin, 10 µg/ml pepstatin A, 2 µg/ml aprotinin, 10 µg/ml soybean trypsin inhibitor, and 100 µM phenylmethylsulfonyl fluoride). Cells were lysed by
three cycles of freeze-thawing using liquid nitrogen. The homogenates
were centrifuged (1500 × g, 15 min, 4°). The protein
content of the supernatant was determined using the Bradford assay
(BioRad, Hercules, CA). For the conversion assay, 5 µg of the
cellular protein was incubated in 100 µl of assay volume containing 1 mM NADPH, 3 µM tetrahydrobiopterin, 5 µM FAD, 5 µM FMN, and 1000 Bq of
[14C]L-arginine. The reaction was
stopped after 15 min by the addition of two volumes of ice-cold
methanol. The dried reaction products were redissolved in 20 µl of
water and spotted onto Polgram SIL N-HR thin layer chromatography
plates (Macherey-Nagel, Düren, Germany).
[14C]L-Arginine was separated from
[14C]L-citrulline using
chloroform/methanol/ammonium hydroxide/water (0.5:4.5:2.0:1.0, v/v/v/v)
as the solvent system. Thin layer chromatography plates were dried and
autoradiographed.
Protein preparation and Western blotting.
For the
determination of NOS III and PKC protein expression, total protein was
isolated from EA.hy 926 cells as described previously (Wallerath
et al., 1997
). In brief, EA.hy 926 cells (untreated or
incubated for 20 hr with 100 nM PMA or 100 nM
PDBu) were homogenized in ice-cold homogenization buffer (50 mM Tris·HCl, pH 7.5, 0.5 mM EDTA, 0.5 mM EGTA, 2 mM dithiothreithol, 7 mM
glutathione, 10% glycerol, 10 µg/ml pepstatin, 10 µg/ml leupeptin,
20 units/ml aprotinin, and 0.2 mM phenylmethylsulfonyl
fluoride) containing 20 mM concentration of the detergent
CHAPS. Homogenates were incubated for 30 min at 4° followed by a
centrifugation at 100,000 × g for 1 hr. Supernatants
were used for protein determination (Bradford assay). Western blotting
was performed as described previously (Kleinert et al.,
1996
). Briefly, 50 µg of each protein sample were separated by
SDS-7.5% polyacrylamide gels. The proteins were transferred to
nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany) by
electroblotting (BioRad). All subsequent steps were performed at room
temperature. Blots were blocked for 30 min with 3% (w/v) bovine serum
albumin and 0.05% (v/v) Tween 20 in TBS (10 mM Tris·HCl,
pH 7.4, 150 mM NaCl) and then incubated for NOS III protein
detection with a polyclonal rabbit anti-NOS III antibody (Transduction
Laboratories) in TBS containing 0.5% (w/v) gelatin and 0.05% (w/v)
Tween 20 for 45 min. After washing in TBS/gelatin/Tween, the blots were
incubated with horseradish peroxidase-conjugated second antibodies
diluted 1:1500 in TBS/gelatin/Tween for 30 min. The blots were washed
stepwise with TBS/gelatin/Tween, TBS/Tween, and TBS alone.
Immunocomplexes were developed using an enhanced horseradish
peroxidase/luminol chemiluminescence reagent (DuPont-New England
Nuclear) according to the manufacturer's instruction.
Analysis of PKC expression and translocation.
PKC proteins
were detected in Western blots with antibodies specific for the
different PKC isoforms (
,
I,
II,
,
,
,
,
,
,
and µ). Here, the antibody incubation buffer was PBS containing 0.1%
(v/v) Triton X100 and 1% (w/v) low-fat dry milk powder. Blots were
incubated with primary antibody overnight and then washed with
PBS/Triton/milk powder and incubated with secondary antibody for 1 hr.
Cloning of the 5'-flanking region from the human NOS III
gene.
Genomic DNA was isolated from human EA.hy 926 cells by
RNase/proteinase K digestion and phenol-chloroform extraction as
described previously (Sambrook et al., 1989
). This DNA was
used for amplification of the 5'-flanking DNA of the human NOS III
gene. PCR was performed as described using as primers the
oligonucleotides TGATGCTGCCTGTCACCTTG (5') and TACTGTGCGTCCACTCTGCTGC
(3'). The sequences were based on published 5'-flanking sequences of
the human NOS III gene (Marsden et al., 1993
). The amplified
DNA fragment (1616 bp, positions
1596 to + 20) was cloned into the
SmaI site of pUC 18, generating pUC-NOS
III-Hu-5'. The DNA sequence of the cloned PCR products were
determined using the T7Sequencing Kit
(Pharmacia). This human NOS III promoter fragment was used to screen a
cosmid library containing human chromosomal DNA cloned in pWE15
(Stratagene). Eight individual cosmid clones were isolated and
characterized. An ApaI fragment containing the human NOS III
promoter sequence (positions
3470 to +115) was cloned and sequenced
(GenBank accession no. AF032908). To clone the human NOS III promoter
in front of a luciferase reporter gene, this fragment was used as
template in a PCR with the oligonucleotides gtgagaagcttGAGAGAAAGAGCTGTCCCCGGGGCCTTGGGG (5') (P-ES1a) and
gtgagtcatgaGTTACTGTGCGTCCACTCGCTGCTGCCTGC (3') (P-ES1b) as primers
(extra nucleotides to generate HindIII and
BspHIII restriction sites are displayed in lowercase
letters). The resulting PCR fragment was restricted with
HindIII and BspHIII and cloned into
pGL3-Basic (Promega; containing a promoterless luciferase reporter gene) restricted with HindIII and
NcoI to generate pNOS III-Hu-3500-Luc.
Transient transfection and reporter gene assay.
Because the
transfection efficiency of EA.hy 926 cells was very low, the human
endothelial cell line ECV304 was used transient transfection
experiments. Cells were plated onto 30-mm cell culture dishes 24 hr
before transfection. The cells (at
80% confluence) were transfected
by lipofection with DOTAP according to the manufacturer's recommendations (Boehringer-Mannheim); 2.5 µg
pGL3-Basic (Promega) or pNOS III-Hu-3500-Luc was
used; 2.5 µg of pCH110 (Pharmacia; containing the
-galactosidase
gene driven by an SV40 promoter) was cotransfected for normalization.
The cells were washed with culture medium 6 hr after transfection and
incubated with 100 nM PMA for 18 hr. Extracts (200 µl)
were prepared using the reporter lysis buffer (Promega). The luciferase
and
-galactosidase activities of the extracts were determined using
the Luciferase Assay System (Promega) and the Galacto-Light System
(Tropix) as described previously (Kleinert et al., 1996
).
The LU of the luciferase assay were normalized by the LU of the
-galactosidase assay after subtraction of extract background.
Stable transfection of EA.hy 926 cells and reporter gene
assay.
EA.hy 926 cells were plated onto 30-mm cell culture dishes
24 hr before transfection. The cells (at
80% confluence) were transfected with DOTAP according to the manufacturer's recommendations (Boehringer-Mannheim); 10 µg pGL3-Basic pNOS
III-Hu-3500-Luc-neo or 10 µg salmon sperm DNA was used. The cells
were washed with culture medium 6 hr after transfection and incubated
with medium for 18 hr. Then, the cells were split to dilute them and
incubated with medium containing 1 mg/ml G418. Single clones were
selected from the pNOS III-Hu-3500-Luc-neo-transfected cells and
propagated in medium containing 1 mg/ml G418. For analysis of phorbol
ester enhancement of NOS III promoter activity, the stably transfected cells were incubated with PMA (10 nM) for 18 hr. Extracts
(200 µl) were prepared using the reporter lysis buffer (Promega), and luciferase activities were determined as described.
Statistical analysis. Statistical differences between mean values were determined by analysis of variance followed by Fisher's protected least significant difference test for comparison of mean values.
| |
Results |
|---|
|
|
|---|
The phorbol ester PMA enhances cGMP production in HUVECs incubated
with bradykinin.
Preincubation with PMA (10 nM) for 20 hr enhanced both basal and bradykinin (10 nM)-stimulated NO
production of HUVECs by
2-fold (Fig.
1). To investigate the molecular
mechanism of this stimulation, subsequent experiments were performed in
the HUVEC-derived stable cell line EA.hy 926 (Edgell et al.,
1983
).
|
Phorbol esters enhance NOS III mRNA expression in human endothelial
EA.hy 926 cells.
Human endothelial EA.hy 926 cells were incubated
for 18 hr with PMA (0.1-1000 nM), and total RNA was
prepared. As shown in Fig. 2, PMA
enhanced NOS III mRNA expression in a concentration-dependent manner. A
concentration as low as 0.1 nM PMA produced a doubling of
NOS III mRNA. NOS III mRNA concentrations reached plateau between 1 and
100 nM PMA and decreased at higher concentrations of PMA. Fig. 3 demonstrates the time dependence
of the PMA effect. A significant up-regulation of the NOS III mRNA was
observed after a 6-hr incubation with 100 nM PMA
(271.6 ± 38.6% of control, mean ± standard error). Maximum
stimulation was reached at 18 hr (326.1 ± 24.2% of control). Another active phorbol ester, PDBu (100 nM, 18 hr),
simulated NOS III mRNA expression, whereas 4
PDD (100 nM,
18 hr), which does not activate PKC, had no effect on NOS III mRNA
expression (Fig. 4).
|
|
|
Phorbol esters enhance NOS III protein and activity in human
endothelial EA.hy 926 cells.
As shown in Fig.
5, both PMA and PDBu (100 nM,
20 hr each) increased NOS III protein content in the EA.hy 926 cells
(as determined with Western blotting using 50 µg of total protein
from each sample). Densitometric analyses of the NOS III protein bands
indicated an increase to 225.5 ± 8.2% after 100 nM
PMA and an increase to 258.2 ± 22.8 after PDBu (mean ± standard error, four experiments). 4
PDD had no effect (three
experiments).
|
PDD for 20 hr, and NOS III activity was determined by the
[14C]L-arginine to
[14C]L-citrulline conversion assay.
As demonstrated in Fig. 6, both PMA and
PDBu, but not 4
PDD, increased NOS III activity in the EA.hy 926 cells.
|
PKC inhibitors had no effect on NOS III mRNA level but reduced the PMA-induced up-regulation. As shown in Fig. 7a, an 18-hr incubation with the specific PKC inhibitors BIM, Gö, Ro (1 µM each), and Chel (3 µM) did not significantly affect the NOS III mRNA expression. However, the PMA (100 nM)-induced up-regulation of NOS III mRNA was significantly reduced by all four PKC inhibitors (Fig. 7b).
|
EA.hy 926 cells express different isoforms of PKC.
Western
blotting using isoform-specific anti-PKC antibodies demonstrated the
expression of PKC
, PKC
I, PKC
, PKC
, PKC
, PKC
, PKC
,
and PKCµ in EA.hy 926 cells (Fig. 8).
PKC isoforms
II and
were not expressed (two experiments, data
not shown). Strictly neuronal expression had been described for PKC
(Hug and Sarre, 1993
); therefore, expression of this isoform was not analyzed in endothelial cells. Incubation of endothelial cells with PMA
(100 nM) for 30 hr significantly down-regulated PKC
and
PKC
but left protein levels of the other isoforms unchanged (Fig.
8).
|
Time course of the PMA-induced translocation and down-regulation of
PKC
and PKC
in EA.hy 926 cells.
PKC
and PKC
were found
to be down-regulated by long term treatment with PMA (Fig. 8);
therefore, we determined the time course of their translocation and
down-regulation. Fig. 9 shows a
representative Western blot analysis for PKC
. Before PMA treatment, more than half of the PKC
protein was located in the soluble fraction. Incubation with PMA (100 nM, 2 and 6 hr) induced
a translocation of PKC protein from the soluble to the particulate
fraction. After 24 hr, PKC
was markedly down-regulated. Only small
amounts of protein were found in the particulate fraction (Fig. 9).
PKC
showed a closely similar pattern of regulation (three
experiments, data not shown). The time course of PKC translocation
(activation) and down-regulation paralleled the time course of the
PMA-induced NOS III mRNA increase shown in Fig. 3.
|
PMA enhances the activity of a NOS III gene promoter fragment
transiently transfected into human endothelial ECV304 cells and stably
transfected into EA.hy 926 cells.
Because EA.hy 926 cells
exhibited a very low transfection efficiency on transient transfection,
ECV304 cells were used in these experiments. They were transfected with
pGL3-Basic (containing a promoterless luciferase
reporter gene) or pNOS III-Hu-3500-Luc (containing a 3470-bp fragment
of the 5'-flanking sequence of the human NOS III gene cloned before the
luciferase reporter gene). Transfected cells were incubated with or
without PMA (100 nM) for 18 hr, and cytoplasmic cell
extracts were prepared. Fig. 10, top, shows the relative luciferase activity (corrected for
-galactosidase activity; see Materials and Methods). The 3470-bp NOS
III promoter fragment showed significant basal activity compared with
pGl3-Basic. PMA (100 nM) increased
the activity of the human NOS III promoter fragment by 2.3-fold,
demonstrating that the PMA stimulation of endothelial cells enhances
the activity of the NOS III gene promoter (Fig. 10, top).
|
PMA does not change the stability of the NOS III mRNA.
EA.hy
926 cells were incubated for 18 hr with or without PMA (100 nM). Then, 10 µg/ml actinomycin D was added to inhibit
gene transcription, and RNA was prepared at different times thereafter. As shown in Fig. 11, the half-life of
human NOS III mRNA in untreated EA.hy 926 cells was
44 hr.
Incubation with PMA (100 nM) did not change the stability
of the NOS III mRNA.
|
| |
Discussion |
|---|
|
|
|---|
Because of the vascular protective function of endothelial NOS III
(Förstermann et al., 1994
; Moncada and Higgs, 1995
;
Gibbons and Dzau, 1996
), an up-regulation of this gene is of
significant scientific (and possibly clinical) interest. The current
study demonstrates that activation of PKC isoforms
,
, or both
represents an efficacious mechanism of increasing transcription of this
gene (at least in vitro.). Given the potency of NO in the
vascular system, a
3-fold increase in NOS III mRNA, protein, and
activity could have major functional consequences.
Evidence accumulated in the current study indicates that activation
(not down-regulation or inhibition) of PKC triggers the pathway or
pathways leading to NOS III induction. First, NOS III expressional
stimulation was only seen with the PKC-stimulating phorbol esters PMA
and PDBu (Figs. 2-7). The phorbol ester 4
PDD, which does not
activate PKC, had no effect on NOS III expression (Figs. 4 and 6).
Second, specific PKC inhibitors such as BIM, Gö, Ro, and Chel did
not change NOS III mRNA expression by themselves (Fig. 7). They did,
however, prevent the stimulatory effect of active phorbol esters (Fig.
7). Third, the time course of the PMA-induced NOS III mRNA expression
correlated well with the time course of PKC activation, not with its
down-regulation and inactivation (compare Figs. 3 and 9). When PKC was
down-regulated (after 24 hr), NOS III mRNA levels returned toward basal
levels.
The issue of NOS III expressional regulation by PKC is somewhat
contentious because a previous study performed with bovine aortic
endothelial cells concluded that down-regulation or inhibition of PKC
elevated endothelial NOS III expression in that cell type (Ohara
et al., 1995
). These authors found that staurosporine, a
nonspecific kinase inhibitor, increased NOS III expression (Ohara et al., 1995
). We verified in our human endothelial cell
system that staurosporine produced an increase in NOS III mRNA that was similar in magnitude to that of the active phorbol esters. NOS III mRNA
levels reached a maximum of 333 ± 7% of control (five experiments) after 24 hr of incubation with 10 nM
staurosporine. However, as shown in Fig. 7a, this effect was not
mimicked by any other PKC inhibitor tested. There are some reports that
staurosporine can activate, rather than inhibit, PKC (Stanwell et
al., 1996a
, 1996b
). However, in EA.hy 926 cells, no translocation
or down-regulation of PKC was detected with staurosporine using an
anti-PKC
antibody (two experiments, data not shown). In addition,
the staurosporine effect on NOS III expression was not inhibited by the
specific PKC inhibitors BIM, Ro, or Chel (two experiments, data not
shown). Therefore, staurosporine seems to up-regulate NOS III
expression by an unknown mechanism unrelated to PKC. This mechanism
awaits further clarification.
To date, 12 isozymes of PKC have been identified in mammalian tissues.
They have been subdivided into conventional PKC isoforms (
,
I,
II,
), novel PKC isoforms (
,
,
,
), atypical PKC isoforms (
,
/
), and yet another subgroup (PKCµ) (Nishikawa et al., 1997
). The conventional PKC members can be activated
by calcium, phospholipids, diacylglycerol, and phorbol esters; the novel PKC members are activated by the same compounds but are calcium
independent. In resting endothelial cells, PKC is located predominantly
in the cytosol (Hecker et al., 1993
). After activation, the
PKCs translocate from the cytosol to the particulate fraction (Mochly-Rosen, 1995
). This seems essential for the function of many, if
not all, PKC isoforms. Phosphorylation of endogenous PKC substrates has
been shown to increase on PKC translocation (Graff et al.,
1989
), and an inhibition of PKC translocation diminished PKC-mediated
biological responses (Yedovitzky et al., 1997
).
Phorbol esters like PMA and PDBu have a diacylglycerol-like structure
and activate conventional and novel PKCs, followed by down-regulation
after prolonged exposure (Nishizuka, 1984
). EA.hy 926 endothelial cells
express a number of PKC isoforms (Fig. 8), but only PKC
and PKC
showed translocation and down-regulation after PMA treatment. This
suggests that one of these isoforms (or both) trigger the signaling
process leading to enhanced NOS III expression. This hypothesis is
consistent with the finding that the PKC inhibitor Gö was the
most efficacious blocker of the PMA-induced stimulation of NOS III mRNA
expression. Gö has been described as a preferential inhibitor of
the conventional PKCs (
,
, and
) (Martiny-Baron et
al., 1993
; Gschwendt et al., 1996
).
The signaling mechanism triggered by the activated PKC or PKCs and
leading to the up-regulation of NOS III mRNA is still largely unclear.
Our data indicate, however, that the up-regulation is a result of an
increased gene transcription and does not involve changes in NOS III
mRNA stability (Figs. 10 and 11). In conclusion, we demonstrated that
activation of protein kinase C isoforms
,
, or both represents an
efficacious means of increasing the transcription of the human NOS III
gene.
| |
Acknowledgments |
|---|
We thank Dr. Jochen Klein for helpful discussions and Bärbel Hering for expert assistance with the cell culture.
| |
Footnotes |
|---|
Received October 27, 1997; Accepted December 29, 1997
This work was supported by Grant Fo 144/3-2 and SFB 553 (Project A1) from the Deutsche Forschungsgemeinschaft, Bonn, Germany.
Send reprint requests to: Dr. Ulrich Förstermann, Department of Pharmacology, Johannes Gutenberg University, Obere Zahlbacher Str. 67, 55101 Mainz, Germany. E-mail: ulrich.forstermann{at}uni-mainz.de
| |
Abbreviations |
|---|
NOS, nitric oxide synthase;
EGTA, ethylene glycol bis(
-aminoethyl
ether)-N,N,N',N'-tetraacetic
acid;
HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid;
PIPES, piperazine-N,N'-bis(2-ethanesulfonic
acid);
CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]propanesulfonate;
Chel, chelerythrine;
Gö, Gö 6976;
HUVEC, human umbilical
vein endothelial cell;
NO, nitric oxide;
NOS III, endothelial-type
nitric oxide synthase;
LU, light unit(s);
PBS, phosphate-buffered
saline;
PDBu, phorbol-12,13-dibutyrate;
4
PDD, 4
-phorbol-12,13-didecanoate;
PKC, protein kinase C;
PMA, phorbol-12-myristate-13-acetate;
Ro, Ro-31-8220;
SDS, sodium dodecyl
sulfate, DOTAP,
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium
methylsulfate ;
RT, reverse transcription;
PCR, polymerase chain
reaction;
TBS, Tris-buffered saline.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. S. Rothmeier, I. Ischenko, J. Joore, D. Garczarczyk, R. Furst, C. J. Bruns, A. M. Vollmar, and S. Zahler Investigation of the marine compound spongistatin 1 links the inhibition of PKC{alpha} translocation to nonmitotic effects of tubulin antagonism in angiogenesis FASEB J, April 1, 2009; 23(4): 1127 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Schmitt, E. H. Heiss, Y. Aristei, T. Severin, and V. M. Dirsch Norfuraneol dephosphorylates eNOS at threonine 495 and enhances eNOS activity in human endothelial cells Cardiovasc Res, March 1, 2009; 81(4): 750 - 757. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Wohlfart, H. Xu, A. Endlich, A. Habermeier, E. I. Closs, T. Hubschle, C. Mang, H. Strobel, T. Suzuki, H. Kleinert, et al. Antiatherosclerotic Effects of Small-Molecular-Weight Compounds Enhancing Endothelial Nitric-Oxide Synthase (eNOS) Expression and Preventing eNOS Uncoupling J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 370 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xu, P. Czerwinski, M. Hortmann, H.-Y. Sohn, U. Forstermann, and H. Li Protein kinase C {alpha} promotes angiogenic activity of human endothelial cells via induction of vascular endothelial growth factor Cardiovasc Res, May 1, 2008; 78(2): 349 - 355. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Johann, V. Barra, A.-M. Kuhn, A. Weigert, A. von Knethen, and B. Brune Apoptotic cells induce arginase II in macrophages, thereby attenuating NO production FASEB J, September 1, 2007; 21(11): 2704 - 2712. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Steinkamp-Fenske, L. Bollinger, H. Xu, Y. Yao, S. Horke, U. Forstermann, and H. Li Reciprocal Regulation of Endothelial Nitric-Oxide Synthase and NADPH Oxidase by Betulinic Acid in Human Endothelial Cells J. Pharmacol. Exp. Ther., August 1, 2007; 322(2): 836 - 842. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rotmann, A. Simon, U. Martine, A. Habermeier, and E. I. Closs Activation of classical protein kinase C decreases transport via systems y+ and y+L Am J Physiol Cell Physiol, June 1, 2007; 292(6): C2259 - C2268. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Spurny, K. Abdoulrahman, L. Janda, D. Runzler, G. Kohler, M. J. Castanon, and G. Wiche Oxidation and Nitrosylation of Cysteines Proximal to the Intermediate Filament (IF)-binding Site of Plectin: EFFECTS ON STRUCTURE AND VIMENTIN BINDING AND INVOLVEMENT IN IF COLLAPSE J. Biol. Chem., March 16, 2007; 282(11): 8175 - 8187. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Y. Shin, W. K. K. Wu, K. M. Chu, M. W. L. Koo, H. P. S. Wong, E. K. Y. Lam, E. K. K. Tai, and C. H. Cho Functional Role of {beta}-Adrenergic Receptors in the Mitogenic Action of Nicotine on Gastric Cancer Cells Toxicol. Sci., March 1, 2007; 96(1): 21 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Blanco-Rivero, A. Sagredo, G. Balfagon, and M. Ferrer Protein kinase C activation increases endothelial nitric oxide release in mesenteric arteries from orchidectomized rats J. Endocrinol., January 1, 2007; 192(1): 189 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, K. Witte, M. August, I. Brausch, U. Godtel-Armbrust, A. Habermeier, E. I. Closs, M. Oelze, T. Munzel, and U. Forstermann Reversal of Endothelial Nitric Oxide Synthase Uncoupling and Up-Regulation of Endothelial Nitric Oxide Synthase Expression Lowers Blood Pressure in Hypertensive Rats J. Am. Coll. Cardiol., June 20, 2006; 47(12): 2536 - 2544. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Littler, C. A. Wehling, M. J. Wick, K. A. Fagan, C. D. Cool, R. O. Messing, and E. C. Dempsey Divergent contractile and structural responses of the murine PKC-{epsilon} null pulmonary circulation to chronic hypoxia Am J Physiol Lung Cell Mol Physiol, December 1, 2005; 289(6): L1083 - L1093. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rossig, C. Urbich, T. Bruhl, E. Dernbach, C. Heeschen, E. Chavakis, K.-i. Sasaki, D. Aicher, F. Diehl, F. Seeger, et al. Histone deacetylase activity is essential for the expression of HoxA9 and for endothelial commitment of progenitor cells J. Exp. Med., June 6, 2005; 201(11): 1825 - 1835. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rask-Madsen and G. L. King Proatherosclerotic Mechanisms Involving Protein Kinase C in Diabetes and Insulin Resistance Arterioscler. Thromb. Vasc. Biol., March 1, 2005; 25(3): 487 - 496. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, C. N. Hahn, M. Parsons, J. Drew, M. A. Vadas, and J. R. Gamble Role of protein kinase C{zeta} in thrombin-induced endothelial permeability changes: inhibition by angiopoietin-1 Blood, September 15, 2004; 104(6): 1716 - 1724. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li, N. Xia, I. Brausch, Y. Yao, and U. Forstermann Flavonoids from Artichoke (Cynara scolymus L.) Up-Regulate Endothelial-Type Nitric-Oxide Synthase Gene Expression in Human Endothelial Cells J. Pharmacol. Exp. Ther., September 1, 2004; 310(3): 926 - 932. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Olson, R. Oeckler, X. Li, L. Du, F. Traganos, X. Zhao, and T. Burke-Wolin Angiotensin II stimulates nitric oxide production in pulmonary artery endothelium via the type 2 receptor Am J Physiol Lung Cell Mol Physiol, September 1, 2004; 287(3): L559 - L568. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lopez, X. Orta, K. Casos, M. P. Saiz, P. Puig-Parellada, M. Farriol, and M. T. Mitjavila Upregulation of endothelial nitric oxide synthase in rat aorta after ingestion of fish oil-rich diet Am J Physiol Heart Circ Physiol, August 1, 2004; 287(2): H567 - H572. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Erdos, J. A. Snipes, A. W. Miller, and D. W. Busija Cerebrovascular Dysfunction in Zucker Obese Rats Is Mediated by Oxidative Stress and Protein Kinase C Diabetes, May 1, 2004; 53(5): 1352 - 1359. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Neumann, N. Gertzberg, and A. Johnson TNF-{alpha} induces a decrease in eNOS promoter activity Am J Physiol Lung Cell Mol Physiol, February 1, 2004; 286(2): L452 - L459. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Abou-Mohamed, J. A. Johnson, L. Jin, A. B. El-Remessy, K. Do, W. H. Kaesemeyer, R. B. Caldwell, and R. W. Caldwell Roles of Superoxide, Peroxynitrite, and Protein Kinase C in the Development of Tolerance to Nitroglycerin J. Pharmacol. Exp. Ther., January 1, 2004; 308(1): 289 - 299. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Schneider, D. El Kebir, C. Chereau, S. Lanone, X.-L. Huang, A. S. De Buys Roessingh, J.-C. Mercier, J. Dall'Ava-Santucci, and A. T. Dinh-Xuan Involvement of Ca2+/calmodulin-dependent protein kinase II in endothelial NO production and endothelium-dependent relaxation Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H2311 - H2319. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Barua, J. A. Ambrose, S. Srivastava, M. C. DeVoe, and L.-J. Eales-Reynolds Reactive Oxygen Species Are Involved in Smoking-Induced Dysfunction of Nitric Oxide Biosynthesis and Upregulation of Endothelial Nitric Oxide Synthase: An In Vitro Demonstration in Human Coronary Artery Endothelial Cells Circulation, May 13, 2003; 107(18): 2342 - 2347. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Siflinger-Birnboim and A. Johnson Protein kinase C modulates pulmonary endothelial permeability: a paradigm for acute lung injury Am J Physiol Lung Cell Mol Physiol, March 1, 2003; 284(3): L435 - L451. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wallerath, D. Poleo, H. Li, and U. Forstermann Red wine increases the expression of human endothelial nitric oxide synthase: a mechanism that may contribute to its beneficial cardiovascular effects J. Am. Coll. Cardiol., February 5, 2003; 41(3): 471 - 478. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yao, M. Hausding, G. Erkel, T. Anke, U. Forstermann, and H. Kleinert Sporogen, S14-95, and S-Curvularin, Three Inhibitors of Human Inducible Nitric-Oxide Synthase Expression Isolated from Fungi Mol. Pharmacol., February 1, 2003; 63(2): 383 - 391. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Rossig, H. Li, B. Fisslthaler, C. Urbich, I. Fleming, U. Forstermann, A. M. Zeiher, and S. Dimmeler Inhibitors of Histone Deacetylation Downregulate the Expression of Endothelial Nitric Oxide Synthase and Compromise Endothelial Cell Function in Vasorelaxation and Angiogenesis Circ. Res., November 1, 2002; 91(9): 837 - 844. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Leikert;, T. R. Rathel;, P. Wohlfart, V. Cheynier, A. M. Vollmar, and V. M. Dirsch Red Wine Polyphenols Enhance Endothelial Nitric Oxide Synthase Expression and Subsequent Nitric Oxide Release From Endothelial Cells Circulation, September 24, 2002; 106(13): 1614 - 1617. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Wallerath, G. Deckert, T. Ternes, H. Anderson, H. Li, K. Witte, and U. Forstermann Resveratrol, a Polyphenolic Phytoalexin Present in Red Wine, Enhances Expression and Activity of Endothelial Nitric Oxide Synthase Circulation, September 24, 2002; 106(13): 1652 - 1658. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Mollnau, M. Wendt, K. Szocs, B. Lassegue, E. Schulz, M. Oelze, H. Li, M. Bodenschatz, M. August, A. L. Kleschyov, et al. Effects of Angiotensin II Infusion on the Expression and Function of NAD(P)H Oxidase and Components of Nitric Oxide/cGMP Signaling Circ. Res., March 8, 2002; 90 (4): e58 - e65. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-D. Orzechowski, A. Gunther, S. Menzel, A. Zimmermann, H. Funke-Kaiser, R. Real, T. Subkowski, F. S. Zollmann, and M. Paul Transcriptional Mechanism of Protein Kinase C-Induced Isoform-Specific Expression of the Gene for Endothelin-Converting Enzyme-1in Human Endothelial Cells Mol. Pharmacol., December 1, 2001; 60(6): 1332 - 1342. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wedgwood, J. M. Bekker, and S. M. Black Shear stress regulation of endothelial NOS in fetal pulmonary arterial endothelial cells involves PKC Am J Physiol Lung Cell Mol Physiol, August 1, 2001; 281(2): L490 - L498. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bove, P. Neumann, N. Gertzberg, and A. Johnson Role of ecNOS-derived NO in mediating TNF-induced endothelial barrier dysfunction Am J Physiol Lung Cell Mol Physiol, May 1, 2001; 280(5): L914 - L922. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Hink, H. Li, H. Mollnau, M. Oelze, E. Matheis, M. Hartmann, M. Skatchkov, F. Thaiss, R. A. K. Stahl, A. Warnholtz, et al. Mechanisms Underlying Endothelial Dysfunction in Diabetes Mellitus Circ. Res., February 2, 2001; 88 (2): e14 - e22. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shigematsu, S. Ishida, D. C. Gute, and R. J. Korthuis Postischemic anti-inflammatory effects of bradykinin preconditioning Am J Physiol Heart Circ Physiol, January 1, 2001; 280(1): H441 - H454. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. P Montecinos, C. Aguayo, C. Flores, A. W Wyatt, J. D Pearson, G. E Mann, and L. Sobrevia Regulation of adenosine transport by D-glucose in human fetal endothelial cells: involvement of nitric oxide, protein kinase C and mitogen-activated protein kinase J. Physiol., December 15, 2000; 529(3): 777 - 790. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ferro, P. Neumann, N. Gertzberg, R. Clements, and A. Johnson Protein kinase C-alpha mediates endothelial barrier dysfunction induced by TNF-alpha Am J Physiol Lung Cell Mol Physiol, June 1, 2000; 278(6): L1107 - L1117. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Linz, H. Heitsch, B. A. Scholkens, and G. Wiemer Long-Term Angiotensin II Type 1 Receptor Blockade With Fonsartan Doubles Lifespan of Hypertensive Rats Hypertension, April 1, 2000; 35(4): 908 - 913. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Li and U. Förstermann Structure-Activity Relationship of Staurosporine Analogs in Regulating Expression of Endothelial Nitric-Oxide Synthase Gene Mol. Pharmacol., March 1, 2000; 57(3): 427 - 435. [Abstract] [Full Text] |
||||
![]() |
J. Navarro-Antolin, J. Rey-Campos, and S. Lamas Transcriptional Induction of Endothelial Nitric Oxide Gene by Cyclosporine A. A ROLE FOR ACTIVATOR PROTEIN-1 J. Biol. Chem., February 4, 2000; 275(5): 3075 - 3080. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Munzel, H. Li, H. Mollnau, U. Hink, E. Matheis, M. Hartmann, M. Oelze, M. Skatchkov, A. Warnholtz, L. Duncker, et al. Effects of Long-Term Nitroglycerin Treatment on Endothelial Nitric Oxide Synthase (NOS III) Gene Expression, NOS III-Mediated Superoxide Production, and Vascular NO Bioavailability Circ. Res., January 7, 2000; 86 (1): e7 - e12. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Lin, S.-Y. Sheu, H.-M. Lee, Y.-S. Ho, W.-S. Lee, W.-C. Ko, and J.-R. Sheu Involvement of Protein Kinase C-gamma in IL-1beta -Induced Cyclooxygenase-2 Expression in Human Pulmonary Epithelial Cells Mol. Pharmacol., January 1, 2000; 57(1): 36 - 43. [Abstract] [Full Text] |
||||
![]() |
T. Wallerath, K. Witte, S. C. Schafer, P. M. Schwarz, W. Prellwitz, P. Wohlfart, H. Kleinert, H.-A. Lehr, B. Lemmer, and U. Forstermann Down-regulation of the expression of endothelial NO synthase is likely to contribute to glucocorticoid-mediated hypertension PNAS, November 9, 1999; 96(23): 13357 - 13362. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ito, P. S. Tsao, S. Adimoolam, M. Kimoto, T. Ogawa, and J. P. Cooke Novel Mechanism for Endothelial Dysfunction : Dysregulation of Dimethylarginine Dimethylaminohydrolase Circulation, June 22, 1999; 99(24): 3092 - 3095. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Liedtke and T. S. Cole Antisense oligonucleotide to PKC-epsilon alters cAMP-dependent stimulation of CFTR in Calu-3 cells Am J Physiol Cell Physiol, November 1, 1998; 275(5): C1357 - C1364. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Schwarz, B. Gierten, J.-P. Boissel, and U. Förstermann Expressional Down-Regulation of Neuronal-Type Nitric Oxide Synthase I by Glucocorticoids in N1E-115 Neuroblastoma Cells Mol. Pharmacol., August 1, 1998; 54(2): 258 - 263. [Abstract] [Full Text] |
||||
![]() |
F. Rodriguez-Pascual, M. Hausding, I. Ihrig-Biedert, H. Furneaux, A. P. Levy, U. Forstermann, and H. Kleinert Complex Contribution of the 3'-Untranslated Region to the Expressional Regulation of the Human Inducible Nitric-oxide Synthase Gene. INVOLVEMENT OF THE RNA-BINDING PROTEIN HuR J. Biol. Chem., August 18, 2000; 275(34): 26040 - 26049. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Holian, S. Wahid, M. J. Atten, and B. M. Attar Inhibition of gastric cancer cell proliferation by resveratrol: role of nitric oxide Am J Physiol Gastrointest Liver Physiol, May 1, 2002; 282(5): G809 - G816. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||