|
|
|
|
Vol. 55, Issue 1, 14-22, January 1999
Department of Biochemistry, University of Adelaide, Adelaide, South Australia
| |
Summary |
|---|
|
|
|---|
We previously identified in the chicken CYP2H1 gene an
upstream enhancer domain (
5900/
1100) that responds to
phenobarbital. Deletion and restriction enzyme analyses of this domain
have now identified two separate enhancer regions that respond to
phenobarbital (from
5900 to
4550 and from
1956 to
1400). We
have focused here on the latter and in particular a resident 240-base
pair (bp) restriction enzyme fragment that retains drug responsiveness. Using deletion analysis and in vitro DNase I footprinting,
transcription factor binding sites have been located in the 240-bp
fragment. The sites identified are an E-box-like element, a consensus
hepatocyte nuclear factor 1 site, a CCAAT box motif, and a novel site.
Mutagenesis demonstrated that each site contributed to enhancer
activity, although there was a weaker contribution from the CCAAT box,
and that no individual site was critical for responsiveness. In keeping with the tissue-restricted expression of the CYP2H1
gene, gel shift experiments established that the proteins binding to
these enhancer sites are enriched in chicken liver, kidney, and small intestine. In vitro footprint experiments showed a stronger protection with liver nuclear extracts from drug-treated chickens compared with
control extracts on the E-box-like element, the CCAAT box motif, and
the novel binding site; however, the basis for this apparent increase
in binding remains to be determined. The proteins binding to the 240-bp
fragment are different from those recently reported to be required for
the activity of the phenobarbital responsive enhancer domains of rodent
CYP2 genes.
| |
Introduction |
|---|
|
|
|---|
Cytochrome
P-450s (P450s) compose a large superfamily of heme
proteins; many are key detoxification enzymes that catalyze the first
step in a biotransformation process (Gonzalez, 1990
; Denison and
Whitlock, 1995
). In this process, foreign chemicals are oxidized by
specific microsomal P450s to forms that can be either excreted directly
from the body or further modified by conjugating enzymes before
excretion. The synthesis of specific P450 isozymes can be selectively
induced, notably in the liver, by different classes of foreign
chemicals; this makes biological sense, because the inducers are
generally substrates for the induced P450s (Gonzalez, 1990
; Okey,
1990
).
The sedative drug phenobarbital, one of the best-known inducers,
increases the transcription of specific CYP genes in
mammals (Waxman and Azaroff, 1992
), chickens (Mattschoss et al.,
1986
; Hansen et al., 1989
; Dogra et al., 1998
) and also in bacteria such as Bacillus megaterium (He and Fulco, 1991
; Shaw et
al., 1998
). The molecular details underlying the phenobarbital
induction mechanism in rodents are under investigation; DNA binding
proteins associated with upstream drug-responsive enhancer regions have been reported recently for the drug-inducible rat CYP2B1/2
(Trottier et al., 1995
; Kim and Kemper, 1997
; Stoltz et al., 1998
) and
mouse CYP2b10 (Honkakoski and Negishi, 1997
; Honkakoski et
al., 1998
) genes. The involvement of a receptor protein that binds
phenobarbital is attractive (Waxman and Azaroff, 1992
), but none of the
DNA binding proteins identified to date seems to fulfill this function. By contrast, well characterized, ligand-dependent nuclear receptors have been identified that mediate the response of specific
CYP genes and other target genes to both polycyclic aromatic
hydrocarbons (Burbach et al., 1992
; Denison and Whitlock, 1995
) and
peroxisome proliferators (Issemann and Green, 1990
). Recently, a
receptor was identified that activated expression of the
CYP3A gene family in response to
pregnenolone-16
-carbonitrile (Kliewer et al., 1998
).
Genes for phenobarbital-inducible P450 in chicken have been isolated
(Mattschoss et al., 1986
). We are investigating the chicken CYP2H1 gene, which is markedly induced in a tissue-specific
fashion (Hansen et al., 1989
). Transient expression studies in cultured chick embryo hepatocytes have identified both an upstream enhancer domain, located between
5900 and
1100, that responds to
phenobarbital (Hahn et al., 1991
) and a proximal promoter region
of 160 base pairs (bp) that binds multiple liver-enriched transcription
factors and directs basal expression but does not respond to
phenobarbital (Dogra and May, 1997
).
One important issue concerns the role of the upstream enhancer domain of the CYP2H1 gene in the induction mechanism and its relationship to the rodent enhancers. In this article, we have analyzed the CYP2H1 domain and identified a region that responds to phenobarbital. We have characterized, by in vitro footprinting and gel shift analysis, the transcription factors that bind to the region and discuss the implications of our findings on the mechanism of phenobarbital induction of CYP genes in eukaryotes.
| |
Materials and Methods |
|---|
|
|
|---|
Plasmid Constructions.
To locate the
phenobarbital-responsive region in the 4.8-kilobase (kb)
BamHI enhancer domain, BamHI (
5900 to
1100), BglII/XhoI (
1956 to
1400),
BglII/StuI (
1956 to
1640), and
StuI/XhoI (
1640 to
1400) fragments
were blunt-ended and cloned in the EcoRV site of the
pBCSVp1 vector. This vector has been described (Clark et al., 1989
) and
contains the simian virus 40 (SV40) enhancerless promoter fused to the
chloramphenicol acetyltransferase (CAT) gene. The chimeric
enhancer-pBCSVp1 vectors, containing the 4.8-kb BamHI
fragment in the forward orientation (p4.8-SVCAT) and the 556-bp
BglII/XhoI fragment in the reverse
orientation (pR556-SVCAT), were used to generate enhancer deletion
constructs. These two vectors were digested with KpnI
and SalI; progressive unidirectional deletions from the
SalI end were created using an erase-a-base kit
(Promega, Madison, WI). Deletion constructs from p4.8-SVCAT retained
4.1, 3.1, 1.9, and 0.8 kb of the 4.8-kb enhancer in the pBCSVp1 vector,
whereas deletion constructs generated from pR556-SVCAT retained 205, 158, 141, 80, and 15 bp of the 240-bp enhancer region. From the 4.8-kb
domain, other constructs were prepared that contained restriction
enzyme fragments: pR1-SVCAT vector
(BamHI/XbaI), pR2-SVCAT (XbaI/XbaI), and pR3-SVCAT
(BglII/BglII) as shown in Fig 2A. These fragments were blunt-ended and cloned into the EcoRV
site of pBCSVp1 vector upstream of SVCAT. All constructs were verified
by restriction mapping and DNA sequence analysis.
Site-Directed Mutagenesis of the 556-bp Fragment.
The 556-bp
enhancer fragment was blunt-ended and cloned into the pBluescript
KS+ vector in the EcoRV site in the reverse
(XhoI/BglII) orientation. This construct
(pR556-KS) was used as a template for site-directed mutagenesis using
the Quick Change mutagenesis kit (Stratagene, La Jolla, CA). Mutations
were introduced in the DNase I footprinted regions and
confirmed by sequencing. The mutated fragments were then released from
pR556-KS by digestion with KpnI/SmaI and
cloned into pBCSVp1 at the corresponding sites to generate mutated
enhancer CAT plasmids. The primers used are as follows, with mutations shown as underlined letters: mFP1
61
GGCATTTCTGCAATGAGCTCAATCACCTGA
32;
mFP2
113
GGGAGTTCAGACCTGCAGATTTAACCAAAC
84;
mFP3
170
GAGAGCAGTTATGAATTCGGCCTGGTCCTG
141;
mFP4
221
TTCAGAGACCGTCTAGATACATAGCAATCT
192.
Cell Culture and Transfection.
Primary hepatocytes were
prepared from 17-day-old chick embryos (Hahn et al., 1991
). For
transfection experiments, plasmid DNA was prepared by alkaline lysis
and CsCl/ethidium bromide equilibrium density gradients and quantified
by spectrophotometry. Transfection of DNA into primary hepatocytes
(2 × 107 per 0.8 ml) was performed by electroporation
as described previously (Dogra and May, 1997
). After transfection, each
sample was split so that approximately 1 × 107 cells
were plated onto 60-mm dishes and cultured in William's E medium plus
10% Serum Supreme (Edward Keller, Melbourne, Australia). In
early experiments, Nu serum (Flow Laboratories, North Ryde, NSW,
Australia) at 10% was used instead of Serum Supreme.
Hepatocytes were incubated at 37°C for 24 h, after which media
were changed; to one of the two plates, 25 µl of phenobarbital
solution in phosphate-buffered saline (PBS) was added to a final
concentration of 500 µM. The cultures were further incubated for
48 h and then CAT activities were determined.
CAT Assay.
Transfected cells were harvested in 40 mM
Tris·HCl, pH 7.5, containing 1 mM EDTA and 150 mM NaCl, by scraping
with a rubber policeman. The cells were pelleted and resuspended in 50 to 100 µl of 250 mM Tris·HCl, pH 7.6, lysed by three cycles of
freezing and thawing, and centrifuged for 5 min to remove cell debris. The protein concentration of each sample was determined by protein microassay (Bio-Rad, Hercules, CA). For CAT assays, the cell
supernatant was heated at 65°C for 6 to 8 min to remove deacetylase
activity and CAT activity was then determined (Gorman et al., 1982
).
The acetylated products of [14C]chloramphenicol were
separated by thin-layer chromatography. After autoradiography, CAT
activity was quantified by cutting out the spots from the plate and
measuring the radioactivity in a scintillation counter. The results
were expressed as a percentage of acetylated chloramphenicol.
In Vitro DNase I Footprinting.
For DNase I footprint assays,
two separate preparations of nuclear extracts were prepared (Gorski et
al., 1986
) and tested from the livers of two 8-week old chickens that
were untreated or i.p. injected with phenobarbital (40 mg/kg b.wt. in
0.5 ml of dimethyl sulfoxide) in the morning and evening the day before sacrifice. The StuI/XhoI 240-bp fragment
(
1640 to
1400) was blunt-ended and cloned in both orientations into
the EcoRV site of pBCSVp1. For footprinting,
KpnI/EcoRI fragments, representing the
5'-to-3' and 3'-to-5' directions of the 240-bp fragment, were obtained,
radiolabeled by end-filling with
[
-32P]deoxy-ATP using Klenow enzyme and
purified by polyacrylamide gel electrophoresis. The DNase I
footprinting reaction consisted of the following components in a final
volume of 50 µl: 20 mM HEPES, pH 7.9, with 60 mM KCl, 60 mM EDTA, 0.6 mM dithiothreitol, 2 mM spermidine, 10% glycerol, 1 to 2 µg of
poly(dI-dC), and 40 µg of nuclear protein extract from chicken liver.
After incubation on ice for 10 min, the probe (25,000 cpm) was added
and incubation was continued at 25°C for an additional 20 min. DNase
I digestion and purification of the DNA was adapted from a method
reported previously (Cereghini et al., 1987
). In DNase I competition
experiments, assays were performed with unlabeled competitor
oligonucleotide at 2- and 10-ng concentrations in the binding
reaction. The DNA products were analyzed on an 8% polyacrylamide
sequencing gel. Fragments partially cleaved by G + A reactions were run
as markers (Maxam and Gilbert, 1980
). The DNase I digestion
pattern in the absence of nuclear extracts was obtained using
one-tenth as much DNase I in the reaction as in the presence of nuclear
extract (0.05-0.1 U).
Gel Mobility Shift Assay.
Nuclear extracts used in gel
mobility shift assays were prepared from chick embryo primary
hepatocytes either untreated or treated with phenobarbital at 500 µM
final concentration (Dogra and May, 1997
). Nuclear extracts were also
prepared (Schreiber et al., 1989
) from the liver, kidney, small
intestine, lung, and heart of 8-week-old chickens that were untreated
or treated with an i.p. injection of phenobarbital (at 40 mg/kg b.wt.
in 0.5 ml of dimethyl sulfoxide) in the morning and evening the day
before they were they were sacrificed.
-32P]deoxy-ATP and
[
-32P]deoxy-CTP using Klenow enzyme. Binding
reactions and the procedures for gel shift analysis were carried out as
described previously (Dogra and May, 1997| |
Results |
|---|
|
|
|---|
Progressive Deletion of the CYP2H1 5' Flanking
Region.
In a previous study, CAT reporter gene constructs
containing 0.5 to 8.9 kb of 5' flanking sequence of the chicken
CYP2H1 gene were transiently expressed in chick embryo
hepatocytes (Hahn et al., 1991
). Maximal phenobarbital induction was
observed with 8.9 kb of 5' flanking sequence; inducibility was lost
when this was reduced to 1.1 kb (Hahn et al., 1991
). Removal of a
4.8-kb BamHI fragment (
5900 to
1100) from within the
8.9-kb sequence completely eliminated the drug response. This 4.8-kb
fragment was subsequently shown to behave as a drug-responsive enhancer and to markedly increase the expression of the weak enhancerless SV40
promoter in transfected chick embryo hepatocytes (Hahn et al., 1991
).
Deletion analysis has now been used to locate drug-responsive regions
within the 4.8-kb enhancer. 5'-End deletions of the 4.8-kb enhancer
fused to the SV40 promoter/CAT reporter plasmid were introduced into
chick embryo hepatocytes. As shown in Fig.
1, progressive deletions from
4.8 to
0.8 kb (i.e.,
5900 to
1900) did not substantially alter basal
levels of CAT activity, but drug induction was reduced from about
7-fold (p4.8-SVCAT) to a final level of about 2-fold (p0.8-SVCAT). We
also tested a 556-bp BglII/XhoI
restriction enzyme fragment located near the 3' end of the 4.8-kb
enhancer (
1956/
1400). This fragment (p556-SVCAT) conferred about a
3-fold increase in the level of drug induction and a similar result was
obtained with the fragment in the reverse orientation in pR556-SVCAT
(Fig. 1).
|
5900/
4550 in pR1-SVCAT) induced CAT activity by
5.8-fold, whereas the other two fragments, R2 (
4550/
3760) and R3
(
3260/
2480), did not show any response to phenobarbital. These
results demonstrated that there are two independent drug responsive
regions in the 4.8-kb enhancer domain. By comparison with the deletion
data in Fig. 1, it seems that the phenobarbital response observed with
p3.1-SVCAT and p1.9-SVCAT is mainly contributed by the 556-bp enhancer
region in p556-SVCAT.
|
1956 to
1640) and a
240-bp StuI/XhoI fragment (
1640 to
1400);
each was inserted into the expression plasmid pBCSVp1 in both
orientations. Although the 556-bp region gave a 6.7-fold level of drug
induction, the 240-bp fragment in either orientation resulted in a 2- to 3-fold increase (Fig. 2B, last two constructs), and the 316-bp
fragment did not respond to phenobarbital in either orientation (data
not shown). Hence, the 240-bp fragment contains sequence(s) responsive
to phenobarbital, whereas another sequence(s) in the 316-bp fragment
stimulates the level of this response.
The 240-bp fragment within the 556-bp enhancer was more precisely
mapped by 5' deletion analysis using the pR556-SVCAT plasmid (Fig. 2B).
Deletion of sequence from
1400 to
1435 bp did not affect the
response to phenobarbital (data not shown), but deleting the sequence
to
1482 resulted in a diminished level of induction (6.7- to
4.5-fold). Reduction to
1499 further lowered induced activity (to
3-fold), whereas continued deletion to
1560 substantially lowered
induction. Essentially no induction was observed with the
1625
deletion construct. These data indicate that multiple regulatory
elements located from
1435 to
1625 contribute to drug
responsiveness. Computer sequence analysis of the 240-bp fragment
revealed a number of possible binding sites: a CCAAT box binding site
at
208/
204 for either CCAAT/enhancer-binding protein (C/EBP)
(Landschulz et al., 1988
186/
181, two AP1 sites at
142/
136
and
43/
37, an H4TF2 site (Dailey et al. 1988
119/
115, a
site for the liver-enriched hepatocyte nuclear factor (HNF5) (Grange et
al., 1991
96/
90, and two E-box-like elements (Lassar et al.,
1989
47/
42 and
38/
33 (Fig.
3). We identified no sequence with
similarity to the Barbie box element implicated in the phenobarbital
mechanism in bacteria (He and Fulco, 1991
|
DNase I Footprint Analysis of the 240-bp Fragment.
Protein
binding sites in the 240-bp fragment were investigated by in vitro
DNase I footprint analysis using nuclear extracts prepared from the
livers of phenobarbital-treated and control chickens. Four separate
protected regions (A-D) were detected on both strands (Fig.
4A). Whereas region A (
60 to
43) was
very weakly protected with control nuclear extracts, strong protection was observed with extracts from drug-treated livers. This region contained one of the two E-box-like sequences (see Fig. 3). Region B
(
104 to
80) was protected by nuclear extracts from both
phenobarbital-treated and control livers and, as shown in Fig. 3,
encompassed a possible binding site for HNF5 (Grange et al. 1991
).
Footprint C (
160 to
148), as with footprint A, was substantially
stronger with extracts from phenobarbital-treated liver. Computer
sequence analysis, however, did not reveal a binding site in region C
for any known transcription factor. The protection of footprint D
(
208 to
197) was slightly greater with extracts from drug-treated
livers; this region contained a possible CCAAT box motif. It was noted
that with nuclear extracts from drug-treated livers, there was no
extension of the footprint pattern on any of the regions compared with
control extracts. No footprint was detected over the putative Sp1, AP1, or H4TF2 sites.
|
Functional Role of the Protein Binding Sites. To evaluate the function of the protein binding sites identified from footprinting the 240-bp fragment, the sites were mutated singly or in combination in pR556-SVCAT (Fig. 5). The expression of CAT activity by wild-type pR556-SVCAT was increased 6.9-fold in the presence of phenobarbital. Mutagenesis of the E-box motif in footprint region A (5'-CACCTG-3' to 5'-GAGCTC-3') substantially decreased enhancer activity to 3.1-fold. Footprint region B was mutated at two different sites. The first mutation, located at the 3' end of the footprint (5'-ACCAAA-3' to 5'-GAGCTC-3'), did not affect enhancer activity (result not shown). A second mutation (5'-ACAAAT-3' to 5'-CTGCAG-3'), which altered the first base of the putative HNF5-binding site (T to G), significantly lowered enhancer activity to 2.8-fold (Fig. 5). Mutagenesis of footprint region C (5'-GTCAGT-3' to 5'-GAATTC-3') also decreased enhancer activity to 2.9-fold, whereas alteration of footprint region D sequence (5'-AGCCAA-3' to 5'-TCTAGA-3') encompassing the putative C/EBP/NF1 site only moderately reduced enhancer activity (5.2-fold). When regions A and C (or regions B and D) were mutated in combination (Fig. 5), drug induction was substantially reduced, although some residual activity remained (1.7-2.0-fold). Also when regions B, C, and D were mutated together, enhancer activity was almost completely lost (Fig. 5). These mutagenesis results established that all four protein binding sites identified by footprinting are required for maximal enhancer activity of the 556-bp enhancer region and that no single binding site is critically required.
|
Gel Mobility Shift Analysis of the Footprinted Regions.
Gel
mobility shift assays were used to characterize the proteins that bound
to the footprinted regions. Double-stranded oligonucleotides (FP1-FP4)
corresponding to the protected regions A to D were used in binding
reactions with nuclear extracts prepared from untreated chick embryo
hepatocytes and from phenobarbital-induced hepatocytes (Dogra and May,
1997
). The mutated oligonucleotides for FP1-FP4 (mFP1-mFP4) were also
used; they contained the same mutations that were tested in the
functional assay of the 556-bp enhancer (see Fig. 5) and in the
competitive DNase I footprint experiments (see Fig. 4B).
|
96/
90 (5'-TATTTAA-3') lies
within a possible HNF1-binding site
(5'-TGGTTAAATATTTGTG-3') located on the negative strand and
was not identified by computer sequence analysis as shown in Fig. 3.
Therefore, competition experiments were also carried out with an
oligonucleotide containing the functional HNF1 site from the rat
albumin promoter (Cereghini et al., 1987
and HNF1
isoforms (Rey-Campos et
al., 1991
|
|
|
|
| |
Discussion |
|---|
|
|
|---|
We have characterized a 556-bp enhancer sequence (
1956/
1400)
in the chicken CYP2H1 5' flanking region that responds to
phenobarbital in transiently transfected chick embryo hepatocytes. This
sequence has been analyzed by dissection into two restriction enzyme
fragments; a 240-bp fragment that responds to phenobarbital and
a 316-bp fragment that increases the drug response but does not itself respond to drug. Deletion analysis of the 240-bp sequence (performed within the 556-bp enhancer) showed that several regions contributed to
drug responsiveness; DNase I protection assays using liver nuclear
extracts from phenobarbital-induced chickens identified four protected
regions (A-D). Sequence analysis and gel shift assays indicated that
footprint region A binds a member of the E-box family of transcription
factors, possibly USF or a related protein (Sawadogo and Roeder, 1985
).
Footprint region B binds members of the HNF1 family (Rey-Campos et al.,
1991
; Dogra and May, 1997
), whereas footprint region D binds a CCAAT
box-binding protein that is possibly related to C/EBP but that is not
NF1. Sequence within region C did not match any known transcription factor-binding site, and the three major protein complexes that bound
to this novel region have yet to be characterized. Site-directed mutagenesis of the protein binding sites in regions A to D and transient expression studies established that inactivation of a single
site or two sites together (A and C or B and D) reduced but did not
abolish induction by the 556-bp enhancer, whereas mutagenesis of
multiple sites (B, C, and D) resulted in almost complete loss of
induction. These findings demonstrated that the sites (A-D) are all
necessary for maximal induction and that no site alone is critical. In
vitro footprint analysis of the 316-bp fragment has revealed binding
sites for HNF1 and HNF4 transcription factors. The data therefore shows
that more than one element in the 556-bp enhancer is required for drug
response; the other elements contribute to the increased level of
induction but are not drug responsive.
A promoter-located 17-bp Barbie box sequence has been implicated in the
phenobarbital-mediated induction of the bacteria CYP102 and
CYP106 genes (He and Fulco, 1991
; Shaw and Fulco, 1993
) and also in the induction of the rat CYP2B1 gene (Prabhu et al.,
1995
). However, inactivation of the corresponding site in the promoter of the rat CYP2B2 gene (Trottier et al., 1995
; Park et al.,
1996
; Stoltz et al., 1998
) and mouse Cyp2b10 gene
(Honkakoski and Negishi, 1997
) did not affect drug induction. Moreover,
recent evidence suggests that the Barbie box of the bacterial
CYP106 gene may not be required for barbiturate-mediated
induction (Shaw et al., 1998
). In the present work, a Barbie
box was not identified in the 556-bp enhancer or the promoter (Dogra
and May, 1997
) of the CYP2H1 gene. This sequence is also
absent from the recently reported upstream phenobarbital-responsive
enhancer regions of the mouse Cyp2b10 gene (Honkakoski and
Negishi, 1997
) and rat CYP2B1/2 genes (Park et al., 1996
;
Stoltz et al., 1998
). Overall, a general role for the Barbie box in the
drug induction mechanism in both eukaryotes and prokaryotes seems unlikely.
The phenobarbital enhancer region for the Cyp2b10 gene
(Honkakoski and Negishi, 1997
) and CYP2B1/2 genes (Park et
al., 1996
; Kim and Kemper, 1997
; Stoltz et al., 1998
;) is located
upstream at approximately
2 kb. Multiple sites that contribute to
phenobarbital responsiveness have been identified by in vitro footprint
analysis and mutagenesis within the mouse 132-bp enhancer and the
corresponding rat enhancer region and include a putative
glucocorticoid-responsive element and an NF1 site (Honkakoski and
Negishi, 1997
; Stoltz et al., 1998
). There is evidence (Stolz et al.,
1998
) that phenobarbital responsiveness of the CYP2B2
enhancer is directed by interactions between multiple proteins on the
enhancer; as mentioned, a similar finding has been made in the present
study with the chicken CYP2H1 enhancer. A recent report has
defined a 51-bp element in the mouse 132-bp enhancer that independently
responds to phenobarbital and other phenobarbital-type inducers; this
element contains the NF1 site and is flanked by apparent novel nuclear
receptor binding sites composed of direct half sites with a spacing of
4 bp (Honkakoski et al., 1998
).
An important finding here is that the proteins that bind to the chicken
556-bp enhancer seem to have no counterparts on the rodent enhancers. A
sequence comparison of this region with the rodent enhancer sequences
did not reveal any common protein-binding sites, in particular a
glucocorticoidresponse element or novel nuclear receptor site. As
mentioned, there is a functional CCAAT box element, but this site binds
a protein complex that is possibly related to C/EBP rather than the
ubiquitously expressed NF1. The C/EBP related complex is particularly
enriched in nuclear extracts from chicken liver (and to a lesser extent
kidney and small intestine), tissue which is highly responsive to
phenobarbital (Hansen et al., 1989
), but is absent from extracts
of the nonresponsive lung and heart tissues. The other three
footprinted regions in the 240-bp fragment also bound proteins enriched
in the liver, kidney, and small intestine. As mentioned earlier, the
adjacent 316-bp fragment contains sites for the liver-enriched
transcription factors HNF1 and HNF4. Hence, tissue-restricted
expression of the CYP2H1 gene (Hansen et al., 1989
) is
likely to be directed by transcription factors that bind to the 556-bp
enhancer in addition to the early promoter, which has functional sites
for HNF1, HNF3, C/EBP, and USF (Dogra and May, 1997
).
In contrast to the enhancer regions of the rat CYP2B1/2
(Park et al., 1996
; Kim and Kemper, 1997
) and mouse CYP2b10
(Honkakoski and Negishi, 1997
) genes, in vitro footprint analysis of
the chicken 240-bp fragment revealed an increase in the binding of
nuclear proteins from drug-treated livers. This binding was probably
not due to an increase in the amount of these nuclear proteins in response to phenobarbital, because in the gel mobility shift studies, an increase in binding with drug-treated nuclear extracts was not
observed. In control experiments, the same nuclear extracts that
revealed increased binding on the 240-bp fragment did not show this
with the 316-bp fragment, eliminating the possibility that this is a
general effect (data not shown). The footprint data suggest that drug
action leads to increased binding on the 240-bp fragment through a
cooperative interaction between proteins. In keeping with this
proposal, footprint analysis using competitor oligonucleotides
corresponding to footprint regions A to D showed that depletion of one
binding protein could result in a weaker footprint on the other
regions. Currently under investigation is the possibility that, in the
presence of drug, one or more proteins are modified [for example by a
phosphorylation event (Dogra and May, 1996
], and that this results in
increased binding to the enhancer in a cooperative fashion.
In summary, we have identified and analyzed a drug-responsive, 556-bp enhancer region in the CYP2H1 gene. Maximum drug responsiveness is dependent upon binding of multiple proteins. Further analysis is required to identify precisely the proteins that bind, the way in which they interact and cooperate, and whether drug action leads to the modification of any of these proteins. In this regard, our analysis of various upstream restriction enzyme fragments located in the 4.8-kb enhancer domain of the CYP2H1 gene has revealed that, in addition to the 556-bp sequence, there is a second separate region that responds to drug to about the same extent as the 556-bp sequence. It will be interesting to identify the transcription factors that bind to this region. If it is proved that the transcriptional factors that activate the chicken and rodent phenobarbital-responsive enhancers are different, this would imply that either the induction mechanisms are fundamentally different or that there is an as yet undetermined common site of phenobarbital action that leads to the modification and activation of multiple transcription factors. Whether phenobarbital and the other phenobarbital-type inducers primarily mediate such action through direct binding to a specific receptor protein remains a key issue.
| |
Footnotes |
|---|
Received June 8, 1998; Accepted October 1, 1998
Send reprint requests to: Dr. Brian K. May, Department of Biochemistry, University of Adelaide, Adelaide, South Australia, Australia 5005. E-mail: bmay{at}biochem.adelaide.edu.au
| |
Abbreviations |
|---|
P450, cytochrome P-450; bp, base pair; kb, kilobase; CAT, chloramphenicol acetyltransferase; SV, simian virus 40; C/EBP, CCAAT/enhancer binding protein; HNF, hepatocyte nuclear factor; USF, upstream stimulatory factor; NF1, nuclear factor 1; PBS, phosphate-buffered saline.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Handschin and U. A. Meyer Induction of Drug Metabolism: The Role of Nuclear Receptors Pharmacol. Rev., December 1, 2003; 55(4): 649 - 673. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Dogra, D. Tremethick, and B. K. May Evidence That the Coactivator CBP/p300 Is Important for Phenobarbital-Induced but Not Basal Expression of the CYP2H1 Gene Mol. Pharmacol., January 1, 2003; 63(1): 73 - 80. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Handschin, M. Podvinec, R. Looser, R. Amherd, and U. A. Meyer Multiple Enhancer Units Mediate Drug Induction of CYP2H1 by Xenobiotic-Sensing Orphan Nuclear Receptor Chicken Xenobiotic Receptor Mol. Pharmacol., October 1, 2001; 60(4): 681 - 689. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Handschin, M. Podvinec, J. Stockli, K. Hoffmann, and U. A. Meyer Conservation of Signaling Pathways of Xenobiotic-Sensing Orphan Nuclear Receptors, Chicken Xenobiotic Receptor, Constitutive Androstane Receptor, and Pregnane X Receptor, from Birds to Humans Mol. Endocrinol., September 1, 2001; 15(9): 1571 - 1585. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Davidson, S. C. Dogra, and B. K. May The Antiglucocorticoid RU486 Inhibits Phenobarbital Induction of the Chicken CYP2H1 Gene in Primary Hepatocytes Mol. Pharmacol., August 1, 2001; 60(2): 274 - 281. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Handschin, M. Podvinec, and U. A. Meyer CXR, a chicken xenobiotic-sensing orphan nuclear receptor, is related to both mammalian pregnane X receptor (PXR) and constitutive androstane receptor (CAR) PNAS, September 26, 2000; 97(20): 10769 - 10774. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Handschin and U. A. Meyer A Conserved Nuclear Receptor Consensus Sequence (DR-4) Mediates Transcriptional Activation of the Chicken CYP2H1 Gene by Phenobarbital in a Hepatoma Cell Line J. Biol. Chem., April 28, 2000; 275(18): 13362 - 13369. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||