|
|
|
|
Vol. 54, Issue 2, 249-257, August 1998
Subunit by the Human IP Prostanoid Receptor:
Analysis Using Agonist Stimulation of High Affinity GTPase Activity and
[35S]Guanosine-5'-O-(3-thio)triphosphate
Binding
Molecular Pharmacology Group, Division of Biochemistry and Molecular Biology, University of Glasgow, Glasgow G12 8QQ, Scotland (C.W.F., D.S.B., G.M.) and Receptor Systems Unit, Glaxo Wellcome Research and Development, Stevenage, Hertfordshire, SG1 2NY, England (S.R.)
| |
Summary |
|---|
|
|
|---|
A FLAG-tagged form of the human IP prostanoid receptor was expressed
stably in HEK 293 cells. This bound [3H]iloprost with
high affinity and stimulated cAMP production when exposed to agonist.
Iloprost produced weak stimulation of GTPase activity and
[35S]guanosine-5'-O-(3-thio)triphosphate
binding in membranes of these cells. Pretreatment of cells with
pertussis toxin did not modify iloprost-mediated stimulation, but this
was blocked by cholera toxin. The effects of iloprost were not
increased by coexpression of either Gs
or
Gi1
. In contrast, coexpression of a chimeric G protein
subunit in which the carboxyl-terminal six amino acids of
Gi1
were altered to those of Gs
resulted in robust stimulation by iloprost. Because the chimeric G protein
subunit (Gi1/Gs6
) is not a substrate for
either pertussis or cholera toxin, pretreatment of cells coexpressing
the IP prostanoid receptor and Gi1/Gs6
with
a mixture of these toxins resulted in resolution of the signal derived
from activation of the chimeric G protein. Agonist-stimulated
[35S]guanosine-5'-O-(3-thio)triphosphate
binding and GTPase activity assays are the most commonly used
strategies to examine interactions between G protein-coupled receptors
and G proteins. These usually are not appropriate for receptors such as
the IP prostanoid receptor that interact with G proteins with low rates
of guanine nucleotide exchange and hydrolysis. Chimeric G proteins such
as Gi1/Gs6
that allow appropriate receptor
contacts to be converted to the higher nucleotide turnover rates
typical of the Gi family G proteins can overcome this and
offer a novel means to examine agonist function at such receptors.
| |
Introduction |
|---|
|
|
|---|
Signal
transduction cascades involving seven-transmembrane element, GPCRs
require the obligate activation of heterotrimeric guanine nucleotide
binding proteins (G proteins) (Birnbaumer et al., 1990
;
Bourne et al., 1990
) Interactions between GPCRs and G
proteins have been assessed and measured by a variety of means. Among
the most widespread and popular are assays that examine GPCR-induced
exchange of GDP for GTP in the nucleotide binding pocket of the G
protein and the subsequent timer-controlled hydrolysis (Gierschik
et al., 1994
) of the terminal phosphate of GTP by the GTPase
activity intrinsic to the
subunits of all G proteins (Milligan,
1988
) or the binding of a poorly hydrolysed analogue of GTP such as
[35S]GTP
S (Wieland and Jakobs, 1994
). Such
approaches have been particularly useful for GPCRs that interact
predominantly with the subfamily of pertussis toxin-sensitive
Gi-like G proteins (Milligan, 1988
; Gierschik
et al., 1994
; Wieland and Jakobs, 1994
). This reflects a
combination of the higher intrinsic guanine nucleotide exchange and
GTPase activity of these G proteins and their relatively high levels of
expression compared with other G proteins. As such, although
agonist-induced turnover of GTP is accepted to occur on other G
proteins, direct demonstration of this often is difficult in membrane
systems (Koski and Klee, 1981
). This occurs despite some of the
earliest evidence for a obligate role for GTP hydrolysis in signal
transmission and termination being derived from analysis of
-adrenoceptor activation of Gs in avian
erythrocytes (Cassel and Selinger, 1976
, 1977
).
Prostaglandins and thromboxanes are locally acting mediators that are
produced from arachidonic acid by the action of cyclooxygenases. Five
primary active prostanoid metabolites, the prostaglandins D2, E2,
F2
, and I2 and
thromboxane A2, function via a family of GPCRs to
produce a range of physiological actions. Receptors from all of these
groupings have been cloned (Pierce et al., 1995
), including
the human IP prostanoid receptor (Boie et al., 1994
). Agonist activation of the IP prostanoid receptor results in stimulation of adenylyl cyclase via activation of the G protein
Gs
(McKenzie and Milligan, 1990b
). Although
not studied as extensively as certain other
Gs
-linked adenylyl cyclase stimulatory
receptors, such as the
-adrenoceptors, the IP prostanoid receptor is
of major potential therapeutic significance. Indeed, the recent
production of mice lacking the IP prostanoid receptor (Murata et
al., 1997
) has confirmed its central role in the regulation of
platelet aggregation and vasodilation and hinted at contributions to
the regulation of inflammation and pain perception. Furthermore, its
endogenous expression by platelets (Armstrong, 1996
) and NG108-15
neuroblastoma X glioma hybrid (Kelly et al., 1990
; McKenzie
and Milligan, 1990b
; Williams and Kelly, 1994
) and other related cell
lines (Kelly et al., 1990
) resulted in substantial
characterization of its regulation and desensitization before the
availability of the receptor cDNA.
Chimeric G protein
subunits have been generated that allowed
certain agonist activated GPCRs to switch output direction. For
example, the alteration of as few as the last three amino acids of
Gq
with those from
Gi1
/Gi2
can allow
certain GPCRs that normally mediate inhibition of adenylyl cyclase to stimulate phosphoinositidase C (Conklin et al., 1993
). A
similar chimeric strategy involving substitution of the
carboxyl-terminal amino acids of G13
with
those from Gz
has been used to define a role
for G13
in
Na+-H+ exchange
(Voyno-Yasenetskaya et al., 1994
).
Equally, conversion of the carboxyl-terminal five amino acids of
Gs
to that of
Gi1
/Gi2
has been
shown to allow the somatostatin SSTR3 receptor to mediate stimulation
of cAMP production, although this receptor normally is considered to
mediate inhibition of adenylyl cyclase activity (Komatsuzaki et
al., 1997
). Generic G protein
subunit carboxyl-terminal
switching also has been applied to attempt to define the specificity of
GPCR/G protein interactions (Liu et al., 1995
; Komatsuzaki
et al., 1997
).
In the current study, we adapted this basic approach to generate a
chimeric G protein
subunit
(Gi1/Gs6
), which has the
backbone of Gi1
except that the
carboxyl-terminal six amino acids have been converted to those of
Gs
. We predicted that this G protein should
allow predominantly Gs
-coupled receptors to
produce robust agonist-dependent regulation of high affinity GTPase
activity and binding of [35S]GTP
S. Using
transient transfection of the chimeric G protein into a cell line
stably expressing a FLAG-tagged form of the human IP prostanoid
receptor, we demonstrate the usefulness of this system and compare it
with the effectiveness of the authentic G proteins.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
All materials for tissue culture were supplied by
Life Technologies Europe (Paisley, Scotland, UK). The IP prostanoid
receptor agonist [3H]iloprost (15.3 Ci/mmol)
was purchased from Amersham International (Buckinghamshire, UK).
[
-32P]GTP (30 Ci/mmol) was obtained from
DuPont-New England Nuclear (Boston, MA).
[35S]GTP
S (1250 Ci/mmol) was purchased from
DuPont-New England Nuclear. Pertussis toxin (240 µg/ml) and all other
chemicals were from Sigma Chemical (Poole, Dorset, UK) and
Boehringer-Mannheim (Mannheim, Germany). Oligonucleotides were
purchased from Genosys (Cambridge, UK).
Construction of a FLAG epitope-tagged human IP prostanoid receptor cDNA. An hIPR cDNA was obtained from Dr. Mark Abramovitz (Department of Biochemistry and Molecular Biology, Merck Frosst Center for Therapeutic Research, Quebec, Canada). To incorporate the FLAG epitope (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) at the amino terminus of the cDNA, a set of PCR oligonucleotide primers was used. The sense oligonucleotide was 5'-AAGGATCCGCCACCATG(GACTACAAGGACGACGATGATAAG)GCGGATTCGTGCAGGAACC-3'; the underlined bases refer to restriction sites for BamHI and NcoI, respectively, with FLAG epitope bases in parenthesis. The antisense oligonucleotide was 5'-AAGAATTCTCAGCTTGAAATG(TCA)GCAGAG-3'; the underlined bases refer to EcoRI restriction site, with the stop codon in parenthesis. The PCR-amplified fragment was digested with BamHI and EcoRI and ligated to pcDNA3 (InVitrogen, San Diego, CA) through these restriction sites. Introduction of the NcoI site at the start codon allowed the selection of positive clones on NcoI digestion and agarose gel electrophoresis. The cDNA construct was fully sequenced.
Construction of Gi1/Gs6
cDNA.
Gi1/Gs6
was generated from a pertussis toxin-resistant form of rat
Gi
1 in which the Cys351 was mutated to
aspartic acid rat Gi
1 by PCR amplification
using the primers 5'-ACGT-GAA-TTC-GCC-ACC-ATG-GGC-TGC-ACA-CTG-AGC-GC-3' (primer 1) and
5'-CCA-CGT-GAA-TTC-TTA-TAA-GAG-TTC-ATA-TTG-CCT-TAG-GTT-ATT-CTT-TAT-3' (primer 2).
Cell culture and stable transfection. HEK 293 cells were maintained in Dulbecco's modified Eagle's medium containing 10% (v/v) newborn calf serum and 2 mM L-glutamine. Cells were seeded into 100-mm culture dishes and grown to 60-80% confluency (18-24 hr) before transfection with 5 µg of FhIPR cDNA using DOTAP reagent (Boehringer-Mannheim). At 48 hr after transfection, the cells were split 1:4 into 800 µg/ml geneticin (G418; Calbiochem, San Diego, CA)-containing medium. A 100-mm dish of untransfected HEK 293 cells also was split into the same medium as a control dish.
About 1 week later, after all the cells in the control dish had died, geneticin-resistant cells in the transfected dishes were picked and transferred into 24-well plates using autoclaved pipette tips. About 40 clones were selected and grown in 1 ml/well of geneticin (400 µg/ml)-containing medium. When the cells were confluent, they were trypsinized and transferred into 25-cm2 culture flask and subsequently into 2 × 75-cm2 flasks. Membrane preparations were made, and their binding of [3H]iloprost was determined.Transient transfections.
Transient transfections into HEK
293 and cells stably expressing the FhIPR (clone 13) were essentially
similar to that described. DNA at 5 µg/100-mm culture dish was used.
At 48-72 hr after transfection, cells were rinsed and harvested in PBS
(0.27 mM KCl, 0.15 mM
KH2PO4, 137 mM
NaCl, 4 mM
Na2HPO4, pH 7.5), followed
by centrifugation at 1000 × g in a refrigerated
centrifuge. The cell pastes obtained were kept at
80° until ready
for membrane preparation.
Preparation of membranes.
Plasma membrane-containing P2
particulate fractions were prepared from cell pastes that had been
stored at
80° after harvesting. Cell pellets were resuspended in
Tris/EDTA buffer (10 mM Tris·HCl, pH 7.5, 0.1 mM EDTA), and rupture of the cells was achieved with 25 strokes of a hand-held Teflon-on-glass homogenizer. Unbroken cells and
nuclei were removed by centrifugation at low speed (2,000 rpm) in a
refrigerated microcentrifuge. The supernatant fraction then was
centrifuged at 75,000 rpm for 30 min in a Beckman Instruments (Palo
Alto, CA) Optima TLX Ultracentrifuge with a TLA100.2 rotor. The pellets
were resuspended in Tris/EDTA buffer to a final protein concentration
of 1-3 mg/ml and stored at
80° until required.
[3H]Iloprost binding studies. Binding assays were initiated by the addition of 20 µg of membrane protein to an assay buffer (50 mM Tris·HCl, pH 7.5, 5 mM MgCl2) containing [3H]iloprost (0.1-50 nM in saturation assays and 10 nM in competition assays). Nonspecific binding was determined in the presence of 10 µM unlabeled iloprost. Reactions were incubated for 30 min at 30°, and bound ligand was separated from free ligand by vacuum filtration through GF/C filters. The filters were washed three times with ice-cold wash buffer (50 mM Tris·HCl, pH 7.5, 0.25 mM EDTA), and bound ligand was determined by liquid scintillation counting.
Immunological studies.
M5 anti-FLAG antibody (IB13091; Kodak
IBI) was used to blot for the FLAG epitope. It was raised in mouse and
specifically recognizes the amino-terminal FLAG (MDYKDDDDK) epitope.
Antiserum CS was produced in a New Zealand White rabbit using
conjugates of synthetic peptide (RMHLRQYELL) and keyhole-limpet
hemocyanin (Calbiochem) as antigen. It was used to blot for both
authentic Gs and
Gi1/Gs6
because it
recognizes the carboxyl-terminal decapeptide of
Gs
(both the short and long isoforms)
(Milligan and Unson, 1989
). Antisera I1C and SG were produced in
similar fashion using peptides LDRIAQPNYI (I1C), which corresponds to amino acids 159-168 of Gi1
, and KENLKDCGLF
(SG), which corresponds to amino acids 341-350 of transducin 1
and
differs by a single amino acid from the carboxyl-terminal decapeptide
of Gi1
and Gi2
(Green
et al., 1990
).
[35S]GTP
S binding studies.
[35S]GTP
S binding studies were performed
according to Wieland and Jakobs (1994)
. Briefly, 25 µg of membranes
was incubated at 25° for 60 min in a final assay volume of 100 µl.
The assay mix consisted of 20 mM HEPES, pH 7.4, 5 mM MgCl2, 100 mM NaCl, and 5 µM GDP. [35S]GTP
S was
used at 50 nCi/assay tube, giving a final assay concentration of
0.3-0.5 nM. Agonist-driven binding of
[35S]GTP
S was determined in the presence of
1 µM iloprost, whereas nonspecific binding was performed
in the presence of 20 µM unlabeled GTP
S. The binding
was stopped by the addition of 2.5 ml of ice-cold wash buffer (20 mM HEPES, pH 7.4, 5 mM
MgCl2), filtered through Whatman GF/C filters,
and followed by three quick washes of 5 ml of wash buffer. Filters were
air-dried; 5 ml of ULTIMA-Gold XR scintillant was added and left
overnight before liquid scintillation counting.
Whole-cell adenylate cyclase assays.
Whole-cell adenylate
cyclase assays were performed as described by Merkouris et
al. (1997)
. Clone 13 cells were split into the wells of a 24-well
plate and incubated in medium containing [3H]adenine at 0.5 µCi/well for 16-24 hr.
The generation of [3H]cAMP in response to
iloprost or forskolin was assessed. Results are expressed as the ratio
of [3H]cAMP to total
[3H]adenine nucleotides (×100).
| |
Results |
|---|
|
|
|---|
The hIPR was amino-terminally modified by the addition of a FLAG
(Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) epitope. The modified IP prostanoid
receptor cDNA (FhIPR) was expressed stably in HEK 293 cells. A number
of individual antibiotic resistant clones were expanded and analyzed.
Specific binding of [3H]iloprost was observed
in membranes derived from a number of the clones (data not shown),
whereas no detectable specific binding was observed in the membranes of
parental HEK 293 cells. Clone 13 expressed the highest levels of
specific [3H]iloprost binding. The specific
binding of [3H]iloprost (5 nM) to
membranes of clone 13 cells could be competed for with high affinity by
unlabeled iloprost, under the assay conditions used, in an apparently
monophasic manner (nH = 1.00 ± 0.12) (Fig. 1a) with an
IC50 value of 9.5 ± 1.1 nM. Applying the formalisms of DeBlasi et
al. (1989)
, this would correspond to a
Kd value for
[3H]iloprost of 4.5 nM
under these assay conditions. Immunoblotting membranes of clone 13 cells with the anti-FLAG monoclonal antibody M5 confirmed expression of
a FLAG-tagged protein (Fig. 1b), which was not present in parental HEK
293 cells. The predominant FLAG antibody reactive species migrated
through SDS-PAGE with an apparent molecular mass of 45 kDa. There was
some evidence for heterogeneity in that a somewhat more slowly
migrating polypeptide also was observed (Fig. 1b). These may represent
differentially glycosylated forms of the receptor.
|
The functionality of the expressed FhIPR was demonstrated by measuring
the ability of iloprost to stimulate cAMP production in intact cells.
The capacity of forskolin to stimulate cAMP production was measured in
parallel; based on a combination of levels of expression of the FhIPR
and because iloprost and forskolin gave similar maximal levels of cAMP
production, clone 13 was selected for detailed analysis.
Concentration-response curves to iloprost indicated an
EC50 value of 1.5 ± 0.4 × 10
10 M for stimulation of cAMP
production (Fig. 2).
|
The addition of iloprost to membranes of clone 13 cells resulted in a
small stimulation of high affinity GTPase activity (see below).
However, although this increase in activity in response to the agonist
was not observed in membranes of parental HEK 293 cells, it was too
limited for detailed pharmacological analysis. Historically, it has
been much easier to measure agonist stimulation of high affinity GTPase
activity when studying GPCRs that interact with members of the
Gi family of pertussis toxin-sensitive G proteins (Koski and Klee, 1981
; Milligan, 1988
; Gierschik et al.,
1994
), and, for example, we recently examined the interaction of the
2A-adrenoceptor and the
subunit of
Gi1 (Wise et al., 1997
) using this
approach.
Because the extreme carboxyl terminus of G protein
subunits is a
key element for GPCR activation of these transducing proteins (Conklin
et al., 1993
; Liu et al., 1995
) and modification
of as few as three amino acids from the carboxyl terminus of the
subunit of the phosphoinositidase C-linked G protein
Gq has been reported to be sufficient to cause
alteration in the nature of GPCRs able to activate these G proteins
(Conklin et al., 1993
), we used a PCR-based strategy to
alter the last six amino acids of Gi1
to those
of Gs
(Fig. 3a).
Confirmation of the success of this strategy was obtained both by
direct sequencing of the modified G protein
(Gi1/Gs6
) cDNA and by a
series of immunoblotting strategies.
Gi1/Gs6
was expressed
transiently in COS-7 cells, and membranes from each of these cells,
mock transfected cells, and rat brain cortex (which expresses high
levels of Gi1
) were immunoblotted with either
antiserum I1C, which was generated against a peptide corresponding to
amino acids 159-168 of Gi1
and is specific
for this G protein (Green et al., 1990
), or with antiserum
SG, which was generated against a peptide corresponding to the
carboxyl-terminal 10 amino acids of Gi1
and
which identifies both Gi1
and
Gi2
(this epitope is identical in these two G
proteins) (Green et al., 1990
). When blotting with antiserum
I1C, a low level of authentic Gi1
was detected as a 41-kDa protein in mock transfected COS-7 cells, as we reported previously (Galbiati et al., 1996
). Successful expression of
Gi1/Gs6
was recorded as
a marked increase in I1C reactivity, which essentially comigrated with
authentic rat brain Gi1
(Fig. 3b,
top). In contrast, immunoblotting of the same membranes with
antiserum SG failed to identify
Gi1/Gs6
, although a
combination of endogenous Gi1
and
Gi2
was detected in both mock and transfected
COS-7 cells and in rat brain (Fig. 3b, bottom). Although these results clearly demonstrated the loss of carboxyl-terminal Gi1
immunoreactivity in
Gi1/Gs6
, the positive
appearance of Gs
carboxyl-terminal
immunoreactivity in this protein was obtained by immunoblotting such
transfected cells with antiserum CS, which was generated against a
peptide corresponding to the carboxyl-terminal 10 amino acids of the
splice variants of Gs
. Now, in addition
to authentic, endogenously expressed
Gs
, transient transfection with
Gi1/Gs6
resulted in the
appearance of a more rapidly migrating CS immunoreactive polypeptide
that comigrated with Gi1
(Fig. 3c).
|
Clone 13 cells subsequently were either mock transfected or transiently
transfected with
Gi1/Gs6
,
Gi1
, or Gs
. Membranes
were prepared, and basal and iloprost stimulation of high affinity
GTPase activity was measured. As noted, a small stimulation over the
basal high affinity GTPase activity was observed in mock transfected
clone 13 cells (Fig. 4). This was
markedly increased in cells transiently transfected with
Gi1/Gs6
but not after
transfection with either Gi1
or
Gs
(Fig. 4). In contrast, transient
transfection of parental HEK 293 cells with
Gi1/Gs6
did not result
in any measurable iloprost stimulation of high affinity GTPase activity
(Fig. 4).
|
We wanted to assess whether the increased agonist-stimulated high
affinity GTPase activity produced by transfection with
Gi1/Gs6
, but not with
authentic Gi1
, simply reflected substantially greater levels of expression of
Gi1/Gs6
. However,
immunoblotting membranes of clone 13 with antiserum I1C after transient
transfection with either of the two G proteins demonstrated these to be
expressed to equivalent levels (Fig. 5).
|
It was possible that the iloprost stimulation of high affinity GTPase
activity in membranes of clone 13 reflected an interaction of the FhIPR
with endogenously expressed Gi-like proteins.
However, the effect of iloprost was not prevented by pretreatment of
the cells with pertussis toxin (25 ng/ml, 16 hr) (Fig.
6). In contrast, pretreatment of the
cells with cholera toxin (200 ng/ml, 16 hr) essentially attenuated
iloprost-stimulated high affinity GTPase activity (Fig. 6). Because
cholera toxin-catalyzed ADP-ribosylation of Gs
attenuates the GTPase activity of this G protein, such results
indicated the signal to be derived from activation of endogenous
Gs.
|
An alternative assay for GPCR-mediated activation of G proteins
is to measure agonist-induced binding of
[35S]GTP
S. Basal specific binding of
[35S]GTP
S was not increased by iloprost in
the membranes of parental HEK 293 cells. As with the GTPase assay,
iloprost did cause stimulation of [35S]GTP
S
binding in membranes of clone 13 cells. However, again, although
transient expression of either Gs
or
Gi1
into clone 13 cells did not result in any
greater level of iloprost-mediated stimulation (see below), the binding
of [35S]GTP
S in response to iloprost was
increased substantially in the presence of
Gi1/Gs6
(Fig.
7).
|
Gi1/Gs6
would be
anticipated to be a substrate for neither cholera toxin nor pertussis
toxin. Clone 13 cells were either mock transfected or transfected with
Gs
, Gi1
, or
Gi1/Gs6
and then treated
for the last 16 hr before cell harvest with a combination of cholera
toxin (200 ng/ml) and pertussis toxin (25 ng/ml). This treatment
essentially attenuated iloprost-stimulation of the binding of
[35S]GTP
S in each of mock transfected,
Gs
-transfected, and Gi1
-transfected clone 13 cells (Fig.
8). In contrast, in cells transiently
transfected with
Gi1/Gs6
, a substantial stimulation of binding of [35S]GTP
S by
iloprost was still achieved (Fig. 8). This was not as great as in the
absence of pretreatment with cholera and pertussis toxins; however, the
degree of reduction in iloprost-stimulated binding of
[35S]GTP
S herein was similar to the maximal
effect of iloprost in mock-transfected clone 13 cells, suggesting that
this fraction was derived from activation of the endogenous
Gs
pool.
|
Immunoblotting membranes from such transfected cells with antiserum I1C
demonstrated expression of
Gi1/Gs6
and
Gi1
(Fig. 9,
top). The small reduction in mobility of the transfected Gi1
through SDS-PAGE in the membranes from
pertussis toxin-treated cells (Fig. 9, compare lanes 3 and
4) is indicative of toxin-catalyzed ADP-ribosylation of this
protein. Very low levels of endogenous Gi1
could be detected in these immunoblots (Fig. 9, see lanes 5-8). Reduced mobility of endogenous Gi1
also was observed after pertussis toxin treatment. In contrast, the
mobility of Gi1/Gs6
was
unaffected by such treatment because it is not a substrate for
pertussis toxin. As anticipated from previous results (Milligan
et al., 1989
), cholera toxin treatment of clone 13 cells
resulted in a substantial reduction in total membrane levels of
authentic Gs
, even in cells transiently
transfected to express excess Gs
(Fig. 9,
bottom, lanes 5 and 6). However, this treatment
did not alter membrane levels of
Gi1/Gs6
(Fig. 9,
bottom, lanes 1 and 2) because it also is not a
substrate for cholera toxin.
|
| |
Discussion |
|---|
|
|
|---|
Studies on GPCR activation of heterotrimeric G proteins are
performed in a number of ways. Probably the two most widely applied methods are to measure agonist-enhanced binding of
[35S]GTP
S (Wieland and Jakobs, 1994
) or the
hydrolysis of the terminal phosphate of
[
32P]GTP (Gierschik et al.,
1994
). Despite the widespread use of such assays, they have been
applied predominantly to GPCRs that couple selectively with members of
the pertussis toxin-sensitive family of Gi-like G
proteins. For other GPCRs, the effect of agonist often is small
compared with the basal signal, resulting in poor specific
signal-to-noise ratios. Systems that improve the response from such
GPCRs would provide an attractive way to study agonist pharmacology.
Substantial evidence indicates that the extreme carboxyl terminus of a
G protein
subunit is a key site for functional contacts with GPCRs.
Pertussis toxin-catalyzed ADP-ribosylation of
Gi-like G proteins at a conserved cysteine
residue four amino acids from the carboxyl terminus of these
subunits (Milligan, 1988
) prevents effective functional interactions
between GPCRs and these G proteins. The unc mutation of
Gs
, which represents a single
arginine-to-proline alteration six amino acids from the carboxyl
terminus, disallows signal transduction from the
2-adrenoceptor (Sullivan et al., 1987
). Furthermore, anti-peptide antibodies directed toward this region
of G proteins often are able to interfere with agonist activation of G
proteins (McKenzie and Milligan, 1990a
; Shenker et al.,
1991
). Given the high sequence, and thus probable structural, similarities between individual G protein
subunits, a large number of chimeras have been generated between different G proteins to
determine elements of G protein function. Indeed, in recent times,
detailed analyses of such chimeras has indicated that only small
elements derived from the extreme carboxyl terminus of the G protein
subunit can be sufficient to define receptor specificity (Conklin
et al., 1993
, 1996
; Liu et al., 1995
; Gomeza
et al., 1996
; Ikezu et al., 1996
; Komatsuzaki
et al., 1997
; Tsu et al., 1997
). This information
has resulted in the use of such chimeric G proteins to transduce
signals from GPCRs to second messenger effector systems that may not be
their usual ones. This can provide a means to use sensitive assay
systems to examine the agonist pharmacology of GPCRs.
We used a chimeric G protein in which the last six amino acids of
Gi1
were converted to those of
Gs
(Gi1/Gs6
) to allow
effective agonist stimulation of high affinity GTPase activity and
[35S]GTP
S binding by the IP prostanoid
receptor. Platelets and neuroblastoma X glioma hybrid NG108-15 cells
have been two of the most studied systems that express this receptor.
Although this GPCR is expressed to levels of >1 pmol/mg membrane
protein in NG108-15 cells, agonists at this GPCR are unable to
stimulate high affinity GTPase activity, although they strongly
activate adenylyl cyclase. In contrast, agonists at the
-opioid
receptor, which is expressed in considerably lower levels in these
cells, produce a robust GTPase response (Koski and Klee, 1981
; McKenzie
and Milligan 1990a
).
A cDNA encoding the hIPR was FLAG-tagged and then stably expressed in
HEK 293 cells. In clone 13, there were good levels of specific
[3H]iloprost binding. Because this ligand is an
agonist (and no radiolabeled antagonists are currently available), the
measured levels of binding can represent only a best estimate. However, using a concentration of [3H]iloprost close to
twice its estimated Kd value (Fig. 1a), ~2-3 pmol/mg of membrane protein of the GPCR was detected. In these membranes, an iloprost-mediated stimulation of high affinity GTPase could be measured. However, it represented a small incremental increase
compared with the basal activity. This did, however, seem to represent
activation of Gs
because it was eliminated by
pretreatment of the cells with cholera toxin. This conclusion reflects
that this toxin eliminates the GTPase activity of
Gs by catalyzing the ADP-ribosylation of a key
arginine residue, a modification that also can lead to accelerated
degradation of this G protein (Milligan et al., 1989
).
However, by contrast, iloprost-stimulated high affinity GTPase activity
and binding of [35S]GTP
S were unaffected by
pertussis toxin treatment, indicating the GPCR-stimulated GTPase
activity did not result from weak activation of the endogenous pool of
Gi-like G proteins.
Transient expression of
Gi1/Gs6
into clone 13 cells allowed effective stimulation of both high affinity GTPase
activity and binding of [35S]GTP
S on the
addition of iloprost. In contrast, expression of Gi1
was unable to mimic these effects. The
availability of an antiserum (I1C) that identifies an internal epitope
present in both Gi1
and
Gi1/Gs6
demonstrated
clearly that these were expressed to equal levels and thus that
although the FhIPR displayed no capacity to activate
Gi1
, interaction with the expressed
Gi1/Gs6
could be
converted into a simple guanine nucleotide exchange-based assay
readout.
Cholera toxin treatment would be anticipated to prevent any
GPCR-mediated stimulation of the GTPase activity of
Gs
, and pertussis toxin is known to prevent
functional contacts between GPCRs and the Gi-like
G proteins. Because
Gi1/Gs6
would not be
anticipated to act as a substrate for either pertussis or cholera toxin, pretreatment of clone 13 cells transiently transfected to
express Gi1/Gs6
with a
combination of both toxins defined that the agonist-induced signal must
be generated by the chimeric G protein. Although as noted, in this
system no evidence was obtained for an effective interaction of the
FhIPR with endogenously expressed Gi-family G
proteins and thus the combined cholera and pertussis toxin treatment
was not required to isolate and define receptor activation of the
chimeric G protein (Fig. 8), this is not always the case. In a number
of examples, agonist at GPCRs that do not appear to mediate their
primary effector function via activation of pertussis toxin-sensitive G
proteins do catalyze measurable GTPase activity or stimulate the
binding of [35S]GTP
S. In such studies,
pertussis toxin pretreatment indicates much of the signal to have been
derived from a minor interaction with Gi-like G
proteins (Akam et al., 1997
).
The current results demonstrate an effective interaction between
the IP prostanoid receptor and the chimeric
Gi1/Gs6
G protein. It
remains to be established whether this chimeric G protein also will be
effectively activated by other predominantly Gs
-coupled GPCRs. If so, it should provide a
sensitive means to analyze agonist pharmacology at such GPCRs using
the type of assays that are widely used in both basic research and
screening systems designed to detect novel agonists.
| |
Acknowledgments |
|---|
We thank Dr. M. Abramovitz (Merck Frosst, Quebec, Canada) for the gift of the human IP prostanoid receptor cDNA.
| |
Footnotes |
|---|
Received February 24, 1998; Accepted April 14, 1998
This work was supported by the Medical Research Council and the Biotechnology and Biosciences Research Council (UK). C.W.F. received a studentship from the National Science and Technology Board of Singapore. D.S.B. received a CASE studentship from the Biotechnology and Biosciences Research Council.
Send reprint requests to: Dr. Graeme Milligan, Davidson Building, University of Glasgow, University Avenue, Glasgow G12 8QQ, Scotland. E-mail: g.milligan{at}bio.gla.ac.uk
| |
Abbreviations |
|---|
FhIPR, FLAG-tagged human IP prostanoid
receptor;
hIPR, human IP prostanoid receptor;
SDS, sodium dodecyl
sulfate;
PAGE, polyacrylamide gel electrophoresis;
PCR, polymerase
chain reaction;
HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic
acid;
HEK, human embryonic kidney;
GTP
S, guanosine-5'-O-(3-thio)triphosphate;
PBS, phosphate-buffered saline;
GPCR, G protein-coupled receptor;
DOTAP, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium
methylsulfate.
| |
References |
|---|
|
|
|---|
metabotropic glutamate receptor-stimulated [35S]-GTP
S binding.
Br J Pharmacol
121:
1203-1209[Medline].
and Gs
that alter the fidelity of receptor activation.
Mol Pharmacol
50:
885-890[Abstract].
15, G
, and chimeric G
q/i proteins: characterization of new antagonists.
Mol Pharmacol
50:
923-930[Abstract].
opioid receptor: studies of inverse agonism in intact cells.
J Neurochem
69:
2115-2122[Medline].
subunit of Gs promotes its removal from the plasma membrane.
Biochem J
260:
837-841[Medline].
Z in the recognition of Gi-coupled receptors.
Mol Pharmacol
52:
38-45
-thio)triphosphate binding by G proteins.
Methods Enzymol
237:
3-13[Medline].This article has been cited by other articles:
![]() |
Y. Cordeaux, S. J. Briddon, A. E. Megson, J. McDonnell, J. M. Dickenson, and S. J. Hill Influence of Receptor Number on Functional Responses Elicited by Agonists Acting at the Human Adenosine A1 Receptor: Evidence for Signaling Pathway-Dependent Changes in Agonist Potency and Relative Intrinsic Activity Mol. Pharmacol., November 1, 2000; 58(5): 1075 - 1084. [Abstract] [Full Text] |
||||
![]() |
J. L. Leaney, G. Milligan, and A. Tinker The G Protein alpha Subunit Has a Key Role in Determining the Specificity of Coupling to, but Not the Activation of, G Protein-gated Inwardly Rectifying K+ Channels J. Biol. Chem., January 14, 2000; 275(2): 921 - 929. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||