|
|
|
|
Vol. 53, Issue 4, 649-655, April 1998
Laboratory of Clinical Science, National Institute of Mental Health, Bethesda, Maryland 20892-1264 (D.B., D.L.M., A.M.A., C.H.W.), Laboratory of Mammalian Genes and Development, National Institute of Child Health and Human Development, Bethesda, Maryland 20982 (D.F., H.W.), Department of Psychiatry, University of Würzburg, 97080 Würzburg, Germany (A.H., R.M., K.-P.L.)
| |
Summary |
|---|
|
|
|---|
The sodium-dependent, high affinity serotonin [5-hydroxytryptamine
(5-HT)] transporter (5-HTT) provides the primary mechanism for
inactivation of 5-HT after its release into the synaptic cleft. To
further evaluate the function of the 5-HTT, the murine gene was
disrupted by homologous recombination. Despite evidence that excess
extracellular 5-HT during embryonic development, including that
produced by drugs that inhibit the 5-HTT, may lead to severe craniofacial and cardiac malformations, no obvious developmental phenotype was observed in the 5-HTT
/
mice. High
affinity [3H]5-HT uptake was completely absent in
5-HTT
/
mice, confirming a physiologically effective
knockout of the 5-HTT gene. 5-HTT binding sites labeled with
[125I]3
-(4'-iodophenyl)tropan-2
-carboxylic acid
methyl ester were reduced in a gene dose-dependent manner, with no
demonstrable binding in 5-HTT
/
mutants. In adult
5-HTT
/
mice, marked reductions (60-80%) in 5-HT
concentrations were measured in several brain regions. While
(+)-amphetamine-induced hyperactivity did not differ across genotypes,
the locomotor enhancing effects of
(+)-3,4-methylenedioxymethamphetamine, a substituted amphetamine that
releases 5-HT via a transporter-dependent mechanism, was completely
absent in 5-HTT
/
mutants. Together, these data suggest
that the presence of a functional 5-HTT is essential for brain
5-HT homeostasis and for 3,4-methylenedioxymethamphetamine-induced
hyperactivity.
| |
Introduction |
|---|
|
|
|---|
The
5-HT system is an important modulator of many developmental,
behavioral, and physiological processes. The 5-HTT plays a key role in
the regulation of serotonergic neurotransmission and has been
implicated in depression, anxiety, and substance abuse (Lesch et
al., 1993a
; Vanhoutte et al., 1993
). 5-HTT is the
primary target for widely used 5-HT reuptake-inhibiting antidepressant drugs such as fluoxetine, as well as drugs of abuse like MDMA ("ecstasy") (Rudnick and Wall, 1992
; Levi and Raiteri, 1993
,
Blakely et al., 1994
). As part of continued efforts directed
at elucidating the role of 5-HTT in normal behavior and in disease
states (Lesch et al., 1993b
; Lesch et al., 1994
;
Lesch et al., 1996
), an animal model with a targeted
disruption of the 5-HTT gene was generated. A genomic segment
containing exon 2 of the murine 5-HTT gene was replaced with a
PGK-neo gene cassette by homologous recombination in ES
cells. As reported in an article describing the organization of the
murine 5-HTT gene (Bengel et al., 1997
), this segment of the
5-HTT gene contains the start codon, a conserved residue of transmembrane domain 1 that participates in substrate transport (Barker
et al., 1997
), and several post-translational modification sites. Therefore, it was anticipated that a 5-HTT gene lacking exon 2 would result in an inactive or highly dysfunctional gene product
without altering the expression of neighboring genes (Olson et
al., 1996
).
| |
Materials and Methods |
|---|
|
|
|---|
Targeting construct and Southern blot analysis.
A mouse c129
genomic P1 library (Genomic Systems, St. Louis, MO) was screened by a
polymerase chain reaction targeting exon 2 (Kp1,
5'-TGAGATTCACCAAGGGGACG; Kp2, 3'- CCTCCACCATTCTGGTAGCAT). Two clones,
P1(20) and P1(242), were purified and further characterized by
restriction mapping and Southern blot analysis. 3' and 5' DNA fragments
encompassing exon 2 with an overall length of 7.5 kb were inserted into
the pPNT-neo replacement targeting vector, containing a
neo and TK cassette under the control of the PGK promoter
(Fig. 1A) (Tybulewicz et al.,
1991
). A 1.1 kb BamHI/HindIII fragment containing
5-HTT exon 2 was replaced by a 1.8 kb PGK neomycin-polyA expression
cassette. Before electroporation, the targeting construct was
linearized at the single NotI restriction site of
pPNT-neo. 129 R1 ES cells were cultured, transfected, and
subjected to double selection. DNA was digested with Asp718 and hybridized with a 3' probe that recognized a 5-HTT sequence external to the construct (Fig. 1B). In addition, recombinant ES cell
clones were identified by Southern blot analysis, with the use of a 5'
HindIII/BamHI probe to confirm accurate gene
targeting (data not shown). After confirmation of two targeted ES cell
clones (ES 49, ES 53; targeting frequency = 2/61), both clones
were microinjected in C57BL/6J blastocysts to obtain chimeric progeny.
Chimeric males were mated to CD-1 and C57BL/6J female mice; pups were
genotyped by Southern blot analysis of tail biopsies (Fig. 1C). After
confirmation of germline transmission, 5-HTT+/
mice were mated to produce 5-HTT
/
mutants.
|
Animals.
CD-1 mice (25 g) were purchased from Charles River
Laboratories (Wilmington, MA) and C57BL/6J mice (25 g) from Jackson
Laboratories (Bar Harbor, ME). Animals were housed in groups of 3-5
per cage with food and water ad libitum in a facility
approved by the American Association for Accreditation of Laboratory
Animal Care (12-hr light-dark cycle). Experimental protocols adhered to
National Institutes of Health guidelines and were approved by the
National Institute of Mental Health Animal Care and Use Committee. The following experiments were performed with
5-HTT
/
, 5-HTT+/
mice
on the CD-1 background and control littermates.
Tissue preparation and brain neurochemistry.
Mice were
killed by cervical dislocation and their brains were rapidly removed
and dissected over ice. After removal of frontal cortex, the brain was
bisected sagittally and the brain stem, hippocampus, and striatum were
dissected from right hemisphere samples (Sidman et al.,
1971
). The left hemispheres were frozen in isopentane on dry ice for
autoradiography. Samples for 5-HT analysis were stored at
70°
before high performance liquid chromatography using electrochemical
detection, as described previously (Andrews and Murphy, 1993
).
5-HTT autoradiography.
[125I]RTI-55
binding to the 5-HTT was quantified from 125I
microscale standards using National Institutes of Health image software and is expressed as nanocuries per milligram of tissue (mean ± standard error). The density of regions of interest was measured in
each of three adjacent sections from four animals per genotype. Left
hemispheres were sectioned sagittally (20 µm) at
20° and thaw-mounted on gelatin-coated slides.
[125I]RTI-55 binding was performed as described
previously (Silverthorn et al., 1995
) using LR 1111 [1-[2-(diphenylmethoxy)ethyl]-4-(3-phenylpropyl)homopiperazine] (1 mM) to inhibit binding of
[125I]RTI-55 to dopamine uptake sites.
Nonspecific binding was determined in the presence of 1 µM paroxetine and represented <10% of the total
binding.
[3H]5-HT uptake studies.
Brain stem and cortex
samples from three mice of each genotype used in four experiments for
[3H]5-HT uptake were homogenized in 15 volumes
of 0.32 M sucrose using a motor driven Teflon pestle and a
glass mortar. The homogenates were centrifuged for 10 min at 1,000 × g. The supernatants were then centrifuged for 10 min at
17,000 × g. The pellets were resuspended in sucrose at
a final concentration of 1-2 mg/ml. 5-HT uptake was measured using six
concentrations of [3H]5-HT (10-100
nM) as described previously (Maarten and O'Reilly, 1990
)
with some minor modifications. Tubes containing 120 mM
NaCl, 20 mM Tris·HCl, 5 mM KCl, 1.2 mM MgSO4, 2.5 mM
CaCl2, 10 mM glucose, 1 mM ascorbic acid, and 0.1 mM pargyline plus
[3H]5-HT were preincubated for 5 min at 37°.
Brain synaptosomes were then added to each tube and uptake was allowed
to occur for 5 min at 37°. The process was terminated by immersing
the tubes in ice water followed by rapid filtration through Whatman
GF/B filters. Radioactivity was measured using liquid scintillation counting. Specific uptake was defined as that occurring at 37° minus
nonspecific uptake determined in tubes containing 0.1 mM fluoxetine incubated at 0°. Sodium dependence of
[3H]5-HT uptake was evaluated by substituting
LiCl (120 mM) for NaCl in one set of experiments.
Locomotor activity. Testing was conducted during the light phase (10:00-15:00 hr). Initially, a pilot study was performed to determine the dose of (+)-MDMA required to produce locomotor stimulation in CD-1 mice. Within the range of 1.0 to 10 mg/kg, a dose of 5.0 mg/kg (+)-MDMA produced maximal locomotor stimulation; therefore, this dose was used in subsequent experiments. Mice [male mice 8-23 weeks of age for the MDMA study; female mice 8-14 weeks of age for the (+)-amphetamine study] of the three genotypes (5 to 9 mice per group) were brought from the animal colony to the testing room and placed in individual cages at least 1 hr before testing. Locomotor activity was assessed in either Plexiglas test chambers (29.5 × 25.5 × 29 cm) using electronic counters that detected interruptions of eight independent photocell beams located 15 mm above the floor (Coulbourn, Allentown, PA) or in a two-chambered Digiscan (Accuscan, Columbus, OH). Animals were allowed to become habituated to the test chamber before injection with either drug [(+)-MDMA or (+)-amphetamine, 5 mg/kg intraperitoneally] or saline. Cumulative beam disruptions were recorded at 10, 30, and 60 min.
Drugs and chemicals. [125I]RTI-55 (2200 Ci/mmol) and [3H]5-HT creatinine sulfate (24-27 Ci/mmol) were purchased from Dupont NEN (Boston, MA). Fluoxetine HCl was kindly provided by Eli Lilly Laboratories (Indianapolis, IN). Paroxetine HCl was a gift from SmithKline Beecham (Essex, UK). LR 1111 was a gift from R. B. Rothman (National Institute on Drug Abuse, Rockville, MD). MDMA HCl and (+)-amphetamine HCl were a gift from the Research Technology Branch of the National Institute on Drug Abuse. All other chemicals were purchased from Sigma Chemical Company (St. Louis, MO) or a comparable source and were of analytical grade.
Statistics. Data were analyzed initially by one- or two-way analysis of variance using the Statistical Analysis System (SAS Institute, Carey, NC). Significant differences between groups were evaluated using post hoc Student-Newman-Keuls multiple comparisons tests or t tests. Welch t tests were used in some comparisons when unequal variances across the results in the different genotypes were observed. All values are expressed as mean ± standard error, with differences of p < 0.05 considered statistically significant.
| |
Results |
|---|
|
|
|---|
Microinjection of two recombinant ES cell clones with the
predicted mutant allele (Fig. 1B) into C57BL/6J mouse blastocysts 3.5 days old produced chimeric mice. Southern blot analysis after tail
biopsy using both 3' and 5' probes confirmed accurate targeting and
excluded the possibility of additional integrations (Fig. 1C). After
germline transmission was established, homozygous
5-HTT
/
mutants were generated from fertile
heterozygote 5-HTT+/
progeny with an expected
1:2:1 ratio of 5-HTT+/+ to
5-HTT+/
and 5-HTT
/
genotypes. 5-HTT
/
mice exhibited normal
weight gain and showed no tendency toward increased lethality compared
with their 5-HTT+/+ littermates. In addition,
they were fertile and produced normal litter sizes when crossed with
each other. Obvious developmental defects or behavioral abnormalities
were not seen in mutant 5-HTT+/
or
5-HTT
/
mice observed into adulthood.
Quantitative autoradiography of the brain 5-HTT using
[125I]RTI-55 was performed to examine the
effects of the disruption of the 5-HTT gene. A ~50% reduction in
uptake site density was measured in 5-HTT+/
mice whereas an absence of binding was observed in all brain regions in
the 5-HTT
/
mutants (Fig.
2 and 3A).
Direct studies of 5-HTT function were conducted by measuring
[3H]5-HT uptake over a 10-fold concentration
range in synaptosomes prepared from brain stem and cortex. The
resulting saturation isotherms of [3H]5-HT
uptake were similar for the 5-HTT+/+ and
5-HTT+/
mice (Fig.
4), and nonlinear regression analysis did
not reveal differences in the Vmax (21 ± 5 pmoles/mg protein/5 min) and Km (45 ± 7 nM) in brain stem or the
Vmax (15 ± 4) and
Km (30 ± 4) in
cortex of 5-HTT+/
mutants compared with control
mice. [3H]5-HT uptake was absent in
5-HTT
/
mutants (Fig. 4). The residual
[3H]5-HT accumulation was sodium independent
and represented less than 3% of that found in
5-HTT+/+ mice. Vmax
and Km were indeterminate in both
brain regions in 5-HTT
/
mutants.
|
|
|
To evaluate the importance of functional 5-HTT in regulating 5-HT and
other neurotransmitters, monoamine concentrations in various brain
regions were measured using high performance liquid chromatography. In
contrast to essentially normal levels of 5-HT in
5-HTT+/+ and 5-HTT+/
mice, 5-HTT
/
mutants showed 60-80%
reductions in 5-HT concentrations in brain stem, frontal cortex,
hippocampus, and striatum (Fig. 3B). Smaller reductions in
5-hydroxyindoleacetic acid in these brain regions were also
statistically significant, whereas concentrations of norepinephrine,
dopamine, and their metabolites were unchanged in the
5-HTT
/
mutants (data not shown).
Consequences of the disruption of the 5-HTT gene on behavior were
evaluated in studies of locomotor activity using (+)-MDMA and
(+)-amphetamine. Initial studies demonstrated similar levels of
baseline (saline) locomotor activity across the three genotypes (Fig.
5). Administration of (+)-MDMA to
5-HTT+/+ mice resulted in a 3-fold increase in
locomotor activity relative to saline-treated littermate controls that
persisted over the 60 min study period (Fig. 5A). Cumulative
(+)-MDMA-induced hyperactivity in the 5-HTT+/
mice was attenuated by ~50% at all time points relative to
5-HTT+/+ mice treated with (+)-MDMA. The
5-HTT
/
mice, on the other hand, displayed no
increase in locomotor activity after (+)-MDMA administration.
Interestingly, at the 10- and 30-min time points, these mice exhibited
a significant paradoxical reduction in locomotor activity relative to
the saline-treated controls. Administration of (+)-amphetamine to
5-HTT+/+ mice resulted in a 5-fold increase in
locomotor activity relative to saline-treated littermate controls that
persisted over the 60 min study period (Fig. 5B). Cumulative
(+)-amphetamine-induced hyperactivity did not differ across genotypes.
|
| |
Discussion |
|---|
|
|
|---|
5-HTT becomes transcriptionally active at embryonic day 10 when it
regulates cranial neural crest migration (Shuey et al., 1992
; Moiseiwitsch and Lauder, 1995
). Despite many 5-HTT-related changes in brain 5-HT homeostasis in adult mice with a null mutation of
the 5-HTT, apparent anatomical alterations were not observed in mice
examined postnatally and observed into adulthood. The lack of major
anatomical anomalies is unexpected in the face of a series of reports
indicating that inhibition of the 5-HTT by fluoxetine, sertraline, and
amitriptyline or by excess 5-HT in cultured mouse embryos perturbs
craniofacial morphogenesis (Shuey et al., 1992
; Yavarone
et al., 1993
; Moiseiwitsch and Lauder, 1995
). Our findings
conflict with a report that rats treated with high doses of fluoxetine
during pregnancy have smaller pups with poorer weight gain (Vorhees
et al., 1994
). Detailed morphological analyses of cortical
and subcortical structures where 5-HT has been suggested to play a
trophic role during development are required to clarify the impact of
5-HTT inactivation on the formation and plasticity of brain structures
(Cases et al., 1996
; Lebrand et al., 1996
).
The observation of congenital malformations in rodent models indicates
that these developmental changes might result from excess 5-HT and
specifically from treatment with selective 5-HT reuptake-inhibiting
antidepressants, has raised considerable concern because of the very
wide use of these drugs and the inevitable consequence that some women
became pregnant during treatment with these agents. However, several
preliminary reports and one very recent follow-up study of women who
became pregnant and continued treatment with fluoxetine revealed no
evidence of neurodevelopmental changes in preschool children (Nulman
et al., 1997
). Another recent study also found no increase
in major or minor structural anomalies or gestational problems in
mothers receiving fluoxetine during the first two trimesters; minor
anomalies and gestational difficulties were more frequent, however, in
mothers whose exposure to fluoxetine began in the third trimester
(Chambers et al., 1996
), although an editorial accompanying
this paper raises some methodological issues regarding these findings
(Robert, 1996
).
Although developmental processes in mice and humans cannot be readily
equated, the lack of any apparent developmental abnormalities in our
mice suggests that major compensatory mechanisms and neuroadaptive changes occur in 5-HTT
/
mice during embryonic
and subsequent neurodevelopment. Transporter function was clearly
ablated in 5-HTT
/
mice, but 5-HT uptake was
nearly unaltered in 5-HTT+/
mice. The data on
uptake function contrast with those from
[125I]RTI-55 binding, which showed a gene
dose-dependent reduction in uptake sites. The lack of parallel changes
in uptake versus binding site density confirms the existence and
physiological relevance of additional modes of post-translational
regulation for the cell membrane 5-HT transporting mechanism (Blakely
et al., 1994
; Qian et al., 1997
). Adaptive
changes in 5-HT synthesis, turnover, or metabolism were, in fact,
evidenced in our study by the substantial depletion of neuronal 5-HT
and 5-hydroxyindoleacetic acid in the four brain regions evaluated.
These reductions in 5-HT may reflect negative feedback mechanisms
affecting the synthesis of 5-HT. In this regard, modest reductions of
brain 5-HT have been reported in rodents treated chronically with
antidepressants like fluoxetine and clomipramine (Rattray, 1991
;
Feenstra et al., 1996
; Cabrera-Vera et al.,
1997
). The possibility that subtle changes in the dynamics of 5-HT
transport in 5-HTT+/
mice exert acute or
long-term effect on neurodevelopment and adult brain plasticity
requires further detailed assessment at the cellular and molecular
level.
The substituted amphetamine, MDMA, is an indirect sympathomimetic with
effects on the serotonergic system (Rattray, 1991
; Steele et
al., 1994
; Green et al., 1995
; White et al.,
1996
). It has been suggested that the primary mechanism of action of MDMA involves the release of endogenous 5-HT from presynaptic nerve
terminals, presumably via reversal of the plasma membrane 5-HT
transport (Rudnick and Wall, 1992
; Wichems et al., 1995
; Gudelsky and Nash, 1996
). The net effect of this agent is an increase in 5-HT in the synapse and a prolonged effect of 5-HT. In rodents, administration of MDMA is associated with several behavioral effects, one of which is enhanced locomotor activity (Callaway et
al., 1990
; Rattray, 1991
; Steele et al., 1994
; Green
et al., 1995
; White et al., 1996
). This increase
in locomotion is mediated by the indirect agonist effect of MDMA and
not via a direct effect of MDMA on receptors. Although activation of
the serotonergic system has previously been thought to be inhibitory on
motor output, recent studies have indicated that the release of
presynaptic 5-HT produces hyperactivity.
The importance of presynaptic release of 5-HT by MDMA in locomotor
enhancement has previously been demonstrated in studies with rats
(Callaway et al., 1990
) and more recently in our preliminary dose-ranging studies with CD-1 mice (data not shown) where pretreatment with selective serotonin reuptake-inhibiting antidepressants attenuated the (+)-MDMA-induced hyperactivity. In the current study, we employed (+)-MDMA as a pharmacologic challenge in mice lacking the 5-HTT to
probe the effects of the 5-HTT disruption on the serotonergic system.
We demonstrated a gene dose-dependent decrease in the hyperactivity
induced by (+)-MDMA, suggesting a requirement for a functional 5-HTT in
MDMA-induced locomotor activity in mice. An alternative theory to this
finding may be that the 5-HTT
/
mice respond
in this fashion because they have depleted 5-HT levels, and therefore
are unable to release sufficient 5-HT. However, the ~50% decrease of
locomotion induced by (+)-MDMA in the 5-HTT+/
mice who have 5-HT levels comparable with the
5-HTT+/+ mice argues against this possibility.
The decrease in (+)-MDMA-induced hyperactivity in the
5-HTT+/
mice and the complete absence in the
5-HTT
/
mice suggests that the 5-HTT is not
only the molecular target for MDMA, but that the 5-HTT also mediates
its behavioral and molecular effects on the serotonergic system.
Increased locomotor activity in rodents is also produced by
(+)-amphetamine and cocaine, but these effects have been attributed to
a primary action of these agents on dopaminergic neurotransmission. Selective lesions of mesolimbic dopamine neurons by different methods
prevent amphetamine- or cocaine-induced increases in locomoter activity
(Kelly and Iversen, 1976
; Koob et al., 1981
). Mice lacking the dopamine transporter are also insensitive to the locomotor stimulant effects of both these drugs of abuse (Giros et
al., 1996
). In the present study, no differences across 5-HTT
genotypes in the marked locomotor stimulant effects of (+)-amphetamine
used at the same dose as MDMA were observed. In ongoing investigations of the effects of cocaine on locomotor activity and other behaviors in
these mice, no genotype-related differences in the locomotor effects
were observed (Wichems et al., manuscript in preparation). Thus, mice lacking the 5-HTT differ only in their locomotor responses to the one substituted amphetamine that targets the 5-HTT, (+)-MDMA, but not to (+)-amphetamine or cocaine.
Intense interest has been focused on understanding the role of 5-HT in
functions as widely varied as sleep, appetite, temperature regulation,
pain perception, and motor activity (Vanhoutte et al.,
1993
). Of equal interest is evidence suggesting that imbalances in
brain 5-HT neurotransmission may contribute to conditions such as
depression, alcoholism, and drug abuse, as well as obsessive-compulsive disorder and other anxiety disorders (Lesch et al., 1993a
,
1993b
; Owens and Nemeroff, 1994
; Melo et al., 1996
; Murphy
et al., 1996
). Recently, the short, low-activity variant of
a polymorphism in the human 5-HTT gene's 5' regulatory region was
found to be associated with anxiety-related personality traits (Lesch
et al., 1996
), adding further data implicating 5-HT in the
regulation of anxiety and mood states in primates as well as analogous
characteristics in other vertebrate and even invertebrate species
(Walters et al., 1981
; Griebel, 1995
; Yeh et al.,
1996
). Despite the existence of 14 or more different 5-HT receptor
subtypes, it is the single cell membrane 5-HTT that is believed to be
the primary modulator of both the 5-HT signaling and the tone of the
serotonergic system. However, the precise physiological role of the
5-HTT in the brain has not been evaluated adequately. We anticipate
that 5-HTT-deficient mice will prove to be a useful model for the
continued study of the mechanism of action of drugs used in the
treatment of disorders involving serotonergic dysfunction. Furthermore,
these mice represent a powerful tool for the investigation of
some drugs of abuse, including (+)-MDMA, which, in addition to having
psychostimulant effects, may also produce 5-HT-related neurotoxicity
similar to that found after administration of other serotonergic agents
(Schmidt et al., 1987
; Andrews and Murphy, 1993
; Steele
et al., 1994
).
| |
Acknowledgments |
|---|
We thank A. Grinberg, S. P. Huang, T. Tolliver, S.-J. Huang, B. Ladenheim, J. L. Cadet, P. Mazzola-Pomieto, M. Seemann, and M. Schad for expert scientific assistance, and S. Y. Uhm for editorial assistance.
| |
Footnotes |
|---|
Received August 1, 1997; Accepted December 8, 1997
This work was supported by the Deutsche Forschungsgemeinschaft, the Bundesministerium für Bildung und Forschung, the European Commission, and the Intramural Research Program of the National Institute of Mental Health. Additional assistance came from a Howard Hughes Medical Institute Fellowship for physicians (D.F.) and from support by the Hermann and Lilly Schilling Foundation (K.-P.L.).
Send reprint requests to: Klaus-Peter Lesch, M.D., Department of Psychiatry, University of Würzburg, Füchsleinstr. 15, 97080 Würzburg, Germany. E-mail: kplesch{at}mail.uni-wuerzburg.de
| |
Abbreviations |
|---|
5-HT, 5-hydroxytryptamine (serotonin);
5-HTT, 5-hydroxytryptamine transporter;
MDMA, 3,4-methylenedioxymethamphetamine;
ES, embryonic stem;
kb, kilobase
pair;
RTI-55, 3
-(4'-iodophenyl)tropan-2
-carboxylic acid methyl
ester.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. M. Cyphert, M. Kovarova, I. C. Allen, J. M. Hartney, D. L. Murphy, J. Wess, and B. H. Koller Cooperation between Mast Cells and Neurons Is Essential for Antigen-Mediated Bronchoconstriction J. Immunol., June 15, 2009; 182(12): 7430 - 7439. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Bischoff, R. Mailer, O. Pabst, G. Weier, W. Sedlik, Z. Li, J. J. Chen, D. L. Murphy, and M. D. Gershon Role of serotonin in intestinal inflammation: knockout of serotonin reuptake transporter exacerbates 2,4,6-trinitrobenzene sulfonic acid colitis in mice Am J Physiol Gastrointest Liver Physiol, March 1, 2009; 296(3): G685 - G695. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Page, O. J. Kuti, C. Prestia, and M. Sur Haploinsufficiency for Pten and Serotonin transporter cooperatively influences brain size and social behavior PNAS, February 10, 2009; 106(6): 1989 - 1994. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. D. Carneiro, D. C. Airey, B. Thompson, C.-B. Zhu, L. Lu, E. J. Chesler, K. M. Erikson, and R. D. Blakely Functional coding variation in recombinant inbred mouse lines reveals multiple serotonin transporter-associated phenotypes PNAS, February 10, 2009; 106(6): 2047 - 2052. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Thomsen, F. S. Hall, G. R. Uhl, and S. B. Caine Dramatically Decreased Cocaine Self-Administration in Dopamine But Not Serotonin Transporter Knock-Out Mice J. Neurosci., January 28, 2009; 29(4): 1087 - 1092. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. C Prasad, J. A Steiner, J. S Sutcliffe, and R. D Blakely Enhanced activity of human serotonin transporter variants associated with autism Phil Trans R Soc B, January 27, 2009; 364(1514): 163 - 173. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Baganz, R. E. Horton, A. S. Calderon, W. A. Owens, J. L. Munn, L. T. Watts, N. Koldzic-Zivanovic, N. A. Jeske, W. Koek, G. M. Toney, et al. Organic cation transporter 3: Keeping the brake on extracellular serotonin in serotonin-transporter-deficient mice PNAS, December 2, 2008; 105(48): 18976 - 18981. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mongeon, M. R. Gleason, M. A. Masino, J. R. Fetcho, G. Mandel, P. Brehm, and J. E. Dallman Synaptic Homeostasis in a Zebrafish Glial Glycine Transporter Mutant J Neurophysiol, October 1, 2008; 100(4): 1716 - 1723. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Popa, C. Lena, C. Alexandre, and J. Adrien Lasting Syndrome of Depression Produced by Reduction in Serotonin Uptake during Postnatal Development: Evidence from Sleep, Stress, and Behavior J. Neurosci., April 2, 2008; 28(14): 3546 - 3554. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hyland Clinical Utility of Monoamine Neurotransmitter Metabolite Analysis in Cerebrospinal Fluid Clin. Chem., April 1, 2008; 54(4): 633 - 641. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Doly, E. Valjent, V. Setola, J. Callebert, D. Herve, J.-M. Launay, and L. Maroteaux Serotonin 5-HT2B Receptors Are Required for 3,4-Methylenedioxymethamphetamine-Induced Hyperlocomotion and 5-HT Release In Vivo and In Vitro J. Neurosci., March 12, 2008; 28(11): 2933 - 2940. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. O'Reilly, S. Trent, S. J. Bailey, and M. A. Lane 13-cis-Retinoic Acid Alters Intracellular Serotonin, Increases 5-HT1A Receptor, and Serotonin Reuptake Transporter Levels In Vitro Experimental Biology and Medicine, October 1, 2007; 232(9): 1195 - 1203. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Altamura, M. Dell'Acqua, R Moessner, D. Murphy, K. Lesch, and A. M. Persico Altered Neocortical Cell Density and Layer Thickness in Serotonin Transporter Knockout Mice: A Quantitation Study Cereb Cortex, June 1, 2007; 17(6): 1394 - 1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Wellman, A. Izquierdo, J. E. Garrett, K. P. Martin, J. Carroll, R. Millstein, K.-P. Lesch, D. L. Murphy, and A. Holmes Impaired Stress-Coping and Fear Extinction and Abnormal Corticolimbic Morphology in Serotonin Transporter Knock-Out Mice J. Neurosci., January 17, 2007; 27(3): 684 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Jennings, M. K. Loder, W. J. Sheward, Q. Pei, R. M. J. Deacon, M. A. Benson, H. J. Olverman, N. D. Hastie, A. J. Harmar, S. Shen, et al. Increased Expression of the 5-HT Transporter Confers a Low- Anxiety Phenotype Linked to Decreased 5-HT Transmission. J. Neurosci., August 30, 2006; 26(35): 8955 - 8964. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Daws, S. Montanez, J. L. Munn, W. A. Owens, N. L. Baganz, J. M. Boyce-Rustay, R. A. Millstein, L. M. Wiedholz, D. L. Murphy, and A. Holmes Ethanol inhibits clearance of brain serotonin by a serotonin transporter-independent mechanism. J. Neurosci., June 14, 2006; 26(24): 6431 - 6438. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alexandre, D. Popa, V. Fabre, S. Bouali, P. Venault, K.-P. Lesch, M. Hamon, and J. Adrien Early life blockade of 5-hydroxytryptamine 1A receptors normalizes sleep and depression-like behavior in adult knock-out mice lacking the serotonin transporter. J. Neurosci., May 17, 2006; 26(20): 5554 - 5564. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mekontso-Dessap, F. Brouri, O. Pascal, P. Lechat, N. Hanoun, L. Lanfumey, I. Seif, N. Benhaiem-Sigaux, M. Kirsch, M. Hamon, et al. Deficiency of the 5-Hydroxytryptamine Transporter Gene Leads to Cardiac Fibrosis and Valvulopathy in Mice Circulation, January 3, 2006; 113(1): 81 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ni, C. S. Wilhelm, M. Bader, D. L. Murphy, K. Lookingland, and S. W. Watts (+)-Norfenfluramine-Induced Arterial Contraction Is Not Dependent on Endogenous 5-Hydroxytryptamine or 5-Hydroxytryptamine Transporter J. Pharmacol. Exp. Ther., September 1, 2005; 314(3): 953 - 960. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Esaki, M. Cook, K. Shimoji, D. L. Murphy, L. Sokoloff, and A. Holmes Developmental disruption of serotonin transporter function impairs cerebral responses to whisker stimulation in mice PNAS, April 12, 2005; 102(15): 5582 - 5587. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Warden, A. G. Robling, M. S. Sanders, M. M. Bliziotes, and C. H. Turner Inhibition of the Serotonin (5-Hydroxytryptamine) Transporter Reduces Bone Accrual during Growth Endocrinology, February 1, 2005; 146(2): 685 - 693. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Li, A. Holmes, L. Ma, L. D. Van de Kar, F. Garcia, and D. L. Murphy Medial Hypothalamic 5-Hydroxytryptamine (5-HT)1A Receptors Regulate Neuroendocrine Responses to Stress and Exploratory Locomotor Activity: Application of Recombinant Adenovirus Containing 5-HT1A Sequences J. Neurosci., December 1, 2004; 24(48): 10868 - 10877. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Jones, S. S. Lau, and T. J. Monks Thioether Metabolites of 3,4-Methylenedioxyamphetamine and 3,4-Methylenedioxymethamphetamine Inhibit Human Serotonin Transporter (hSERT) Function and Simultaneously Stimulate Dopamine Uptake into hSERT-Expressing SK-N-MC Cells J. Pharmacol. Exp. Ther., October 1, 2004; 311(1): 298 - 306. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Numis, E. L. Unger, D. L. Sheridan, A. C. Chisnell, and A. M. Andrews The Role of Membrane and Vesicular Monoamine Transporters in the Neurotoxic and Hypothermic Effects of 1-Methyl-4-(2'-aminophenyl)-1,2,3,6-tetrahydropyridine (2'-NH2-MPTP) Mol. Pharmacol., September 1, 2004; 66(3): 718 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Ferguson, M. Bazalakova, V. Savchenko, J. C. Tapia, J. Wright, and R. D. Blakely Lethal impairment of cholinergic neurotransmission in hemicholinium-3-sensitive choline transporter knockout mice PNAS, June 8, 2004; 101(23): 8762 - 8767. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Murphy, A. Lerner, G. Rudnick, and K.-P. Lesch Serotonin Transporter: Gene, Genetic Disorders, and Pharmacogenetics Mol. Interv., April 1, 2004; 4(2): 109 - 123. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Frodl, E. M. Meisenzahl, P. Zill, T. Baghai, D. Rujescu, G. Leinsinger, R. Bottlender, C. Schule, P. Zwanzger, R. R. Engel, et al. Reduced Hippocampal Volumes Associated With the Long Variant of the Serotonin Transporter Polymorphism in Major Depression Arch Gen Psychiatry, February 1, 2004; 61(2): 177 - 183. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Li, L. Ma, R. B. Innis, N. Seneca, M. Ichise, H. Huang, M. Laruelle, and D. L. Murphy Pharmacological and Genetic Characterization of Two Selective Serotonin Transporter Ligands: 2-[2-(Dimethylaminomethylphenylthio)]-5-fluoromethylphenylamine (AFM) and 3-Amino-4-[2-(dimethylaminomethyl-phenylthio)]benzonitrile (DASB) J. Pharmacol. Exp. Ther., February 1, 2004; 308(2): 481 - 486. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Robinson Signaling Pathways Take Aim at Neurotransmitter Transporters Sci. Signal., November 4, 2003; 2003(207): pe50 - pe50. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. McCaffery, M. Bleil, M. F. Pogue-Geile, R. E. Ferrell, and S. B. Manuck Allelic Variation in the Serotonin Transporter Gene-Linked Polymorphic Region (5-HTTLPR) and Cardiovascular Reactivity in Young Adult Male and Female Twins of European-American Descent Psychosom Med, September 1, 2003; 65(5): 721 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kelai, F. Aissi, K. P. Lesch, C. Cohen-Salmon, M. Hamon, and L. Lanfumey ALCOHOL INTAKE AFTER SEROTONIN TRANSPORTER INACTIVATION IN MICE Alcohol Alcohol., July 1, 2003; 38(4): 386 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Vogel, R. Mossner, M. Gerlach, T. Heinemann, D. L. Murphy, P. Riederer, K.-P. Lesch, and C. Sommer Absence of Thermal Hyperalgesia in Serotonin Transporter-Deficient Mice J. Neurosci., January 15, 2003; 23(2): 708 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Tjurmina, I. Armando, J. M. Saavedra, D. S. Goldstein, and D. L. Murphy Exaggerated Adrenomedullary Response to Immobilization in Mice with Targeted Disruption of the Serotonin Transporter Gene Endocrinology, December 1, 2002; 143(12): 4520 - 4526. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-T. Liu, S. Rayport, Y. Jiang, D. L. Murphy, and M. D. Gershon Expression and function of 5-HT3 receptors in the enteric neurons of mice lacking the serotonin transporter Am J Physiol Gastrointest Liver Physiol, December 1, 2002; 283(6): G1398 - G1411. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Rocha, E. H. Goulding, L. E. O'Dell, A. N. Mead, N. G. Coufal, L. H. Parsons, and L. H. Tecott Enhanced Locomotor, Reinforcing, and Neurochemical Effects of Cocaine in Serotonin 5-Hydroxytryptamine 2C Receptor Mutant Mice J. Neurosci., November 15, 2002; 22(22): 10039 - 10045. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Froger, A. M. Gardier, R. Moratalla, I. Alberti, I. Lena, C. Boni, C. De Felipe, N. M. J. Rupniak, S. P. Hunt, C. Jacquot, et al. 5-Hydroxytryptamine (5-HT)1A Autoreceptor Adaptive Changes in Substance P (Neurokinin 1) Receptor Knock-Out Mice Mimic Antidepressant-Induced Desensitization J. Neurosci., October 15, 2001; 21(20): 8188 - 8197. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Persico, E. Mengual, R. Moessner, S. F. Hall, R. S. Revay, I. Sora, J. Arellano, J. DeFelipe, J. M. Gimenez-Amaya, M. Conciatori, et al. Barrel Pattern Formation Requires Serotonin Uptake by Thalamocortical Afferents, and Not Vesicular Monoamine Release J. Neurosci., September 1, 2001; 21(17): 6862 - 6873. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ranganathan, E. R. Sawin, C. Trent, and H. R. Horvitz Mutations in the Caenorhabditis elegans Serotonin Reuptake Transporter MOD-5 Reveal Serotonin-Dependent and -Independent Activities of Fluoxetine J. Neurosci., August 15, 2001; 21(16): 5871 - 5884. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Chen, Z. Li, H. Pan, D. L. Murphy, H. Tamir, H. Koepsell, and M. D. Gershon Maintenance of Serotonin in the Intestinal Mucosa and Ganglia of Mice that Lack the High-Affinity Serotonin Transporter: Abnormal Intestinal Motility and the Expression of Cation Transporters J. Neurosci., August 15, 2001; 21(16): 6348 - 6361. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zwart, S. Verhaagh, M. Buitelaar, C. Popp-Snijders, and D. P. Barlow Impaired Activity of the Extraneuronal Monoamine Transporter System Known as Uptake-2 in Orct3/Slc22a3-Deficient Mice Mol. Cell. Biol., July 1, 2001; 21(13): 4188 - 4196. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sora, F. S. Hall, A. M. Andrews, M. Itokawa, X.-F. Li, H.-B. Wei, C. Wichems, K.-P. Lesch, D. L. Murphy, and G. R. Uhl Molecular mechanisms of cocaine reward: Combined dopamine and serotonin transporter knockouts eliminate cocaine place preference PNAS, April 24, 2001; 98(9): 5300 - 5305. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. l. Cour, C. Boni, N. Hanoun, K.-P. Lesch, M. Hamon, and L. Lanfumey Functional Consequences of 5-HT Transporter Gene Disruption on 5-HT1A Receptor-Mediated Regulation of Dorsal Raphe and Hippocampal Cell Activity J. Neurosci., March 15, 2001; 21(6): 2178 - 2185. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gobbi, D. L. Murphy, K.-P. Lesch, and P. Blier Modifications of the Serotonergic System in Mice Lacking Serotonin Transporters: An in Vivo Electrophysiological Study J. Pharmacol. Exp. Ther., March 1, 2001; 296(3): 987 - 995. [Abstract] [Full Text] |
||||
![]() |
N. Salichon, P. Gaspar, A. L. Upton, S. Picaud, N. Hanoun, M. Hamon, E. De Maeyer, D. L. Murphy, R. Mossner, K. P. Lesch, et al. Excessive Activation of Serotonin (5-HT) 1B Receptors Disrupts the Formation of Sensory Maps in Monoamine Oxidase A and 5-HT Transporter Knock-Out Mice J. Neurosci., February 1, 2001; 21(3): 884 - 896. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pörzgen, S. K. Park, J. Hirsh, M. S. Sonders, and S. G. Amara The Antidepressant-Sensitive Dopamine Transporter in Drosophila melanogaster: A Primordial Carrier for Catecholamines Mol. Pharmacol., January 1, 2001; 59(1): 83 - 95. [Abstract] [Full Text] |
||||
![]() |
Q. Li, C. Wichems, A. Heils, K.-P. Lesch, and D. L. Murphy Reduction in the Density and Expression, But Not G-Protein Coupling, of Serotonin Receptors (5-HT1A) in 5-HT Transporter Knock-Out Mice: Gender and Brain Region Differences J. Neurosci., November 1, 2000; 20(21): 7888 - 7895. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Bauman, S. Apparsundaram, S. Ramamoorthy, B. E. Wadzinski, R. A. Vaughan, and R. D. Blakely Cocaine and Antidepressant-Sensitive Biogenic Amine Transporters Exist in Regulated Complexes with Protein Phosphatase 2A J. Neurosci., October 15, 2000; 20(20): 7571 - 7578. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Fabre, B. Boutrel, N. Hanoun, L. Lanfumey, C. M. Fattaccini, B. Demeneix, J. Adrien, M. Hamon, and M.-P. Martres Homeostatic Regulation of Serotonergic Function by the Serotonin Transporter As Revealed by Nonviral Gene Transfer J. Neurosci., July 1, 2000; 20(13): 5065 - 5075. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Inui Transgenic Approach to the Study of Body Weight Regulation Pharmacol. Rev., March 1, 2000; 52(1): 35 - 62. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.M. Persico, C. Altamura, E. Calia, S. Puglisi-Allegra, R. Ventura, F. Lucchese, and F. Keller Serotonin Depletion and Barrel Cortex Development: Impact of Growth Impairment vs. Serotonin Effects on Thalamocortical Endings Cereb Cortex, February 1, 2000; 10(2): 181 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Li, C. Wichems, A. Heils, L. D. Van de Kar, K.-P. Lesch, and D. L. Murphy Reduction of 5-Hydroxytryptamine (5-HT)1A-Mediated Temperature and Neuroendocrine Responses and 5-HT1A Binding Sites in 5-HT Transporter Knockout Mice J. Pharmacol. Exp. Ther., December 1, 1999; 291(3): 999 - 1007. [Abstract] [Full Text] |
||||
![]() |
S. Ramamoorthy and R. D. Blakely Phosphorylation and Sequestration of Serotonin Transporters Differentially Modulated by Psychostimulants Science, July 30, 1999; 285(5428): 763 - 766. [Abstract] [Full Text] |
||||
![]() |
L. P. Shearman, A. M. McReynolds, F. C. Zhou, and J. S. Meyer Relationship between [125I]RTI-55-labeled cocaine binding sites and the serotonin transporter in rat placenta Am J Physiol Cell Physiol, December 1, 1998; 275(6): C1621 - C1629. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sora, C. Wichems, N. Takahashi, X.-F. Li, Z. Zeng, R. Revay, K.-P. Lesch, D. L. Murphy, and G. R. Uhl Cocaine reward models: Conditioned place preference can be established in dopamine- and in serotonin-transporter knockout mice PNAS, June 23, 1998; 95(13): 7699 - 7704. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||