![]() |
|
|
Vol. 54, Issue 6, 1016-1023, December 1998
2-Adrenergic Receptor Gene
Division of Critical and Pulmonary Care Medicine,
| |
Summary |
|---|
|
|
|---|
Regulation of
2-adrenergic receptor (
2AR)
levels by glucocorticoids is a physiologically important mechanism for
altering
2AR responsiveness. Glucocorticoids increase
2AR density by increasing the rate of
2AR
gene transcription, but the cis-elements involved have
not been well characterized. We now show that one of six potential
glucocorticoid response elements (GREs) in the 5'-flanking region of
the rat
2AR gene is necessary for
glucocorticoid-dependent stimulation of receptor gene expression. Using
a nested set of deletion fragments of the rat
2AR gene
5'-flanking region fused to a luciferase reporter gene,
glucocorticoid-dependent induction of reporter gene expression in HepG2
cells was localized to a region between positions
643 and
152,
relative to the transcription initiation site. In electrophoretic
mobility shift assays, a double-stranded oligonucleotide incorporating
a near-consensus GRE from this region (positions
379 to
365) formed
complexes with the human recombinant glucocorticoid receptor, as well
as with nuclear protein from dexamethasone-treated HepG2 cells.
Mutation of a single base within this GRE sequence greatly diminished
interaction of the mutated oligonucleotide with the human recombinant
glucocorticoid receptor. The functional activity of the GRE was
characterized using a luciferase reporter construct driven by a minimal
thymidine kinase promoter. In HepG2 cells transfected with constructs
containing the GRE, dexamethasone increased reporter gene expression
approximately 3-fold, whereas a dexamethasone effect was not observed
with constructs lacking the GRE. Taken together, these findings show
that a GRE located at positions
379 to
365 in the 5'-flanking
region of the rat
2AR gene mediates glucocorticoid
stimulation of
2AR gene transcription.
| |
Introduction |
|---|
|
|
|---|
The
2AR is a member of a large superfamily of
membrane-associated receptors that are coupled to G proteins and
produce their effects by activating intracellular signal transduction
pathways (Strader et al., 1995
). For many G protein-coupled
receptors, modulation of receptor number is an established mechanism
controlling responsiveness to hormones and neurotransmitters.
Heterologous regulation of
2AR levels by
glucocorticoids is a physiologically important example of such control
(Collins et al., 1988
). Numerous in vitro and
in vivo studies have shown that
2AR
levels and
-agonist-stimulated adenylyl cyclase activity are
increased by glucocorticoids (Cheng et al., 1980
; Norris
et al., 1987
; Collins et al., 1988
; Takahashi and
Iizuka, 1991
; Dangel et al., 1996
). The increase in
2AR number results from an increase in the
rate of synthesis of new receptors (Norris et al., 1987
),
which in turn is preceded by increased steady state levels of
2AR mRNA (Collins et al., 1988
;
Hadcock and Malbon, 1988
; Zhong and Minneman, 1993
; Mak et
al., 1995
; Dangel et al., 1996
) and increased rates of
transcription of the
2AR gene (Collins
et al., 1988
; Mak et al., 1995
). Taken together, these findings suggest that enhanced
2AR gene
transcription is a principal mechanism underlying
glucocorticoid-mediated increases in
2AR levels.
GREs mediate transcriptional activation of numerous eukaryotic genes by
glucocorticoid receptors (Beato et al., 1989
). Comparison of
these response elements has revealed a consensus, 15-nucleotide, nearly
palindromic sequence that binds the glucocorticoid receptor (Nordeen
et al., 1990
). The
2AR genes from
several mammalian species contain GRE-like sequences in both coding and
noncoding regions (Emorine et al., 1987
; Kobilka et
al., 1987
; Buckland et al., 1990
; Jiang and Kunos,
1995
; McGraw et al., 1996
). Although there is indirect
evidence to suggest that regions in the 5'-noncoding region of the
2AR gene are involved (Malbon and Hadcock,
1988
), the specific genetic elements responsible for the functional
effect of glucocorticoids on
2AR gene
transcription have yet to be identified.
Recently, we extended the sequence of 5'-flanking DNA of the rat
2AR gene to approximately 3.7 kilobases
upstream from the start of translation (McGraw et al.,
1996
). Sequence analysis indicated that this segment of the gene
contains six putative GREs that could potentially mediate the effect of
glucocorticoids on
2AR gene expression. Using
a combination of transient transfection assays with
2AR-luciferase fusion genes and EMSAs, we now
show that a GRE-like element located at positions
379 to
365
(relative to the transcription start site) confers glucocorticoid
inducibility to the rat
2AR gene. Our data
also suggest that, within the context of the
2AR promoter, the activity of this GRE may be
regulated by additional unidentified genetic elements.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
Dexamethasone was purchased from Sigma Chemical
(St. Louis, MO) and was dissolved in ethanol to a stock concentration
of 200 µM. The restriction enzymes AvrII and
NheI were purchased from Boehringer Mannheim (Indianapolis,
IN). All other restriction enzymes were purchased from Promega Corp.
(Madison, WI). Plasmids pRShGR
and N-600 prATLUC were kindly
provided by Robert McGehee (Arkansas Children's Hospital, Little Rock, AR).
Cell culture.
HepG2 cells were grown in Dulbecco's modified
Eagle medium supplemented with 10% fetal bovine serum (Gibco BRL,
Grand Island, NY) that had been depleted of steroid hormones. Serum was
stripped of steroids by the addition of 1 g of activated charcoal
(Sigma)/100 ml of serum and incubation at 55° for 1 hr. The
charcoal-treated serum was centrifuged at 23,000 × g for 10 min
at 4°. The supernatant was filter-sterilized and stored at
20°
before use.
Plasmid construction.
We have extended the known sequence of
the rat
2AR gene to position
3491 (McGraw
et al., 1996
). The nucleotide numbering system that we used
in this study is based on the assignment of +1 to the transcription
start site (nucleotide
220 relative to the start of translation, as
previously determined) (Jiang et al., 1996
). Chimeric gene
constructs were made by fusing
2AR gene
fragments with pGL3-Basic (Promega), a promoterless luciferase expression vector. Initially,
p
2AR(
3129/+126),
p
2AR(
1115/+126), and
p
2AR(
152/+126) were prepared by subcloning
restriction fragments from the 5'-flanking region of the rat
2AR gene into the available sites of
pGL3-Basic, as previously reported (McGraw et al., 1996
). p
2AR(
2552/+126),
p
2AR(
643/+126), and
p
2AR(
62/+126) were prepared by linearization
of
2AR(
3129/+126) with MluI and
NheI and unidirectional digestion of the linearized plasmid
with exonuclease III/mung bean nuclease (Stratagene, La Jolla, CA).
Short segments of
2AR DNA containing putative
GREs were subcloned into pT81LUC (Nordeen, 1988
), a luciferase
expression vector driven by a minimal TK promoter, to test their
ability to enhance expression of a heterologous promoter. For these
constructs, double-stranded oligonucleotides containing either
GRE1 or GRE5 and the
polymerase chain reaction-generated
2AR gene
fragment containing GRE2,
GRE3, and GRE4 were cloned into the XmaI site of pT81LUC. The sequence and orientation
of all constructs were confirmed by dideoxy sequencing (Sanger et al., 1977
) using Sequenase version II (United States Biochemical Corp., Cleveland, OH). All plasmids used in transfections were prepared
using Bigger Prep plasmid preparation kits (5 Prime-3 Prime, Boulder, CO).
Mutagenesis.
GRE5 was mutated in
plasmid p
2AR(
3129/+126) using the
oligonucleotide gaaagaataagctcacccggacacgc and the GeneEditor in
vitro site-directed mutagenesis system (Promega). The resulting
mutant, p
2ARm1(
3129/+126), replaced the
guanine at position +6 of GRE5 with an
adenine. The mutation was confirmed by dideoxy sequencing (Sanger
et al., 1977
). The identity between the remainder of
p
2AR(
3129/+126) and
p
2ARm1(
3129/+126) was confirmed by
restriction site analysis.
Polymerase chain reaction.
The relatively short segment
(
831 to
708) in the
2AR gene containing
three putative GREs was amplified from rat genomic DNA using a
Perkin-Elmer model 480 thermal cycler (Norwalk, CT) and
2AR gene-specific primers. The primers were
5'-catatacccgggcgaagttactgccttggtgcggttg-3' (sense) and
5'-catatacccgggggcaagaacacaggaggtgactc-3' (antisense). Each primer was
synthesized with a XmaI site to facilitate cloning of the
amplified product into pT81LUC. The reaction mixture included 0.5 µg
of rat genomic DNA, 0.5 pmol of each primer, 0.2 mM
deoxynucleoside triphosphates, 1.5 mM
MgCl2, and 2.5 units of Thermus
aquaticus DNA polymerase (Promega). A 5-min hot start at 94° was
used, followed by 30 cycles of 94° for 1 min and 66° for 1 min and
then a final single cycle of 72° for 7 min.
Transient transfections.
HepG2 cells were transfected by
calcium phosphate coprecipitation in 60-mm dishes, as described
previously (Chen and Okayama, 1987
). For experiments in which
dexamethasone-stimulated promoter activity in different 5'-deletion
constructs was tested, subconfluent cells in Dulbecco's modified Eagle
medium with 10% fetal bovine serum that had been stripped of steroids
were transfected with 0.38 pmol of the
2AR-luciferase fusion genes, 2 µg of
pRSV
gal, 1 µg of pRShGR
, and pGEM-7Zf(
) to adjust the amount
of total DNA in each dish to 8.33 µg. HepG2 cells were co-transfected
with pRShGR
, a human glucocorticoid receptor expression vector
(Brasier et al., 1990
), because replicating cells can be
deficient in trans-acting factors such as the glucocorticoid
receptor (Johnson, 1990
). Cells were exposed to precipitates overnight
and the medium was changed. Either vehicle or dexamethasone (final
concentration, 0.1 µM) was added 24 hr after
transfection, and cells were harvested after an 8-hr incubation. After
harvesting, cell lysates were prepared and assayed for luciferase using
the Promega luciferase assay system or for
-galactosidase using the
Galacto-Light system (TROPIX, Bedford, MA), with a Monolight model 2010 luminometer (Analytical Luminescence Laboratory, Ann Arbor, MI). For
experiments in which the ability of putative
2AR GREs to enhance the activity of a heterologous promoter in the presence of dexamethasone was assessed, the dual-luciferase reporter assay system (Promega) was used as described above, except that pRSV
gal was omitted from the
transfection mixture. In its place, pRL-SV40 encoding
Renilla luciferase was used as a measure of transfection efficiency.
Human recombinant glucocorticoid receptor and nuclear
extract preparation.
Human recombinant glucocorticoid
receptor was obtained from Affinity Bioreagents (Golden, CO). Nuclear
extracts were prepared essentially as previously described (Andrews and
Faller, 1991
). Except where otherwise noted, centrifugations were
performed in an Eppendorf model 5415C microfuge at maximum speed, at
room temperature. Approximately 106 to
107 HepG2 cells that had been transiently
transfected with pRShGR
were scraped into 1.5 ml of cold
phosphate-buffered saline, pH 7.4, and pelleted. Cells were resuspended
in 400 µl of buffer A (10 mM HEPES-KOH, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl
fluoride) at 4°. Cells were allowed to swell for 10 min, they were
vortex-mixed for 10 sec and then centrifuged for 10 sec, and the
supernatant was discarded. The pellet was resuspended in 20-50 µl of
buffer C (20 mM HEPES-KOH, pH 7.9, 25% glycerol,
420 mM NaCl, 1.5 mM
MgCl2, 0.2 mM EDTA, 0.5 mM dithiothreitol, 0.2 mM phenylmethylsulfonyl
fluoride) at 4° and incubated for 20 min. Cellular debris was removed
by centrifugation for 2 min at 4°, and the supernatant containing
DNA-binding proteins was stored at
70°. Nuclear extract protein
concentrations were determined (Bradford, 1976
) using bovine serum
albumin as the standard.
EMSAs.
Oligonucleotides were either commercially synthesized
(Bio-Synthesis, Inc., Lewisville, TX) or, in the case of
oligonucleotides containing the human tyrosine aminotransferase gene
GRE, were obtained from Affinity Bioreagents. The sequences of the
sense oligonucleotides only are shown in Table
1. Previously, glucocorticoid receptor
bound to a functional GRE in MMTV was shown to occupy no more than 30 bp of DNA (Nordeen et al., 1990
). Therefore, the oligonucleotides that we used in EMSAs included 35 nucleotides of
2AR gene sequence plus an additional five
nucleotides comprising a restriction site for subcloning of the
fragment. Complementary oligonucleotides in equimolar amounts were
heated to 100°, cooled overnight to 25°, divided into aliquots, and
stored at
20° before use. Double-stranded oligonucleotide probes
were end-labeled using T4 polynucleotide kinase and
[
-32P]ATP. Binding reactions were performed
in a 20-µl volume containing approximately 20,000 cpm of labeled
probe, 6-12 µg of nuclear extract or human recombinant
glucocorticoid receptor (Affinity Bioreagents), 20 mM
HEPES, pH 7.9, 60 mM KCl, 5 mM
MgCl2, 2 mM dithiothreitol, 10%
glycerol, 200 ng of poly(dI·dC), 1 µg of bovine serum albumin, and
unlabeled competitor oligonucleotides. The instructions provided by the
manufacturer were followed when the human recombinant glucocorticoid
receptor was used in EMSAs. The binding reaction mixtures were
incubated at 25° for 30 min and then loaded onto 6% nondenaturing
polyacrylamide gels in 25 mM Tris, pH 8.3, 25 mM boric acid, 0.5 mM EDTA. For supershift
experiments, incubations with polyclonal anti-human glucocorticoid
receptor antibody (Affinity Bioreagents) or preimmune antiserum
(diluted 1:500) were performed for 30 min at room temperature after
addition of radiolabeled GRE5 and nuclear
extract. Gels were dried and autoradiographed overnight at
70°,
using Fujifilm RX-Fuji medical X-ray film and intensifying screens.
|
| |
Results |
|---|
|
|
|---|
The
2AR gene.
In an earlier study, in addition
to correcting an error in the previously reported sequence of the rat
2AR gene (Buckland et al., 1990
),
we cloned an additional 1400 bp of 5'-flanking DNA (McGraw et
al., 1996
). Analysis of the known sequence of the rat
2AR gene yielded seven potential
glucocorticoid regulatory elements (Fig.
1A). Six of the potential GREs are
located upstream from the receptor open reading frame, whereas the
seventh GRE is located in the 3'-flanking region of the gene. Sequence
comparisons were made between the putative GREs in the
2AR gene and the consensus sequence for
previously demonstrated, positively modulated GREs. This consensus GRE
sequence arose from analysis of GRE-like elements in the following
genes: MMTV, Moloney murine sarcoma provirus, metallothionein IIa,
lysozyme, vitellogenin, growth hormone, uteroglobin, tyrosine
aminotransferase, tryptophan oxygenase, and acidic glycoprotein (Nordeen et al., 1990
) (Fig. 1B). In preliminary studies,
the putative GRE downstream from the receptor open reading frame was found to be nonfunctional (data not shown); therefore, we focused our
attention on the six GRE-like elements in the 5'-flanking region of the
gene. We have numbered these GRE sequences 1 through 6, with
GRE6 being the most proximal.
|
Transient transfections using
2AR promoter
truncations.
To first determine which regions of the
2AR 5'-flanking region are necessary for
glucocorticoid-mediated transcriptional activation, a series of six
5'-deletion fragments were fused to a luciferase reporter gene. Among
these fragments, p
2AR(
3129/+126) and
p
2AR(
2552/+126) contain all six putative
GREs, p
2AR(
1115/+126) contains the proximal
five putative GREs, p
2AR(
643/+126) contains GRE5 and GRE6, and
p
2AR(
152/+126) and
p
2AR(
62/+126) contain only the most proximal
GRE. To test the effect of dexamethasone on the expression of the
2AR-luciferase fusion genes, luciferase activity was determined in transfected HepG2 cells after incubation with either vehicle or 0.1 µM dexamethasone for 8 hr.
Results from preliminary experiments indicated that 8 hr was the
optimal time to observe dexamethasone responsiveness, because cell
viability decreased with longer exposures to dexamethasone (data not
shown). Fig. 2 depicts the results of
experiments in which progressively truncated
2AR-luciferase fusion genes transiently
transfected into HepG2 cells were tested for dexamethasone
responsiveness. Approximately 2-fold induction with dexamethasone
(compared with levels in the absence of added glucocorticoid) was
observed with p
2AR(
3129/+126),
p
2AR(
2552/+126), and
p
2AR(
1115/+126). This level of induction of
luciferase activity is similar to the 2-4-fold induction in
2AR levels that has been observed in the lung
after injection of rats with dexamethasone (McGraw et al.,
1995
) or after addition of glucocorticoids to cultured cells (Collins
et al., 1988
; Takahashi and Iizuka, 1991
; Dangel et
al., 1996
). With p
2AR(
643/+126), the
dexamethasone induction was approximately 1.3-fold. In contrast, no
dexamethasone effect was observed with p
2AR(
152/+126) or
p
2AR(
62/+126). As a positive control, we used N-600 prATLUC, a fusion gene containing a segment of the rat
angiotensinogen gene with two functional GREs coupled to a luciferase-encoding gene. In the presence of dexamethasone, expression of N-600 prATLUC was increased approximately 8-10-fold, consistent with the level of glucocorticoid induction previously demonstrated with
this fusion gene in HepG2 cells (Brasier et al., 1989
).
These results indicated that the region between positions
643 and
152 was necessary for dexamethasone induction of
2AR gene expression. This region contains a
single GRE (GRE5), which then became the focus of
additional experiments.
|
EMSAs using nuclear extracts. To determine whether nuclear transcription factors could indeed bind to GRE5, we performed EMSAs using a 35-bp double-stranded oligonucleotide that includes GRE5 and nuclear extracts prepared from HepG2 cells that had been treated with 0.1 µM dexamethasone for 8 hr. In preliminary experiments in which increasing amounts of HepG2 cell nuclear extracts were added to radiolabeled GRE5 probe, we determined that 6 µg of nuclear extract resulted in optimal levels of shifted product (data not shown). Incubation of radiolabeled GRE5 with HepG2 nuclear extracts resulted in a prominent shifted band (Fig. 3). The specificity of binding was confirmed by observing that the addition of increasing concentrations of unlabeled GRE5 displaced radiolabeled GRE5 in a dose-dependent manner, whereas the unlabeled random oligonucleotide did not suppress radiolabeled GRE5 binding (Fig. 3).
|
|
EMSAs using the human recombinant glucocorticoid receptor. We further characterized the ability of GRE5 to bind the glucocorticoid receptor in vitro using EMSAs with human recombinant glucocorticoid receptor and serial dilutions of competitor oligonucleotides. Radiolabeled GRE5 incubated with human recombinant glucocorticoid receptor resulted in a single shifted band (Fig. 5). Addition of increasing concentrations of unlabeled GRE5 displaced radiolabeled GRE5 in a dose-dependent manner (Fig. 5). In contrast, increasing concentrations of either unlabeled GRE1 or unlabeled mutant m1GRE5 (with a single nucleotide change in the core sequence of GRE5) showed decreased ability to compete with radiolabeled GRE5 for binding to human recombinant glucocorticoid receptor (Fig. 5).
|
2AR gene) displaced radiolabeled
GRETAT from the human recombinant glucocorticoid
receptor in a dose-dependent manner (Fig. 6).
|
Transient transfections using a
2AR-luciferase
fusion gene with mutated GRE5.
To further test the
involvement of GRE5 in glucocorticoid regulation
of
2AR expression, a plasmid
[p
2ARm1(
3129/+126)] was constructed that
had been mutated at position +6 of GRE5
(gggtgagctgttct to gggtgagctattct). This
mutation, the same base change as in oligonucleotide
m1GRE5 (Table 1), is essential for glucocorticoid inducibility of a MMTV GRE (Nordeen et al., 1990
). Our
results demonstrated loss of glucocorticoid inducibility using
p
2ARm1(
3129/+126) (Fig.
7). Interestingly, in the absence of
added dexamethasone, the activity of
p
2ARm1(
3129/+126) was markedly lower than
that of p
2AR(
3129/+126) (Fig. 7). A possible
explanation is that basal expression of
p
2AR(
3129/+126) in HepG2 cells that
overexpress the glucocorticoid receptor is relatively high, despite
removal of glucocorticoids from the serum by charcoal stripping.
Alternatively, GRE5 contributes to the basal
activity of the
2AR gene promoter.
|
Transient transfections using putative GREs fused to a
heterologous promoter.
To further examine the functionality
of the putative GREs, fragments that contained either
GRE1, GRE5, or
GRE2 plus GRE3 and GRE4 together were fused to a luciferase
expression plasmid driven by a minimal TK promoter. An MMTV fragment
containing a functional GRE (Majors and Varmus, 1983
) cloned into
pT81LUC was used as a positive control. Approximately 4-fold induction
was observed with dexamethasone using the MMTV-pT81LUC fusion gene
(Fig. 8). Activity of
GRE5-pT81LUC was induced 3.2-fold in the presence of dexamethasone (Fig. 8), a value that was higher than that observed with any of the
2AR-luciferase fusion genes
that included GRE5. Activity of
GRE1-pT81LUC was not induced by dexamethasone
(Fig. 8). Transfection of HepG2 cells with the segment
831 to
708 (which contains GRE2, GRE3,
and GRE4) fused to pT81LUC resulted in luciferase
activity in either vehicle- or dexamethasone-treated cells that was
below the level of detection in the assay (Fig. 8). This result
suggests the presence of an element in the segment
831 to
708 of
the
2AR gene that negatively affects the
activity of the minimal TK promoter.
|
| |
Discussion |
|---|
|
|
|---|
Glucocorticoids increase
2AR expression
and
2-agonist-stimulated adenylyl cyclase
activity in a variety of tissues and cell types (Cheng et
al., 1980
; Norris et al., 1987
; Collins et
al., 1988
; Takahashi and Iizuka, 1991
; Zhong and Minneman, 1993
;
Dangel et al., 1996
). For most steroid hormone-responsive
genes, including those regulated by glucocorticoids, changes in the
level of expression induced by hormone are principally controlled by
changes in the rate of transcription of the target gene (Beato et
al., 1989
). These trans-activation effects are a result
of the glucocorticoid hormone-receptor complex interacting with GREs
within the target gene and thus acting as a transcription factor (Beato
et al., 1989
). In the case of the
2AR gene, the results of numerous studies suggest transcriptional regulation by glucocorticoids. Steady state
levels of
2AR mRNA in several cell lines and
tissues have been shown to be increased in the presence of
glucocorticoids (Collins et al., 1988
; Hadcock and Malbon,
1988
; Takahashi and Iizuka, 1991
; Zhong and Minneman, 1993
; Mak
et al., 1995
; Dangel et al., 1996
). The rate of
transcription of the
2AR gene has been shown,
by nuclear run-off transcription assays, to be increased by
glucocorticoids in both DDT1 MF-2 cells (Collins
et al., 1988
) and rat lung (Mak et al., 1995
).
In this study, the 5'-flanking region of the rat
2AR gene was isolated and used to prepare
2AR-luciferase fusion genes, as a means to
identify cis-acting elements that mediate the stimulatory effects of glucocorticoids on
2AR gene
expression. The HepG2 human liver cell line was chosen for these
studies because human hepatocytes are known to express the
2AR (Bevilacqua et al., 1987
) and
HepG2 cells were previously used to study glucocorticoid regulation of
angiotensinogen gene expression (Brasier et al., 1989
,
1990
). HepG2 cells are deficient in functional glucocorticoid receptors
(Brasier et al., 1990
); however, this deficiency enabled us
to investigate the role of glucocorticoids in the regulation of
2AR gene expression by performing
co-transfection with a glucocorticoid receptor-encoding expression plasmid.
Early reports demonstrated that, in rats, glucocorticoids decrease
2AR number and
-agonist-stimulated adenylyl
cyclase activity (Wolfe et al., 1976
; Chan et
al., 1979
). More recent evidence suggests that glucocorticoid
regulation of rat liver
2AR expression is age
dependent. Hepatic
2AR number, although
decreased in young rats, is actually increased in aged rats by
glucocorticoids (Slotkin et al., 1996
). To the best of our
knowledge, glucocorticoid regulation of the
2AR has not been studied in human liver.
However, our data clearly demonstrate that the HepG2 cell line is a
valid model system in which to study glucocorticoid regulation of
2AR gene expression.
Cloning of the rat
2AR gene (Buckland et
al., 1990
; Jiang and Kunos, 1995
; McGraw et al., 1996
)
has allowed investigation of the genetic elements involved in
glucocorticoid regulation of
2AR gene
expression. Indirect evidence obtained in an early study suggested that
the putative cis-acting elements were located in the
5'-flanking region of the
2AR gene (Malbon and
Hadcock, 1988
). Examination of the rat
2AR
gene sequence for known transcription factor binding sites indicated
that six potential GREs are located within the proximal 3.7 kilobases
of 5'-flanking DNA. In the transfection analyses using various
2AR-luciferase fusion genes, we were able to
demonstrate that dexamethasone responsiveness was mediated by a region
spanning nucleotides
643 to
152. Within this segment is a single
putative GRE, with the sequence gggtgagcttgttct (Fig. 1). This GRE,
designated GRE5, displays reasonable similarity to the consensus GRE sequence ggtacannntgttct (Beato et al.,
1989
). Approximately 2-fold induction with dexamethasone was observed with the longer
2AR-luciferase fusion gene
constructs that contained GRE5. This level of
induction was less than that observed with N-600 prATLUC. However, it
should be noted that numerous investigators have obtained similar
levels of induction (2-4-fold) with glucocorticoid administration, in
measurements of either receptor numbers, steady state mRNA levels, or
2AR gene transcription rates, in a variety of
cells and tissues (Norris et al., 1987
; Collins et
al., 1988
; Hadcock and Malbon, 1988
; Takahashi and Iizuka, 1991
;
Zhong and Minneman, 1993
; Mak et al., 1995
; Dangel et
al., 1996
). Therefore, the GRE that we have identified as lending
glucocorticoid responsiveness to
2AR gene
expression seems to be physiologically relevant.
The reason for the diminished responsiveness of the
2AR gene to glucocorticoid induction, compared
with that of other glucocorticoid-inducible genes such as N-600 prATLUC
(Brasier et al., 1989
), is unclear at this time. The limited
similarity of GRE5 to the consensus GRE (Fig. 1B)
suggests that the biological response of the
2AR gene to dexamethasone stimulation may be
related to the extent of homology to the consensus GRE. Of interest was
the observation that GRE5, when fused to a
luciferase expression vector driven by the basal TK promoter and
transiently transfected into HepG2 cells, resulted in 3.2-fold
induction of activity. This induction was similar to that obtained with
MMTV sequences cloned into pT81LUC. These results suggest either that
the
2AR promoter is a relatively weak
substrate for GRE enhancer activity, that the activity of GRE5 is constrained by sequences in the
5'-flanking region of the
2AR gene, or that
other segments of the
2AR gene that are missing from our reporter gene constructs are necessary for greater induction by glucocorticoids. In many genes, GREs have been
demonstrated to synergize with other transcription factor-binding
elements to increase gene activity. For example, a direct interaction
between interleukin-1-inducible NF
B binding to an acute-phase
response element and two flanking GREs has been demonstrated to
underlie the acute-phase activation of the angiotensinogen gene in rat liver (Ron et al., 1990
). Through recruitment of hepatic
nuclear factor 3, protein kinase A has been shown to modulate the
activity of a GRE in the rat tyrosine aminotransferase gene (Espinas
et al., 1995
) and phosphoenolpyruvate carboxykinase genes
(Wang et al., 1996
). Finally, widely spaced GREs have been
shown to be additive in stimulating glucocorticoid induction of the
tryptophan oxygenase gene in rat liver (Danesch et al.,
1987
).
The results from the EMSAs confirmed that GRE5 is
capable of binding nuclear proteins isolated from
glucocorticoid-treated HepG2 cells, as well as the human recombinant
glucocorticoid receptor. A double-stranded oligonucleotide containing
GRE5 and surrounding sequence bound a protein in
nuclear extracts prepared from glucocorticoid-treated HepG2 cells that
was immunologically identified as a glucocorticoid receptor. Moreover,
the same double-stranded oligonucleotide bound the human recombinant
glucocorticoid receptor. Interestingly, a single base change in
GRE5 greatly reduced the ability of the mutant
GRE (m1GRE5) to compete with radiolabeled
GRE5 for binding to the human recombinant
glucocorticoid receptor. This change (guanine to adenine in position +6
of the GRE) was previously shown to result in the complete loss of
glucocorticoid inducibility of a MMTV GRE fused to a luciferase
reporter gene (Nordeen et al., 1990
).
Glucocorticoids are important therapeutic agents used in the
treatment of asthma, but a small proportion of asthmatic patients are
resistant to the beneficial effects of glucocorticoids (Cypcar and
Busse, 1993
). The molecular mechanisms underlying this form of steroid
resistance remain unclear, although one of the beneficial effects of
using glucocorticoids to treat asthma is increased
2AR expression (Barnes, 1996
). Our EMSA
results demonstrated that a single nucleotide change in
GRE5 of the rat
2AR gene
resulted in a greatly diminished ability to bind the human recombinant glucocorticoid receptor. This same nucleotide change in
p
2AR(
3129/+126) resulted in a fusion gene,
p
2ARm1(
3123/+126), that was no longer inducible by dexamethasone, as determined in transient transfection assays. Interestingly, mutations in the regulatory DNA of the human
apolipoprotein (Suzuki et al., 1997
) and 5-lipoxygenase (In
et al., 1997
) genes have been shown to alter their
expression, although the functional significance is currently not
clear. The cis-acting elements in the human
2AR gene that mediate glucocorticoid responsiveness have not yet been identified. Nevertheless, the demonstration of steroid resistance in human patients, together with
our present findings regarding glucocorticoid regulation of
2AR gene expression, suggests that the
molecular basis for steroid resistance in a subset of asthmatic
patients could involve mutations in GREs in the
2AR gene.
| |
Acknowledgments |
|---|
We thank Dr. Peter Buckland (University of Wales,
Cardiff, UK) for contribution of the
2AR
genomic clone, Dr. K. Cameron Falkner for helpful advice on performing
supershift assays, and Dr. Patricia Wight for critical reading of the manuscript.
| |
Footnotes |
|---|
Received August 6, 1998; Accepted September 11, 1998
This work was supported in part by National Institutes of Health Grant R01-GM30669.
Send reprint requests to: Dr. Lawrence E. Cornett, Department of Physiology and Biophysics, Slot 750, University of Arkansas for Medical Sciences, 4301 West Markham Street, Little Rock, AR 72205. E-mail: cornettlawrencee{at}exchange.uams.edu
| |
Abbreviations |
|---|
AR, adrenergic receptor; GRE, glucocorticoid response element; EMSA, electrophoretic mobility shift assay; bp, base pair(s); MMTV, mouse mammary tumor virus; TK, thymidine kinase; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid.
| |
References |
|---|
|
|
|---|
1- and
2-adrenergic receptors in human liver.
Eur J Clin Invest
17:
330-335[Medline].
-adrenergic receptors in fetal rabbit.
Endocrinology
107:
1646-1648[Abstract].
2-Adrenergic receptors in hamster smooth muscle cells are transcriptionally regulated by glucocorticoids.
J Biol Chem
263:
9067-9070
-adrenoceptor density and mRNA levels in the rat heart cell-line H9c2.
Biochem J
317:
925-931.
2-adrenergic receptor: expression and promoter characterization.
Proc Natl Acad Sci USA
84:
6995-6999
-adrenergic receptors by "permissive" hormones: glucocorticoids increase steady-state levels of receptor mRNA.
Proc Natl Acad Sci USA
85:
8415-8419
2-adrenergic receptor gene in rat liver: the negative regulatory role of C/EBP
.
Biochemistry
35:
13136-13146[Medline].
2-adrenergic receptor.
Gene
163:
331-332[Medline].
2-adrenergic receptor and their putative promoter regions.
J Biol Chem
262:
7321-7327
2-adrenergic receptors in vivo.
J Clin Invest
96:
99-106.
2-adrenergic receptor gene are obligate for glucocorticoid regulation of receptor mRNA levels.
Biochem Biophys Res Commun
154:
676-681[Medline].
2-adrenergic receptor and its mRNA in the rat lung by dexamethasone.
Exp Lung Res
21:
535-546[Medline].
2-adrenergic receptor gene.
Biochim Biophys Acta
1305:
135-138[Medline].
-adrenergic receptors in the DDT1 MF-2 smooth muscle cell line involves synthesis of new receptor.
Mol Cell Biochem
74:
21-27[Medline].
2-adrenergic receptors in keratinocytes: glucocorticoids increase steady-state levels of receptor mRNA in foetal rat keratinizing epidermal cells (FRSK cells).
Br J Dermatol
124:
341-347[Medline].
-Adrenergic receptors in rat liver: effects of adrenalectomy.
Proc Natl Acad Sci USA
73:
1343-1347
1- and
2-adrenergic receptors by dexamethasone in C6 glioma cells: effects on catecholamine responsiveness.
Mol Pharmacol
44:
1085-1093[Abstract].
This article has been cited by other articles:
![]() |
R. Wadhawan, Y.-T. Tseng, J. Stabila, B. McGonnigal, S. Sarkar, and J. Padbury Regulation of cardiac beta 1-adrenergic receptor transcription during the developmental transition Am J Physiol Heart Circ Physiol, June 1, 2003; 284(6): H2146 - H2152. [Abstract] [Full Text] [PDF] |
||||
![]() |
|