|
|
|
|
Vol. 55, Issue 6, 1037-1043, June 1999
Department of Pharmacology and Neuroscience, Ninewells Hospital and Medical School, The University of Dundee, Dundee, United Kingdom
| |
Summary |
|---|
|
|
|---|
The 5-hydroxytryptamine type 3 (5-HT3) receptor is a transmitter-gated ion channel mediating neuronal excitation. The receptor native to neurons, or as a homopentameric assembly of 5-HT3A receptor subunits, displays a species-dependent pharmacology exemplified by a 1800-fold difference in the potency of (+)-tubocurarine [(+)-Tc] as an antagonist of the current response mediated by mouse and human receptor orthologs. Here, we attempt to identify amino acid residues involved in binding (+)-Tc by use of chimeric and mutant 5-HT3A subunits of mouse and human expressed in Xenopus laevis oocytes. Replacement of the entire extracellular N-terminal domain of the mouse 5-HT3A (m5-HT3A) subunit by that of the human ortholog and vice versa exchanged the differential potency of (+)-Tc, demonstrating the ligand binding site to be contained wholly within this region. Mutagenesis of multiple amino acid residues within a putative binding domain that exchanged nonconserved residues between mouse and human receptors shifted the apparent affinity of (+)-Tc in a reciprocal manner. The magnitude of the shift increased with the number of residues (3, 5, or 7) exchanged, with septuple mutations of m5-HT3A and human 5-HT3A subunits producing a 161-fold decrease and 53-fold increase in the apparent affinity of (+)-Tc, respectively. The effect of point mutations was generally modest, the exception being m5-HT3A D206E, which produced a 9-fold decrease in apparent affinity. We conclude that multiple amino acids within a binding loop of human and mouse 5-HT3A subunits influence the potency of (+)-Tc.
| |
Introduction |
|---|
|
|
|---|
The
5-hydroxytryptamine type 3 (5-HT3) receptor is a
transmitter-gated, cation-selective ion channel containing
five transmembrane-spanning glycoprotein subunits (Derkach et al.,
1989
; Boess et al., 1995
). A 5-HT3 subunit,
termed 5-HT3A, has been identified by expression cloning from a murine hydridoma cell line cDNA library (Maricq et al.,
1991
). Subsequent homology screening has allowed the isolation of
splice variants and 5-HT3A subunit orthologs from
human (Belelli et al., 1995
; Miyake et al., 1995
), rat (Isenberg et
al., 1993
; Miyake et al., 1995
), and guinea pig (Lankiewicz et al.,
1998
) sources. Most recently, a novel 5-HT3B
subunit, capable of forming hetero-oligomeric complexes with the
5-HT3A subunit, has been identified (Davies et
al., 1999
).
Despite their highly conserved structure, 5-HT3A
subunit orthologs display distinctive pharmacological profiles that
closely reflect the interspecies variation in ligand binding described for neuronal 5-HT3 receptors (Peters et al.,
1997
). A striking example is provided by the nicotinic acetylcholine
receptor (AChR) antagonist (+)-tubocurarine [(+)-Tc], which binds to
native (pKi = 6.7-7.3; Bonhaus et al.,
1993
) or recombinant receptors (pKi = 6.7-7.1; Bonhaus et al., 1995
; Yan et al., 1999
) of mouse origin (m5-HT3A) with an affinity comparable with that
found for the high- affinity site formed at the interfaces of the
/
subunits of the Torpedo nicotinic AChR (Pedersen and
Cohen, 1990
) and the
/
and
/
subunits of the mammalian
skeletal muscle nicotinic AChR (Sine, 1993
; Papineni and Pedersen,
1997
; Bren and Sine, 1997
). In contrast, (+)-Tc demonstrates much lower
affinity at the human recombinant (h5-HT3A;
pKi = 4.4; Hope et al., 1996
) or native
(pKi = 4.8; Bufton et al., 1993
)
receptor isoforms.
Knowledge of the structural determinants of ligand binding at
5-HT3 receptors is limited. That the
extracellular N-terminal domain of the receptor imparts ligand binding
specificity is evident from studies on a chimeric construct of the
N-terminal domain of the nicotinic AChR
7 subunit and the residual
sequence of the m5-HT3A subunit (Eiselé et
al., 1993
). The chimera displayed nicotinic receptor pharmacology, but
the ion channel properties of the m5-HT3A
receptor. Oxidation of tryptophan residues within the
5-HT3 receptor reduces the binding of the
selective antagonist [3H]zacopride in a manner
that can be prevented by preincubation with some, but not all,
5-HT3 receptor ligands (Miquel et al., 1991
). For
the m5-HT3A subunit, the replacement of
individual tryptophan residues within the N-terminal domain by either
Tyr and/or Ser causes, with the exception of Trp-67, loss of ligand recognition and function (Spier et al., 1997
). Replacement of Trp-67 by
Tyr or Phe decreased the affinity of (+)-Tc, but also other
ligands, such as granisetron (Spier et al., 1997
; Yan et al., 1999
).
Interestingly, Trp occupies an homologous location in nicotinic AChR
7,
, and
subunits (i.e.,
7Trp-54,
Trp-55, and
Trp-57) and participates in the binding of (+)-Tc (O'Leary et
al., 1994
; Corringer et al., 1995
). However, Trp-67 and adjacent residues are conserved in all 5-HT3A subunit
orthologs, indicating that additional residues must be responsible for
the differential potency of (+)-Tc. Similarly, although mutation of
Glu-106 of the m5-HT3A subunit produces differing
effects upon the binding of several ligands (Boess et al., 1997
),
conservation of this residue and flanking sequences argues against
involvement in the differential affinity of (+)-Tc.
The window of selectivity between the binding of (+)-Tc at high
(i.e.,
/
or
/
) and low
(i.e.,
/
) affinity subunit interfaces of
the muscle nicotinic AChR has, via the construction of chimeras and
site-directed mutations, revealed residues that participate in (+)-Tc
binding (Pedersen and Cohen, 1990
; Sine, 1993
; Papineni and Pedersen,
1997
; Bren and Sine, 1997
). Here, we exploit the differential affinity
of (+)-Tc at m5-HT3A and
h5-HT3A receptors to identify residues that might
influence binding. We elected to quantify antagonism by (+)-Tc using an
electrophysiological assay of wild-type and mutant
5-HT3A subunits expressed in Xenopus laevis oocytes because of the robust difference
(i.e., ~1,850-fold) in the potency
of the antagonist at human and mouse 5-HT3A
receptors in this system (Hope et al., 1993
; Belelli et al., 1995
;
Peters et al., 1997
). Subunit chimeras wherein the N-terminal domains of human and mouse 5-HT3A receptor subunits were
exchanged reciprocally were constructed to verify that differences in
the potency of (+)-Tc are due wholly to binding in the extracellular
N-terminal region. By the construction of mutant receptors, we
demonstrate the reciprocal exchange of small numbers of residues
between human and mouse receptors to produce opposite effects upon the
potency of (+)-Tc.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials. (+)-Tubocurarine hydrochloride and 5-HT creatine sulfate complex were purchased from Sigma Chemical Co. (Poole, Dorset, UK). Oligonucleotides were synthesized by Cruachem Ltd. (Glasgow, Strathclyde, UK).
Construction of Chimeric 5-HT3 Receptor Subunits and
Mutagenesis.
Two chimeric 5-HT3 receptor
subunits containing human and mouse 5-HT3A
sequences were constructed using a polymerase chain reaction
(PCR)-based approach (Yon and Fried, 1989
). The chimeric receptor
subunit h218m 5-HT3A, where the number denotes
the position of the residue immediately amino terminal to the chimeric
junction, comprised the extracellular N-terminal domain of the
h5-HT3A subunit and the remaining sequence of the
m5-HT3A ortholog. The 5' and 3' ends of the h218m
5-HT3A chimera were defined by the
oligonucleotides H1 (CCGGAATTCCGGGGCCACGAGAGGCAG) and M1
(CCGCTCGAGAAGATATCATAGCATTTTTATT) containing
EcoRI and XhoI restriction sites
(underlined), respectively. The chimeric junction was
defined by a single large oligonucleotide C1
(ATGTGGTCATCCGCCGGCGGCCTTTATTCTATGCAGTCAG). Conversely, the amino- and
carboxy-terminal components of m223h 5-HT3A were
derived from the corresponding regions of m5-HT3A
and h5-HT3A, respectively. The 5' and 3' ends of
m223h 5-HT3A were defined by the oligonucleotides M2 (CCGGCTCGAGACATCTGGGAAGCTTGCCAT) and H2
(CCGGAATTCCAAAGTCCC) embodying an XhoI or
EcoRI site. The chimeric junction was defined by
oligonucleotide C2 (ACGTGATCATCCGCCGGAGGCCCCTCTTCTATGTGGTCAG). Both chimeric 5-HT3A subunits were amplified
using a 30-cycle PCR (denaturing, 95°C, 30 s; annealing, 65°C,
30 s; and extension, 75°C, 4 min). Each PCR contained 10 ng of
m5-HT3A and h5-HT3A cDNAs,
10 mM KCl 10, 10 mM
(NH4)2SO4,
20 mM Tris-Cl (pH 8.8), 2 mM MgSO4, 0.1% Triton
X-100, 100 µg ml
1 BSA, 200 µM each
dNTP and 2.5 U of plaque-forming unit polymerase. In both cases,
the outer (5' and 3') primers were present at a concentration of 1 µM, while the central oligonucleotide (C1 or C2) was present at 0.01 µM. h218m 5-HT3A and m223h
5-HT3A were cloned into pcDNA1amp (In Vitrogen
BV, NV Leek, The Netherlands) and Bluescript SK+ (Stratagene Ltd.,
Cambridge, UK) respectively, before expression in Xenopus
laevis oocytes.
Expression of Chimeras, Mutant Receptors, and
Electrophysiological Analysis.
Xenopus laevis ooctyes
were isolated and enzymatically defolliculated as previously described
(Hope et al., 1993
). cDNA (20 nl; 5-250 ng
µl
1) encoding chimeric or mutant
5-HT3A receptor subunits was injected into the
nucleus of Stage V-VI oocytes, which were subsequently stored
individually at 19-20°C for 2 to 10 days in 96-well microtiter plates in 200 µl of Barth's solution (composition 88 mM NaCl, 1 mM
KCl, 2.4 mM NaHCO3, 1 mM
MgSO4, 0.5 mM CaCl2, 0.5 mM
Ca(NO3)2, and 15 mM HEPES,
pH 7.5) supplemented with gentamicin (100 µg ml
1).
when measured in standard
extracellular solution (composition: 88 mM NaCl, 1 mM KCl, 2.4 mM
NaHCO3, 1 mM MgSO4, 0.5 mM
CaCl2, and HEPES 10, pH 7.5). Oocytes were held
in a Perspex (ICI Acrylics, Darwen, UK) chamber of 0.5 ml volume
and constantly superfused with extracellular solution at a rate of 8 to
10 ml min
1. All agonist and antagonist
compounds were applied via the superfusate. Antagonists were preapplied
for a period of 1 min before simultaneous application with agonist for
an additional 20 to 60 s. Currents evoked by 5-HT (at
EC50, see below) were recorded onto digital audiotape using a Biologic DAT recorder (Biologic Science Instruments, Claix, France) and displayed upon a chart recorder. All
recordings were conducted at ambient temperature (18-23°C).
In all experiments examining antagonism of agonist evoked currents by
(+)-tubocurarine, 5-HT was applied at the EC50
determined for the chimeric or mutant receptor under evaluation.
Agonist concentration response curves were iteratively fitted (Fig P. V6; BioSoft, Cambridge, UK) with the Hill equation:
|
|
|
|
| |
Results |
|---|
|
|
|---|
Mouse and Human 5-HT3A Subunit Chimeras.
Previous
studies examining the antagonist potency of (+)-Tc at
h5-HT3A and m5-HT3A
receptors expressed in Xenopus laevis oocytes yielded
IC50 values of 2.6 µM and 1.4 nM, respectively
(Hope et al., 1993
; Belelli et al., 1995
). To confirm that this large
differential is due exclusively to differences in primary amino acid
sequence residing within the extracellular N-terminal domain preceding the first transmembrane span, the chimeras m223h
5-HT3A and h218m 5-HT3A
were constructed and examined for sensitivity to block by (+)-Tc. At a
holding potential of
60 mV, both chimeric constructs mediated large
inward current responses to 5-HT applied at a half-maximally effective
concentration (EC50; Fig.
1). As anticipated from the close
similarity in the EC50 values for 5-HT at
wild-type m5-HT3A and
h5-HT3A subunits (Hope et al., 1993
; Belelli et
al., 1995
), the apparent affinity of 5-HT at either chimera was
unaltered (Table 1). In contrast, the concentration of (+)-Tc required to reduce the control response to 5-HT by 50% (i.e.,
IC50) at chimera m233h
5-HT3A was reduced by over 2200-fold relative to the wild-type h5-HT3A subunit (Table 1), such
that the concentration-inhibition curve shifted leftward to superimpose
upon that obtained for (+)-Tc acting at the wild-type
m5-HT3A subunit (Fig. 1). The converse result was
obtained for the h218m 5-HT3A subunit chimera,
where the IC50 for (+)-Tc was increased by over
1300-fold in comparison to the m5-HT3A subunit to
yield an inhibition curve that approximated closely to that found for
(+)-Tc at the wild-type h5-HT3A subunit. These
results indicate that the structural determinants of the discriminatory
potency of (+)-Tc are located entirely within the N-terminal domain.
|
Multiple Point Mutant m5-HT3A and h5-HT3A
Subunits.
Sequence alignment of 5-HT3A
subunit orthologs (Fig. 2) reveals a
cluster of nonconserved residues contained within a domain homologous
to ligand binding "loop" 3 (also termed "C") of certain nicotinic AChR (Galzi and Changeux, 1995
),
-aminobutyric acid type A
(Smith and Olsen, 1995
), and strychnine-sensitive glycine receptor
subunits (Rajendra et al., 1997
). In view of the fact that (+)-Tc is
known to photoaffinity label aromatic residues within loop 3 of
nicotinic AChR
-subunits, which stabilize the binding of the
antagonist (Sine et al., 1994
; Chiara and Cohen, 1997
), we focused upon
the homologous region of m5-HT3A and
h5-HT3A in subsequent mutagenesis experiments.
|
|
|
|
Single Point Mutant m5-HT3A Subunits. Table 2 summarizes the IC50 values for (+)-Tc obtained when the seven nonidentical amino acids within the putative loop 3 of the m5-HT3A subunit were individually mutated to the homologous residues of the h5-HT3A species ortholog. The mutations m5-HT3AK201R, I205 M, I207S, and I219V were associated with IC50 values for (+)-Tc that were essentially indistinguishable from that found for the wild-type m5-HT3A subunit. Very modest increases in IC50 (~2.5-3.0-fold) were obtained for m5-HT3AQ199Y and S210Y, whereas a substantial increment (~9-fold) was found for the D206E mutant.
| |
Discussion |
|---|
|
|
|---|
Domains contributing to the ligand binding sites of nicotinic
AChRs were initially identified by affinity labeling using derivatives of agonist and antagonist compounds. Such studies provided a valuable framework for subsequent molecular biological approaches employing chimeric and point mutant receptor subunits (reviewed in Galzi and
Changeux, 1995
). In the absence of similar information, we exploited
the species-dependent pharmacology of 5-HT3A
receptor subunits and sequence comparisons between subunits as an
attempt to delineate components of the ligand binding site.
(+)-Tc is a structurally rigid antagonist that displays a large
difference in potency across 5-HT3A subunit
orthologs (Peters et al., 1997
). One potential advantage in evaluating
this ligand is the existence of comparative information concerning
specific amino acid residues that influence the binding of (+)-Tc to
the interfaces formed between muscle nicotinic AChR subunits (Pedersen and Cohen, 1990
; O'Leary et al., 1994
; Sine, 1993
; Bren and
Sine, 1997
; Chiara and Cohen, 1997
). In the latter case, the binding of
(+)-Tc involves specific domains provided both by the
and non-
subunits, which have been termed the "principal" and
"complementary" components of the site respectively (Bertrand
and Changeux, 1995
). The structure activity relationships for
curariform antagonists at Torpedo and mouse nAChR
/
subunit interfaces and the m5-HT3A subunit are
broadly similar (Pedersen and Papineni, 1995
; Papineni and Pedersen,
1997
; Yan et al., 1998
), suggesting that the binding of (+)-Tc at the
5-HT3 receptor may also involve principal and complementary components provided, in this instance, by the opposite faces of adjacent, structurally identical, 5-HT3A
subunits. The results of the present study implicating loop 3 residues
("principal component") in the binding of (+)-Tc when combined with
data demonstrating an influence of Trp-67 ("complementary
component") upon antagonist binding (Yan et al., 1999
) support such a scheme.
Studies on native and recombinant 5-HT3 receptors
indicate that (+)-Tc acts in a manner consistent with competitive
antagonism (Higashi and Nishi, 1982
; Maricq et al., 1991
; Newberry et
al., 1991
; Hope et al., 1993
; Yan et al., 1998
). Indeed, as assessed by
computational chemistry, there is considerable structural congruence between (+)-Tc, 5-HT, and several 5-HT3
receptor-selective agonists (Aprison et al., 1996
). However, high
concentrations of (+)-Tc insurmountably antagonize electrical responses
mediated by 5-HT3 receptors endogenous to rabbit
(Higashi and Nishi, 1982
) and guinea pig (Newberry et al., 1991
)
neurons. By analogy to the muscle nAChR, such an action could
potentially be due to open channel blockade by (+)-Tc (Colquhoun et
al., 1979
). Thus, it was important to confirm that the differential
potency of (+)-Tc at mouse and human 5-HT3A
subunit orthologs is entirely due to differences in primary amino acid
sequence within the extracellular N-terminal domain. That this is so is
indicated by the results obtained with the chimeras m223h
5-HT3A and h218m 5-HT3A,
where the reciprocal exchange of the N-terminal domain was shown to
entirely account for the species dependent pharmacology of (+)-Tc.
We studied the domain homologous to loop 3 (or C) of nAChR
subunits
for several reasons. First, sequence alignment of the four orthologs of
the 5-HT3A subunit currently isolated identify this region as containing a particularly high incidence of unconserved residues relative to the remainder of the extracellular N-terminal domain (Fig. 2). Secondy, a chimeric construct of the human and guinea
pig 5-HT3A subunit orthologs reveals this region
to strongly contribute to a differential potency of 1-phenylbiguanide,
a 5-HT3 receptor-selective agonist, at the
wild-type subunits. Third, a tyrosine residue (Tyr-198) within
loop 3 of nAChR
subunits that is photoaffinity labeled by (+)-Tc
(Chiara and Cohen, 1997
) and that constitutes an important element of
the principal binding component (Sine, 1993
; O'Leary et al.,
1994
), is conserved in the 5-HT3A subunit (Fig. 2
and see below).
The substitution of amino acid residues from
m5-HT3A into h5-HT3A
sequence and vice versa caused qualitatively opposite changes in the
potency of (+)-Tc. By contrast, only very modest effects upon the
agonist potency of 5-HT were observed, militating against a nonspecific
effect of the mutations upon receptor structure or function. The
progressively larger shift in the IC50 of (+)-Tc associated with the triplet, quintuple, and septuple amino acid substitutions in loop 3 (Table 1) indicates that multiple nonconserved residues contribute to the differential potency of the antagonist at
mouse and human 5-HT3A receptor orthologs.
Furthermore, it is clear that additional residues located elsewhere
within the N-terminal domain must also be involved, because the
exchange of all seven nonconserved loop 3 amino acids between the
subunit orthologs is insufficient to completely convert the
IC50 for (+)-Tc to that of either the human (cf.
mutant 5) or mouse (cf. mutant 6) 5-HT3A subunit.
Moreover, such unidentified residues appear to contribute unequally to
the binding of (+)-Tc in the two subunit orthologs as evidenced by the
consistently smaller impact upon the IC50 of
(+)-Tc when homologous residues from the mouse are grafted into the
human subunit versus the converse exchange (compare mutants 1, 3, and 5 with mutants 2, 4, and 6). In this respect, domains of the
5-HT3A subunit that are homologous to the
complementary binding sites for (+)-Tc presented by vertebrate muscle
nicotinic AChR
/
(high affinity) and
(low affinity) subunits
are of interest, particularly because Trp-67, which is homologous to
7Trp-54,
Trp-55, and
Trp-57, participates in the binding of (+)-Tc (Spier et al., 1997
; Yan et al., 1999
). However, at loci corresponding to the critical residues identified in the nicotinic AChR
subunits [i.e., fetal receptor:
Ile-116/
Val-118;
Tyr-117/
Thr-119 (Sine, 1993
);
Ser-161/
Lys-163; adult
receptor:
Ile-58/
His-60; and
Asp-59/
Ala-61 (Bren and Sine,
1997
)] the primary sequence across 5-HT3A
subunit orthologs is invariant, or shows only a conservative
substitution (i.e., Phe/Tyr) that, in any event, does not
correlate with the apparent affinity of (+)-Tc.
The analysis of the contribution of individual residues suggests that,
in all but one instance, interactions with (+)-Tc are likely to be
indirect. Thus, the mutations m5-HT3A Q199Y,
K201R, I205M, I207S, S210Y, or I219V produce, at most, a 3-fold change in the blocking potency of (+)-Tc. Several of these exchanges conserve
gross physicochemical properties of the residue such as positive charge
(K201R) and aliphatic (I219V) character, whereas others are associated
with the incorporation of aromatic groups and a concomitant increase in
side chain volume (Q199Y and S210Y). It is noteworthy that there is
little conservation of these residues across the four orthologs of
5-HT3A subunit thus far identified (Fig. 2). In
contrast, in the case of the solitary mutation producing a substantial
increase in the IC50 of (+)-Tc (i.e.,
m5-HT3A D206E) Glu is the aligned residue in
nonmouse 5-HT3A subunits, all of which
demonstrate reduced affinity toward (+)-Tc. Interestingly, m5-HT3A Asp-206 aligns with Cys-193 of the
nicotinic AChR
-subunit which, along with Cys-192, Tyr-190, and
Tyr198, contributes to the loop 3 component of the principal nicotinic
binding site (Galzi and Changeux, 1995
; Bertrand and Changeux, 1995
).
There is considerable evidence that both Tyr-190 and Tyr-198 of the
muscle nicotinic AChR
-subunit act to stabilize the binding of the
curariform antagonist dimethyl-d-tubocurarine, principally through quaterary ammonium-aromatic interactions (O'Leary et al., 1994
; Sine et al., 1994
). An homologous tyrosine residue common to
human, mouse, and rat 5-HT3A subunits, or
phenylalanine in the guinea pig sequence (Fig. 2), may play a similar
role. However, a serine residue conserved across all
5-HT3A subunit orthologs aligns with Tyr-190
(Fig. 2). Mutagenesis of Tyr-190 to Ser in the nicotinic AChR subunits
is associated with a pronounced reduction in the affinity of
dimethyl-d-tubocurarine and the virtual abolition of
/
versus
/
interface selectivity (Sine et al., 1994
). It is
conceivable that this substitution contributes to the low affinity of
(+)-Tc for the human 5-HT3A receptor and that the
multiple amino acid differences between human and mouse sequences
within loop 3 compensate for the presence of serine in the mouse
subunit, perhaps by allowing the adjacent phenylalanine residue to
assume an orientation that permits interaction with (+)-Tc. Overall, the present data are compatible with a scheme wherein loop 3 residues collectively determine the shape of an element of the ligand pocket for
(+)-Tc with m5-HT3A Asp-206, perhaps making
direct contact with the ligand. The additional methylene group in the
side chain of Glu versus Asp may place the negatively charged
carboxylic acid group in a less favorable orientation for interaction
with (+)-Tc.
A precedent for a diffuse influence of loop 3 residues upon ligand
binding derives from a recent study of the chimeric
7-5-HT3A subunit (Corringer et al., 1998
). In
the latter, the exchange of five residues from an agonist binding
domain of the
4- nicotinic subunit into the
7-5-HT3A chimera selectively enhanced the
apparent affinity of ACh by 30-fold, abolishing the difference in
potency between the latter and nicotine to confer a pharmacological
phenotype typical of the
4
2-nicotinic receptor. In common with
the results of the present study, the mutation of individual residues
revealed only one that exerted a substantial (i.e., 7-fold)
influence upon the apparent affinity of ACh. Interestingly, several of
the residues exerting a subtle effect upon the apparent affinity of ACh
are homologous to amino acids within mouse and human
5-HT3A subunits that contribute to the
differential potency of (+)-Tc.
| |
Footnotes |
|---|
Received November 2, 1998; Accepted March 17, 1999
1 Present address: Department of Pharmacology, The Medical School, The University of Birmingham, Edgbaston, Birmingham B15 2TT.
This work was supported by grants from the Wellcome Trust to J.A.P. and J.J.L.
Send reprint requests to: Dr. John A. Peters, Department of Pharmacology and Neuroscience, Ninewells Hospital and Medical School, The University of Dundee, Dundee DD1 9SY, Scotland, United Kingdom. E-mail: j.a.peters{at}dundee.ac.uk
| |
Abbreviations |
|---|
AChR, acetylcholine receptor; 5-HT, 5-hydroxytryptamine; PCR, polymerase chain reaction; (+)-Tc, (+)-tubocurarine.
| |
References |
|---|
|
|
|---|
7 homooligomeric receptor.
J Biol Chem
270:
11749-11752
-
and
-
subunit interfaces of the nicotinic acetylcholine receptor.
Proc Natl Acad Sci USA
87:
2785-2789
subunit of the nicotinic acetylcholine receptor stabilize quaternary ammonium groups of agonist and curariform antagonists.
J Biol Chem
269:
8808-8816This article has been cited by other articles:
![]() |
A. N. de Oliveira-Pierce, R. Zhang, and T. K. Machu Colchicine: A Novel Positive Allosteric Modulator of the Human 5-Hydroxytryptamine3A Receptor J. Pharmacol. Exp. Ther., May 1, 2009; 329(2): 838 - 847. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Drisdel, D. Sharp, T. Henderson, T. G. Hales, and W. N. Green High Affinity Binding of Epibatidine to Serotonin Type 3 Receptors J. Biol. Chem., April 11, 2008; 283(15): 9659 - 9665. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yan, J. K. Meyer, and M. M. White Mapping Residues in the Ligand-Binding Domain of the 5-HT3 Receptor onto d-Tubocurarine Structure Mol. Pharmacol., August 1, 2006; 70(2): 571 - 578. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Zhang, N. A. White, F. S. Soti, W. R. Kem, and T. K. Machu N-Terminal Domains in Mouse and Human 5-Hydroxytryptamine3A Receptors Confer Partial Agonist and Antagonist Properties to Benzylidene Analogs of Anabaseine J. Pharmacol. Exp. Ther., June 1, 2006; 317(3): 1276 - 1284. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yan and M. M. White Spatial Orientation of the Antagonist Granisetron in the Ligand-Binding Site of the 5-HT3 Receptor Mol. Pharmacol., August 1, 2005; 68(2): 365 - 371. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schreiter, R. Hovius, M. Costioli, H. Pick, S. Kellenberger, L. Schild, and H. Vogel Characterization of the Ligand-binding Site of the Serotonin 5-HT3 Receptor: THE ROLE OF GLUTAMATE RESIDUES 97, 224, AND 235 J. Biol. Chem., June 13, 2003; 278(25): 22709 - 22716. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Machu, M. E. Hamilton, T. F. Frye, C. L. Shanklin, M. C. Harris, H. Sun, T. E. Tenner Jr., F. S. Soti, and W. R. Kem Benzylidene Analogs of Anabaseine Display Partial Agonist and Antagonist Properties at the Mouse 5-Hydroxytryptamine3A Receptor J. Pharmacol. Exp. Ther., December 1, 2001; 299(3): 1112 - 1119. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T. Min, C. L. Wu, and J. Yang Nondepolarizing Neuromuscular Blockers Inhibit the Serotonin-Type 3A Receptor Expressed in Xenopus Oocytes Anesth. Analg., February 1, 2000; 90(2): 476 - 476. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||