Introduction

Top Summary Introduction Procedures Results & Discussion References

A number of platinum coordination compounds exhibit antiviral and antitumor activities (Taylor and Ward, 1991; Comis, 1994; Rixe et al., 1996). In the search for new, therapeutically more effective platinum drugs, platinum(II) compounds containing, as a part of the coordination sphere, certain selected antiviral nucleosides also were recently synthesized (Taylor and Ward, 1991; Coluccia et al., 1995). Several compounds of this type exhibit similar or enhanced antiviral activities in vitro and in many instances are less toxic to normal cells than either component (Taylor and Ward, 1991).

The synthesis of a novel compound, cisPt-ACV (Fig. 1C), was recently described (Coluccia et al., 1995). This compound is based on antitumor cisplatin [cis-diamminedichloroplatinum(II)] (Fig. 1A), which contains in its coordination sphere antiviral ACV [9-(2-hydroxyethoxymethyl)guanine, acycloguanosine] (Fig. 1C). The molecule of ACV contains an unchanged guanine residue and a modified, acyclic deoxyribose moiety. This antiviral drug exhibits high activity against various herpes viruses (O'Brien and Campoli-Richards, 1989).

View larger version (18K): [in this window] [in a new window]   Fig. 1.   Structures.

Preliminary results indicated that cisPt-ACV retained anti-herpes simplex-1 efficiency in vitro, albeit less than that of the unplatinated ACV (Coluccia et al., 1995). This finding prompted us to assess systematically the in vitro antiviral activity of this new complex toward a variety of DNA and RNA viruses. The results confirming activity of cisPt-ACV in vitro toward a number of viruses will be published in a separate communication.

Cisplatin (Fig. 1A) and its direct analogue carboplatin [cis-diammine(1,1-cyclobutyl-dicarboxylato)platinum(II)] are effective anticancer drugs currently approved for the treatment of several human carcinomas (Comis, 1994; Rixe et al., 1996). Even though these platinum drugs belong to the most successful antitumor compounds developed in recent years, they display limited activity against some of the common tumors, such as breast and colon carcinomas. In addition, a variety of adverse effects and acquired resistance are observed in patients receiving cisplatin or carboplatin chemotherapy. These limitations have inspired efforts to develop new platinum-based drugs that would display improved therapeutic properties.

Exploration of new structural classes of platinum antitumor drugs resulted in the discovery of various new platinum(II) complexes. These new compounds also include those of formula cis-[PtCl(NH₃)₂(Am)]⁺ (where Am is an amine ligand). These formally monofunctional complexes (only containing one leaving chloride group), in which Am was a ligand derived from pyridine, pyrimidine, purine, piperidine, or aniline, demonstrated activity against a number of murine tumors and human tumor cell lines (Hollis et al., 1989, 1991) in contrast to closely related and simpler but inactive platinum/triamine complexes, such as dienPt [[PtCl(H₂NCH₂CH₂NHCH₂CH₂NH₂)]Cl] (Fig. 1B) or [Pt(NH₃)₃Cl]Cl. Therefore, the antitumor activity of cisPt-ACV also was tested (Coluccia et al., 1995). cisPt-ACV was found to be as effective as cisplatin when equitoxic doses were administered in vivo to P388 leukemia-bearing mice. Importantly, the cisPt-ACV also was active against a cisplatin-resistant subline of the P388 leukemia. This observation suggests that cisPt-ACV exhibits antitumor activity, but the mechanism underlying this activity is different from that of cisplatin.

We are currently testing the hypothesis that an alteration in DNA-binding mode may result in antitumor activity different from that of cisplatin. It is generally believed that the mechanism of anticancer activity of cisplatin and its simple analogues involves formation of platinum/DNA adducts that are capable of blocking DNA and RNA synthesis (for general reviews, see Johnson et al., 1989; Lepre and Lippard, 1990; Leng and Brabec, 1994) and induce programmed cell death (Barry et al., 1990; Ormerod et al., 1996). These platinum(II) complexes usually bind to DNA in a two-step process, producing first monofunctional adducts preferentially at the N(7) position of guanine residues, which can subsequently close to bifunctional lesions. There is a considerable evidence suggesting that the antitumor efficacy of cisplatin and its analogues is associated with the formation of DNA 1,2-intrastrand d(GpG) or d(ApG) cross-links by this drug (see, for example, Johnson et al., 1989; Lepre and Lippard, 1990; Leng and Brabec, 1994).

It is reasonable to expect that the molecular mechanism underlying antitumor activity of the compounds such as cis-[PtCl(NH₃)₂(Am)]⁺ involves coordination of the platinum complex to DNA. On the other hand, no experimental data have been obtained indicating that such reaction is involved in the mechanism of antiviral activity of the platinated nucleoside analogues. Nevertheless, to address fundamental questions about the mechanism of biological action of platinum(II) compounds containing, as a part of the coordination sphere, certain selected antiviral nucleosides, studies were initiated on DNA interactions of cisPt-ACV in cell-free media. The results of these studies will contribute to understanding of the limits of the structure-activity relationships among platinum(II) complexes. It also is anticipated that at least some aspects of DNA interactions of cis-[PtCl(NH₃)₂(Am)]⁺ revealed in this report will be useful when searching not only for new antitumor drugs but also for new antiviral platinum complexes containing, as a part of the coordination sphere, antiviral nucleosides.

	Experimental Procedures

Top Summary Introduction Procedures Results & Discussion References

Materials. Cisplatin, transplatin, and dienPt were synthesized and characterized at Lachema (Brno, Czech Republic). cisPt-ACV and transPt-ACV, the trans isomer of cisPt-ACV] were prepared and characterized as described previously (Coluccia et al., 1995). The stock solutions of the platinum complexes were prepared through dissolution at a concentration of 5 × 10^-4 M in 10 mM NaClO₄ in the dark at 25°; they were stored for 7 days before they were used. Calf thymus DNA (42% G + C, mean molecular mass ~ 2 × 10⁷) also was prepared and characterized as described previously (Brabec and Paleèek, 1970). Plasmid pSP73 (2464 bp) was isolated according to standard procedures and banded twice in CsCl/ethidium bromide equilibrium density gradients. The oligodeoxyribonucleotides synthesized on an Applied Biosystem solid-phase synthesizer were purified by ion exchange fast performance liquid chromatography with a linear gradient of 0.1-0.8 M NaCl with 10 mM NaOH. In this report, the concentrations of oligonucleotides are related to the mononucleotide content. Restriction endonucleases were purchased from New England BioLabs (Beverly, MA). T4 polynucleotide kinase and Klenow fragment of DNA polymerase I were from Boehringer-Mannheim Biochemica (Mannheim, Germany). Riboprobe Gemini System II for transcription mapping containing T7 RNA polymerase was purchased from Promega (Madison, WI). Deoxyriboguanosine, DNase I from bovine pancreas, nuclease P1 from Penicillium citrinum, and alkaline phosphatase from calf intestine were from Sigma-Aldrich (Prague, Czech Republic). Ethidium bromide, acrylamide, bisacrylamide, urea, DMS, and NaCN were from Merck (Darmstadt, Germany). TbCl₃0·6 H₂O was from Fluka Chemie AG (Buchs, Switzerland). The radioactive products were from Amersham (Arlington Heights, IL).

Platination reactions. Calf thymus or plasmid DNAs were modified by platinum complexes in 10 mM NaClO₄ at 37° in the dark for 48 hr if not stated otherwise. In these samples, the number of platinum atoms fixed per nucleotide residue (r_b values) were determined by FAAS or differential pulse polarography (Kim et al., 1990). The oligodeoxyribonucleotide duplex 5'-d(CTTCTCTTCTGGTCTTCTCT)/5'-d(GAGAGAAGACCAGAAGAGAA) [abbreviated as d(TGGT)/d(ACCA) according to its central sequences] was platinated in the following manner so it contained only a single adduct of cisPt-ACV. The single-stranded d(TGGT) at a concentration of 8 × 10^-4 M [the top, pyrimidine-rich strand of the duplex d(TGGT)/d(ACCA)] was allowed to react with cisPt-ACV (the input molar ratio was 1 Pt atom per oligonucleotide strand) for 48 hr at 37°. The single product of this reaction was purified by ion exchange fast performance liquid chromatography (Brabec et al., 1992) and further analyzed for the platinum content by FAAS. The concentration of the oligonucleotide present in the product, determined by absorption spectrophotometry, made it possible to conclude that the product of the reaction of single-stranded d(TGGT) contained 1 molecule of cisPt-ACV coordinated per oligonucleotide strand. The yield of this reaction was ~90%. The purified platinated or nonmodified d(TGGT) was further analyzed in the single-stranded form or annealed with the unplatinated bottom (complementary) strand, d(ACCA) (the mixture was incubated in 50 mM NaClO₄ at 65° for 5 min and subsequently slowly cooled at room temperature to ~22° within ~2 hr). The formation of the duplexes was checked by recording melting curves, which exhibited a clear cooperative helix-coil transition characterized by ~35% hyperchromic effect with a melting temperature of >50°.

Sequence specificity of DNA adducts. Transcription of the (NdeI/HpaI) restriction fragment of pSP73 DNA with T7 RNA polymerase and electrophoretic analysis of transcripts was performed according to the protocols recommended by Promega (Promega Protocols and Applications, 43-46; 1989/90) and previously described in detail (Lemaire et al., 1991; Brabec and Leng, 1993).

Fluorescence measurements. These measurements were performed with a Shimadzu RF 40 spectrofluorophotometer using a 1-cm quartz cell. Terbium fluorescence measurements were performed as follows: TbCl₃ was added to 8 µg of modified or control DNA/ml at a final concentration equivalent to twice the monomeric nucleotide content. The fluorescence intensity was measured after equilibration for 60 min at 25° in the dark. The excitation and emission wavelengths were 290 and 546 nm, respectively. Other details of these measurements can be found in earlier reports (Topal and Fresco, 1980; Balcarová and Brabec, 1989).

Unwinding of negatively supercoiled DNA. Unwinding of closed circular supercoiled pSP73 plasmid DNA was assayed by an agarose gel mobility shift assay (Keck and Lippard, 1992). The unwinding angle F, induced per platinum/DNA adduct, was calculated from the r_b value at which the complete transformation of the supercoiled to relaxed form of the plasmid was attained. Samples of pSP73 plasmid were incubated with cisPt-ACV at 37° in the dark for 48 hr. All samples were precipitated by ethanol and redissolved in the TBE (Tris-borate/EDTA) buffer. An aliquot of the precipitated sample was subjected to electrophoresis on 1% agarose gels running at 25° in the dark with TBE buffer with a voltage set at 30 V. The gels were then stained with ethidium bromide, followed by photography on Polaroid 667 film with transilluminator. The other aliquot was used for the determination of r_b values by FAAS.

ICL assay. cisPt-ACV at varying concentrations was incubated with 2 µg of pSP73 DNA linearized by EcoRI. The platinated samples were precipitated by ethanol and analyzed for DNA ICLs as described recently (Lemaire et al., 1991; Brabec and Leng, 1993). The linear duplexes were first 3'-end labeled by means of the Klenow fragment of DNA polymerase I and [-³²P]dATP. The samples were deproteinized by phenol and precipitated by ethanol, and the pellet was dissolved in 18 µl of a solution containing 30 mM NaOH, 1 mM EDTA, 6.6% sucrose, and 0.04% bromphenol blue. The amount of ICLs was analyzed by electrophoresis under denaturing conditions on alkaline agarose gel (1%). After the electrophoresis was completed, the intensities of the bands corresponding to single strands of DNA and ICL duplex were quantified by means of a Molecular Dynamics PhosphorImager (Storm 860 System with ImageQuant software; Sunnyvale, CA).

HPLC analyses. These analyses were performed using a Hitachi Series 4 liquid chromatograph equipped with a LCI-100 computing integrator and a Waters µBondapak C18 column. If not stated otherwise, the products were separated by RP-HPLC (isocratic elution with 0.1 M ammonium acetate, pH 5.5, in 3.9% CH₃CN at 1 ml/min flow rate). The following enzymatic digestion protocol was used to characterize the platinated deoxyribooligonucleotides. The samples (50 µg of the oligonucleotide) were incubated with 72 units of DNase I at 37°. After 4 hr, nuclease P1 (40 µg) was added, and the reaction was allowed to continue at 37° for 18 hr. Finally, alkaline phosphatase (39 units) was added, and the incubation continued for an additional 4 hr at 37°. The digested samples containing constituent nucleosides were heated for 2 min at 80° and centrifuged, and the supernatant was analyzed by RP-HPLC. The standard cis-[Pt(NH₃)₂(N7-ACV)(N7-dGuo)]⁺ was prepared by reaction of deoxyriboguanosine (dGuo) with one equivalent of cis-[PtCl(NH₃)₂(N7-ACV)]NO₃. The latter species was generated by allowing the chloro form dissolved in distilled water to react with one equivalent of AgNO₃. The AgCl precipitate was removed by centrifugation. The resulting major product was purified by RP-HPLC using water/methanol gradient with 0.02 M ammonium acetate, pH 5.5, and its structure was confirmed by ¹H NMR spectroscopy and infrared spectroscopy. Proton NMR spectra were obtained with a Bruker AM 300 spectrometer and infrared spectra using Perkin-Elmer Cetus (Norwalk, CT) 283 and FT spectrophotometers.

Nessler colorimetric assay. Liberation of ammonia from cisPt-ACV on its binding to DNA was assayed using a classic Nessler reagent. After the reaction was completed, the absorbance of the samples was measured at 428 nm. The reaction was optimized so that 2% ammonia could be detected in the samples analyzed in this work. Other details of these analyses are given in the text below.

DMS footprinting. The chemical modifications of the platinated or nonmodified oligodeoxyribonucleotides, single-stranded d(TGGT) or double-stranded d(TGGT)/d(ACCA), by DMS were performed with the d(TGGT) strand 5'-end labeled by T4 polynucleotide kinase and [-³²P]ATP. Other details of these modifications were the same as in our previous work (Lemaire et al., 1991; Brabec and Leng, 1993). Before analysis on a 24% polyacrylamide/8 M urea gel, the products were treated with 0.2 M NaCN (pH 11.5, 16 hr, 45° in the dark) to remove bound platinum. Intensities of the bands on the autoradiograms were quantified by means of a Molecular Dynamics PhosphorImager (Storm 860 System with ImageQuant software).

DNA melting. The melting curves of DNAs were recorded by measuring the absorbance at 260 nm. If not stated otherwise, the melting curves were recorded in media containing various concentrations of NaCl and 1 mM Tris·HCl with 0.1 mM EDTA, pH 7.4. The value of the melting temperature (t_m) was determined as the temperature corresponding to a maximum on the first-derivation profile of the melting curves. The t_m values could be thus determined with an accuracy of ±0.3°.

Immunochemical analysis. Monoclonal antibodies, Ab_cis, were prepared against double-helical calf thymus DNA modified by cisplatin at r_b of 0.08 in 10 mM NaClO₄ for 48 hr at 37°. They were purified and characterized in the same way as described previously (Sundquist et al., 1987; Vrána et al., 1992). Their specificity and avidity were the same as described previously (Sundquist et al., 1987; Vrána et al., 1992). The procedures for their immunoenzymatic analysis and ELISA also have been described (Sundquist et al., 1987; Vrána et al., 1992).

Other methods. UV spectra were measured with a Beckmann DU-8 spectrophotometer. FAAS measurements were carried out on a Unicam 939 AA spectrometer with a graphite furnace. For FAAS analysis, DNA was precipitated with ethanol and dissolved in 0.1 M HNO₃.

	Results and Discussion

Top Summary Introduction Procedures Results & Discussion References

Stability of cisPt-ACV and its DNA binding. We found conditions for RP-HPLC analysis that allowed quantitative detection of ACV in the presence of cisPt-ACV (Fig. 2A). The lower limit of this determination was 0.5% ACV in the presence of cisPt-ACV. cisPt-ACV was dissolved at concentrations of 1-5 × 10^-4 M in water, 0.01 M and 1.0 M NaClO₄ or NaCl and incubated in the dark at 37° for 1 week. No peak in the RP-HPLC profile corresponding to free ACV was observed, indicating that no ACV spontaneously dissociated from cisPt-ACV in any of the solutions. Solutions of calf thymus DNA at a concentration of 0.32 mg/ml were incubated with cisPt-ACV at r_i values of 0.01-0.1 in 10 mM NaClO₄ at 37° (r_i is defined as the molar ratio of free platinum complex to DNA nucleotide phosphates at the onset of incubation with DNA). At various time intervals, an aliquot of the reaction mixture was withdrawn and precipitated by ethanol, and the supernatant was assayed by RP-HPLC for free cisPt-ACV (not bound to DNA). In this way, we also were able to check directly whether cisPt-ACV on its binding to double-helical DNA is decomposed so its ACV moiety is released into the solution. The HPLC peak corresponding to the free (unbound) cisPt-ACV complex decreased with time of its incubation with DNA and completely disappeared after 24 hr [half-time of this reaction (t_1/2) was~1.7 hr] (shown for r_i = 0.1 in Fig. 2B). This result indicates that cisPt-ACV binds to DNA with a similar rate as cisplatin (Kim et al., 1990) and that all molecules of cisPt-ACV are bound to DNA within 24 hr. No peak appeared in the HPLC profile corresponding to the released ACV after 24 hr of the incubation. It was verified that a small quantity of free ACV (corresponding to 1% of the total amount of cisPt-ACV present in the reaction with DNA) added to this DNA sample after incubation lasting 24 hr yielded a well defined peak in the HPLC profile appearing at the same retention time as free ACV (Fig. 2A). The samples of DNA, to which all molecules of Pt-ACV present in the reaction mixture were bound after incubation in 10 mM NaClO₄ for 24 hr, were further incubated for additional 48 hr at 37° in 0.01, 0.05, and 1 M NaClO₄ or in 0.05 and 1 M NaCl. These subsequent incubations resulted in only the occurrence of a very small peak coeluting with ACV, indicating that only a negligible amount of ACV was released; the amount of ACV released did not exceed ~3%.

View larger version (14K): [in this window] [in a new window]   Fig. 2.   A, C18 RP-HPLC separation of ACV and cisPt-ACV. B, Dependence of the area under the HPLC peak of cisPt-ACV (see A) mixed with 32 µg of calf thymus DNA/ml at ri = 0.1 on the time (for other details, see the text). The peak area at the onset of incubation of cisPt-ACV with DNA was taken as 100%.

Sequence specificity of cisPt-ACV binding to DNA. Transcription mapping studies were performed to determine the preferential binding of cisPt-ACV to specific sites or regions in DNA. Recent work has shown that the in vitro RNA synthesis by RNA polymerases on DNA templates containing several types of bidentate adducts of platinum complexes can be prematurely terminated at the level or in the proximity of adducts (Lemaire et al., 1991; Brabec and Leng, 1993; Brabec et al., 1994; Nováková et al., 1995). Importantly, monofunctional DNA adducts of several platinum(II) complexes are unable to terminate RNA synthesis (Lemaire et al., 1991; Brabec and Leng, 1993; Brabec et al., 1994).

View larger version (34K): [in this window] [in a new window]   Fig. 3.   A, Autoradiogram of 6% polyacrylamide/8 M urea sequencing gel showing inhibition of RNA synthesis by T7 RNA polymerase on the NdeI/HpaI fragment of pSP73 plasmid modified by platinum complexes. Control, nonmodified template. dienPt, the template modified by dienPt at rb = 0.05. cisPt-ACV, the template modified by cisPt-ACV at rb = 0.01. transDDP, the template modified by transplatin at rb = 0.01. cisDDP, the template modified by cisplatin at rb = 0.01. U, A, C, and G, chain terminated marker RNAs. Numbers, nucleotide sequence numbering of B. B, Portion of the base sequence used to monitor inhibition of RNA synthesis on the template containing the adducts of Pt-ACV and other platinum complexes. Only the upper strand of the template is given. Dashed line, sequence transcribed by T7 RNA polymerase, which uses the upper strand of the NdeI/HpaI fragment of pSP73 plasmid as a template. Arrows, Stop signals for DNA modified by cisPt-ACV. Numbers, nucleotide numbering in the sequence map of pSP73 plasmid.

View larger version (21K): [in this window] [in a new window]   Fig. 4.   RP-HPLC separation of the products of enzymatic digest of (A) single-stranded oligonucleotide d(TGGT) nonmodified (curve 1) or containing a single adduct of cisPt-ACV (curve 2). B, Oligonucleotide duplex d(TGGT)/d(ACCA) nonmodified (curve 1) or containing a single adduct of cisPt-ACV in the top strand, d(TGGT) (curve 2). For other details, see the text.

View larger version (44K): [in this window] [in a new window]   Fig. 5.   A, Autoradiogram of 24% polyacrylamide/8 M urea gel showing piperidine-induced specific strand cleavage at DMS-modified bases in unplatinated single-stranded oligonucleotide d(TGGT) (ss noPt), single-stranded d(TGGT) containing the single adduct of cisPt-ACV (ss Pt), unplatinated oligonucleotide duplex d(TGGT)/d(ACCA) (ds noPt), and the duplex d(TGGT)/d(ACCA) containing the single adduct of cisPt-ACV in the top strand d(TGGT). The analysis of the single-stranded d(TGGT) was performed with the strand radioactively labeled at its 5' end. The analysis of the duplexes d(TGGT)/d(ACCA) was performed with their top strands 5'-end labeled, so ds noPt and ds Pt in this figure are relative to the top strand. ss Pt and ds Pt, relative to the oligomers containing the single adduct of cisPt-ACV, which was, after the modification by DMS, subsequently treated with 0.2 M NaCN (alkaline pH) for 10 hr at 45° to remove platinum from the duplex. See the text for other details.

Unwinding induced in DNA by cisPt-ACV binding. Electrophoresis in native agarose gel was used to determine the unwinding induced in pSP73 plasmid by cisPt-ACV through monitoring of the degree of supercoiling (Keck and Lippard, 1992) (Fig. 6). A compound that unwinds the DNA duplex reduces the number of supercoils. This decrease in supercoiling (on binding of unwinding agents) causes a decrease in the rate of migration through agarose gel, which makes it possible for the unwinding to be observed and quantified. Fig. 6 shows electrophoresis gels in which increasing amounts of cisPt-ACV have been bound to a mixture of relaxed and supercoiled pSP73 DNA. The unwinding angle is given by F = 18 s/r_b(c), where s is the superhelical density and r_b(c) is the value of r_b at which the supercoiled and relaxed forms comigrate (Keck and Lippard, 1992). Under the current experimental conditions, s was calculated to be 0.063 on the basis of the data of cisplatin for which the r_b(c) was determined in this study and F was taken 13° (Keck and Lippard, 1992). Unwinding angles for cisPt-ACV calculated in this way were 6°. The unwinding angles for cisplatin and dienPt taken from the literature (Bellon et al., 1991; Keck and Lippard, 1992) are 13° and 6°, respectively.

View larger version (25K): [in this window] [in a new window]   Fig. 6.   Unwinding of supercoiled pSP73 plasmid DNA by Pt-ACV. Top bands, form of relaxed plasmid. Bottom bands, closed, negatively supercoiled plasmid. The plasmid was incubated with Pt-ACV for 48 hr at rb values indicated (upper lanes).

DNA ICL by cisPt-ACV. On electrophoresis in agarose gel under denaturing conditions, 3'-end labeled strands of linearized pSP73 plasmid containing no ICLs migrate as a 2464-base single strand, whereas the ICL strands migrate more slowly as a species of higher molecular mass (Lemaire et al., 1991; Brabec and Leng, 1993). The weak bands corresponding to more slowly migrating ICL fragments were only noticed if cisPt-ACV complex was used to modify DNA in linearized form at r_b of 0.002 (not shown). The intensity of the more slowly migrating band increased with the growing level of the modification. The radioactivity associated with the individual bands at each r_b was measured to obtain estimates of the fraction of ICL molecules. These estimates gave the frequency of ICLs formed by cisPt-ACV in linear DNA (amount of ICLs/molecule of cisPt-ACV complex bound to DNA) of only ~0.2% almost independently of r_b. This result indicates that the ICL efficiency of cisPt-ACV in linear DNA is negligible [cisplatin forms under identical conditions ~6% ICLs (Brabec and Leng, 1993; Vrána et al., 1995)].

Melting of DNA modified by cisPt-ACV. Calf thymus DNA was modified by cisPt-ACV, cisplatin, or dienPt to various r_b (0-0.2) (at 37° for 48 hr so all molecules of the platinum complexes were coordinated to DNA). The effect of these modifications on DNA melting temperature, t_m, was measured (Fig. 7). The results indicate that cisPt-ACV has a similar effect on DNA melting as cisplatin (i.e., both complexes reduce thermal stability of DNA). In contrast, clinically ineffective monofunctional dienPt or bidentate transplatin enhances thermal stability of DNA under identical conditions. The observation that the t_m values of DNA modified by cisPt-ACV were decreased is consistent with an occurrence of conformational alterations induced in DNA by cisPt-ACV that destabilize the duplex (aludová et al., 1996).

View larger version (17K): [in this window] [in a new window]   Fig. 7.   Plots of tm values of calf thymus DNA modified by cisplatin (), transplatin (), dienPt (), or Pt-ACV () on rb measured in 10 mM NaCl plus 1 mM Tris·HCl with 0.1 mM EDTA, pH 7.4 (tm is defined as the difference between the tm values of nonmodified and platinated DNAs).

Fluorescence of complexes of terbium ion with DNA modified by cisPt-ACV. Terbium ion (Tb³⁺) fluorescence is used to investigate local perturbations induced in conformation of double-helical DNA by various physical or chemical agents, including cisplatin pimprivate ENRf8 (Arquilla et al., 1983; Balcarová and Brabec, 1989). This assay is based on the observation that Tb³⁺ fluorescence is strongly enhanced when the ion is bound to the N7 atoms of guanine residues in distorted DNA regions pimprivate ENRf8 (Topal and Fresco, 1980). The modification of double-helical DNA by cisplatin has been shown to result in substantial increase of the fluorescence of this lanthanide cation (Arquilla et al., 1983; Balcarová and Brabec, 1989). This enhancement takes place due to its binding to unplatinated guanine residues in distorted regions around the platination site (Balcarová and Brabec, 1989). In contrast, the coordination of ineffective complexes, such as transplatin or monofunctional dienPt to double-helical DNA results in no distortions, which would increase the accessibility of base residues for their reaction with terbium leading to enhancement of its fluorescence (Arquilla et al., 1983; Balcarová and Brabec, 1989).

View larger version (18K): [in this window] [in a new window]   Fig. 8.   Change in fluorescence of Tb3+ ion produced by its binding to double-helical calf thymus DNA modified by cisplatin (×), dienPt (), or cisPt-ACV () at various rb or by its mixing with DNA to which ACV was added at various ri values. Fluorescence of untreated DNA was arbitrarily set at unity.

Immunochemical analysis of DNA modified by cisPt-ACV. The antibodies raised against DNA modified by cisplatin have been found useful for probing the structures of DNA adducts formed by a number of different platinum complexes (e.g., Sundquist et al., 1987; Hollis et al., 1991; Vrána et al., 1992; Nováková et al., 1995; Vrána et al., 1995; aludová et al., 1997). We prepared antibodies that bind specifically to DNA modified by cisplatin and its analogues (Ab_cis). Ab_cis were found to exhibit strict requirements for two neighboring purine residues in one strand of DNA coordinated in cis geometry with the platinum atom of cis-[Pt(NH₃)₂]²⁺ unit; moreover, this antibody is insensitive to the chemical nature of the inert cis platinum amine ligand. Importantly, Ab_cis do not recognize DNA adducts of transplatin and monofunctional adducts of several platinum(II) complexes (Sundquist et al., 1987; Vrána et al., 1992).

View larger version (17K): [in this window] [in a new window]   Fig. 9.   Competitive inhibition in an ELISA of the cisplatin-DNA antibody binding (Abcis) to the competitor that was calf thymus DNA modified at rb = 0.05 by either cisPt-ACV (), cisplatin (×), or dienPt (). The inhibition expresses the antibody binding as percentage of binding in the absence of any competitor. Data points measured in triplicate varied on average by ±2% from their mean.

Conclusions. A new platinum(II) antiviral and antitumor agent, cis-[Pt(NH₃)₂(Am)Cl]⁺, was synthesized, in which Am is the known antiviral agent ACV (Coluccia et al., 1995). The current results suggest that this new compound can coordinate to DNA and preferentially forms in double-helical DNA stable monofunctional adducts at guanine residues. The results also demonstrate that cisPt-ACV, when monodentately coordinated at d(GG) sites in single-stranded or double-helical DNA, is bound with equal preference to either guanine residue. This is in contrast to DNA binding mode of the similar monofunctional complex cis-[Pt(NH₃)₂(4-methylpyridine)Cl]⁺, which also forms monofunctional lesions at the d(GG) sites but with preference to their 5' residues (Lempers et al., 1990).