Introduction

Top Summary Introduction Materials and Methods Results Discussion References

-Aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian central nervous system. Its effects are mediated largely through the GABA_A receptors, a family of GABA-gated Cl ion channels (for reviews, see Sieghart, 1995; McKernan and Whiting, 1996), which are pentameric assemblies of the 14 different subunits cloned to date (1-6, 1-3, 1-3, , and ). The combination of  and  subunits has been shown to confer specific functional and pharmacological properties, in particular the affinity and efficacy of compounds at the benzodiazepine binding site. These two subunit types also contribute to the affinity and efficacy of GABA and Zn²⁺ sensitivity of the channel.

Dysfunction of GABAergic neurotransmission has been implicated in neurological disorders such as epilepsy. Studies of temporal lobe epilepsy using different animal models have reported up-regulation of various GABA_A receptor subunit mRNAs and proteins as well as modification of the pharmacological profile of receptors in rat hippocampus. For example, in electrical kindled rat, Clark and coworkers (1994) found increased levels of 4, 1, and 3 subunit mRNAs in dentate gyrus. Similarly, in kainic acid-induced temporal lobe epilepsy a marked up-regulation of 1, 2, 4, 5, 1, 3, 2, and  subunit proteins has been reported in the molecular layer of the rat dentate gyrus (Schwarzer et al., 1997). A recent study in rat (Brooks-Kayal et al., 1998) investigating GABAergic currents and mRNA expression in single dentate granule cells demonstrated profound changes in subunit expression and GABA_A receptor properties after pilocarpine treatment. The most dramatic changes were a 175 and 225% increase in the relative expression of 4 and  subunit mRNAs, respectively, together with an enhanced sensitivity of GABA_A receptors to block by Zn²⁺. An emerging view from these and other studies (Mahmoudi et al., 1997; Matthews et al., 1998; Smith et al., 1998) is that 4 subunit-containing GABA_A receptors are highly plastic and, compared with other subtypes, are rapidly up-regulated in response to changes in neuronal activity.

Biochemical and pharmacological reports have shown that in rat brain some 4 receptors bind [³H]Ro15-4513 with high affinity (Benke et al., 1997) whereas others do not (Khan et al., 1996), suggesting the existence of a heterogeneous population of 4 subunit-containing GABA_A receptors. In the present study, we have used pharmacological analyses and quantitative immunoprecipitation (Sur et al., 1998) to further characterize 4 subunit-containing GABA_A receptors. We have focused our attention on subpopulations of 4 subunit-containing receptors present in rat thalamus and hippocampus, brain regions that express high level of 4 subunits and are involved in epilepsy (Wisden et al., 1992; Lowenstein, 1996).

	Materials and Methods

Top Summary Introduction Materials and Methods Results Discussion References

[³H]Muscimol (19.1 Ci/mmol) and [³H]Ro 15-4513 (20.9 Ci/mmol) were obtained from DuPont-New England Nuclear (Boston, MA). Benzodiazepine site ligands were obtained from Sigma (St. Louis, MO) or Research Biologicals, Inc. (Natick, MA).

Radioligand Binding Studies. Binding of [³H]Ro15-4513 (8 nM) or [³H]muscimol (40 nM) to thalamic or 432 cell membranes was carried out in 10 mM KH₂PO₄, 100 mM KCl pH 7.4 in a total volume of 0.5 ml. After incubation at 4°C for 1 h binding assays were terminated by filtration through Whatman GF/B filters, followed by washing three times in 10 mM KH₂PO₄, 100 mM KCl pH 7.4, and scintillation counting. Nonspecific binding was determined using 1 mM GABA for [³H]muscimol binding and 40 µM bretazenil for [³H]Ro15-4513 binding because bretazenil binds to all 1 to 6 subtypes (Sieghart, 1995). Nonlinear regression and statistical analyses were performed with Prism (GraphPad Software, San Diego, CA).

Generation of 4 Antiserum. Expression of the 4 subunit putative cytoplasmic loop was carried out as described elsewhere (McKernan et al., 1991). cDNA sequences encoding the domain between TM3 and TM4 (residues Pro332-Pro475 of bovine 4) were engineered into the bacterial expression vector pRSET5a using the polymerase chain reaction. Oligonucleotide primers used were 5' tttcaggaattccagtgctgagagaaaagcatcctgaaac 3' (sense, incorporating an EcoRI site) and 5' atccagaagcttgtggagcagagggagtagtagtggc 3' (antisense, incorporating a HindIII site), and polymerase chain reaction was performed using bovine brain cDNA as template. The construct was confirmed by DNA sequencing. Polypeptide was expressed in Escherichia coli strain BL21 DE3 (lys-S) and using methods described previously (McKernan et al., 1991) purified to 1 mg/ml and emulsified with Freund's complete adjuvant (1:1, v/v). Rabbits were then immunized with 50-µg aliquots s.c., and boosted monthly for another 2 months with 50 µg of polypeptide emulsified with Freund's incomplete adjuvant. Rabbits were bled 7 days after each boost and the presence of anti-4 antibodies was then assayed by Western blot against bacterially expressed 1, 2, 3, 4, 5, and 6 polypeptides as described previously (McKernan et al., 1991; Quirk et al., 1994).

Generation of 432 Cell Line. cDNAs encoding human 4, 3, and 2S have been described previously (Hadingham et al., 1993a,b; Wafford et al., 1996). The expression of the 4 subunit in oocytes was poor, so the 5'-untranslated region and the signal peptide of the 1 subunit was engineered onto the 4 subunit, which resulted in much higher levels of expression (Wafford et al., 1996). This construct was then used to generate a stable cell line expressing human 432 GABA_A receptors by transfection of the individual subunits in the dexamethasone-inducible expression vector pMSGneo in mouse L(tk) cells as described previously (Hadingham et al., 1993a). Geneticin-resistant cell colonies were subcloned and assayed for [³H]Ro 15-4513 binding 5 days after the induction of receptor expression. Cells expressing the highest levels of [³H]Ro 15-4513 binding were recloned and the resultant cell line was maintained as described previously (Hadingham et al., 1993a).

Immunoprecipitation. Receptors were solubilized from rat brain or from cell lines using 0.5% deoxycholate as described previously (McKernan et al., 1991). Briefly, antiserum (100 µl) and protein-A beads (100 µl) were incubated in a total volume of 1 ml of Tris-buffered saline (TBS) for 1 h at room temperature. After three washes with TBS, the antibody-protein A complex was loaded with 0.5% deoxycholate-solubilized receptors (0.4-0.6 ml) from thalamus, hippocampus, or cell line and incubated overnight at 4°C. The beads were then washed three times in TBS/0.1% Tween 20 and resuspended in 10 mM KH₂PO₄, 100 mM KCl, pH 7.4. Controls with protein A beads only or anti-5HT₃-antibody-protein A beads were used to determine nonspecific immunoprecipitation. Quantitative coimmunoprecipitations were carried out as described by Quirk et al. (1994). The 2- and -specific antibodies have been described previously and characterized (Quirk et al., 1994, 1995).

	Results

Top Summary Introduction Materials and Methods Results Discussion References

[³H]Ro15-4513 Saturation Binding. Saturation experiments in rat thalamus were performed with [³H]Ro15-4513, a benzodiazepine site radioligand that binds to all 2 subunit-containing GABA_A receptors (i.e., 12, 22, 32, 42, etc.; Sieghart, 1995). The experiments were carried out either in the absence of diazepam to determine the total number of receptors or in the presence of 10 µM diazepam to reveal the existence of diazepam-insensitive (DIS) [³H]Ro15-4513 sites. The diazepam-sensitive (DS) [³H]Ro15-4513 binding sites were then defined as the difference between total receptors and DIS. As illustrated in Fig. 1, [³H]Ro15-4513 binds to both DS and DIS receptors with a similar affinity (Kd_DS = 7.1 ± 0.3 nM; Kd_DIS = 7.0 ± 0.7 nM; mean ± S.E.M., n = 2) but with different B_max values; DS and DIS sites accounting for 94 ± 2% (1339 ± 253 fmol/mg protein) and 6 ± 2% (90 ± 44 fmol/mg protein) of total sites, respectively.

View larger version (19K): [in this window] [in a new window]   Fig. 1.   Saturation experiments with [3H]Ro15-4513 in rat thalamus in the presence () or absence () of 10 µM diazepam revealed the existence of DS sites (: Kd = 7.1 ± 0.3 nM; Bmax = 1339 ± 253 fmol/mg protein) and DIS sites (: Kd = 7.0 ± 0.7 nM; Bmax = 90 ± 44 fmol/mg protein). The proportion of DIS-[3H]Ro15-4513 sites was 6 ± 2% of total [3H]Ro15-4513 sites. Data are the mean ± S.E.M. of two experiments.

[³H]Ro15-4513 Binding Sites Pharmacology. Displacement of bound [³H]Ro15-4513 from thalamic membrane by various benzodiazepine site ligands also revealed distinct GABA_A receptor populations (Fig. 2A and Table 1). The 1-selective compound, zolpidem, inhibited 67 ± 6% of binding sites with a K_i value of 20 nM, establishing 1-containing receptors as the main  subunit population in the thalamus. Flunitrazepam did not block 11 ± 2% of [³H]Ro15-4513 sites whereas all other tested drugs fully displaced bound radioligand (Fig. 2A and Table 1). Competition experiments (Fig. 2B and Table 1) showed that CGS8216, bretazenil, DMCM, Ro15-1788, and ZK93426 bind to DIS [³H]Ro15-4513 with a reduced affinity.

View larger version (26K): [in this window] [in a new window]   Fig. 2.   Displacement of [3H]Ro15-4513 (8 nM) bound to rat thalamic membrane in the absence (A) or presence (B) of 10 µM flunitrazepam by various benzodiazepine site ligands. A, note that the 1 receptor-selective drug, zolpidem () inhibited only 66 ± 6% bound radioligand. Similarly, 11 ± 2% of the radiolabeled sites were insensitive to flunitrazepam (). B, bretazenil (), CGS8216 (), DMCM (), Ro15-1788 (), and ZK93426 () fully inhibited flunitrazepam-insensitive [3H]Ro15-4513 sites with Ki values (nM) of 59 ± 8, 28 ± 6, 32 ± 7, 119 ± 25, and 1142 ± 133, respectively. Plotted values are the mean ± S.E.M. of three determinations.

View this table: [in this window] [in a new window]   TABLE 1 Comparison of the affinity (Ki, nM) of compounds for [3H]Ro15-4513 (8-10 nM) binding sites in rat thalamus in the absence or presence of 10 µM flunitrazepam and to 432 receptors stably expressed in L(tk) cells Values are the mean ± S.E.M. of two to three determinations. Percentages (%) correspond to the inhibition of [3H]Ro15-4513 binding by 10 µM of the drug.

Characterization of 4 Antibody. To further characterize the native rat 4 subunit-containing receptor, an 4-specific antiserum was developed. Immunoblotting data (not shown) indicated that 4 antiserum does not cross-react with bacterially expressed peptides corresponding to the intracellular loop of 1, 2, 3, 5, and 6 GABA_A receptor subunit. The ability of the antiserum to detect native and recombinant receptors was investigated by immunoprecipitating solubilized 4-containing receptors from the rat brain and stable cell line, respectively. As shown in Fig. 3, the antiserum immunoprecipitated essentially all (93 ± 14%) [³H]Ro 15-4513 binding sites solubilized from the cell line. In contrast, 4 antiserum did not precipitate a significant amount of [³H]Ro15-4513 binding from solubilized 132, 232, 332, 532, and 632 recombinant receptors, which have high-affinity [³H]Ro15-4513 binding sites.

View larger version (15K): [in this window] [in a new window]   Fig. 3.   Specific immunoprecipitation of 4 subunit-containing receptors by the anti-4 antiserum. Saturable immunoprecipitation of [3H]Ro15-4513 binding sites from detergentsolubilized 432 cell line is observed. Protein A beads were incubated with increasing volumes of antiserum and GABAA receptors solubilized from the 432 cell line were immunoprecipitated as described in Materials and Methods. The 4 antiserum (100 µl) precipitated 93 ± 14% of the total number of [3H]Ro15-4513 sites (mean ± S.E.M.; n = 3). In contrast, no significant amount of [3H]Ro15-4513 binding sites was immunoprecipitated by 100 µl of 4 antibody from 1 (1 ± 1%; mean ± S.E.M.; n = 2), 2 (0.4 ± 0.4%; n = 2), 3 (0%; n = 2), 5 (3 ± 1%; n = 2), or 6 (1 ± 1%; n = 2) subunit-containing receptors.

View larger version (25K): [in this window] [in a new window]   Fig. 4.   Quantitative immunoprecipitation of [3H]muscimol binding sites from rat thalamus by 4, 2 (A), and 4,  (B) antisera and from rat hippocampus (C) by 4, . A, GABAA receptors were solubilized from thalamic membranes and incubated overnight with protein A beads previously incubated with specific antibodies alone or in combination. Data (mean ± S.E.M.; n = 2) showed that 4- and 2-containing receptors account for 22 ± 13 and 52 ± 3% of the total population, respectively. The theoretical value (4 + 2) was higher than the amount of receptors coprecipitated by both 4 and 2 antibodies. The difference between theoretical and observed values (rightmost column) indicates that 8 ± 3% of total [3H]muscimol binding sites in thalamus originate from 42 receptor subtype. B, similar experiments performed with 4 and  antibodies indicate that 4, , and 4 subunit-containing receptors represent 19 ± 2%, 16 ± 3%, and 13 ± 2% (mean ± S.E.M.; n = 4) of the total thalamic population, respectively. They also revealed that in rat thalamus all  subunits coassemble with an 4 subunit. C, quantitative immunoprecipitation from rat hippocampus indicates the presence of 4 and  subunit-containing receptors that account for 13 ± 3% and 13 ± 2% of total [3H]muscimol binding sites, respectively, as well as a small population (7 ± 2%; rightmost column) of 4 receptors. Data are the mean ± S.E.M. of three determinations.

	Discussion

Top Summary Introduction Materials and Methods Results Discussion References

The pharmacology of benzodiazepine sites is determined primarily by the  and  subunits present in the pentameric GABA_A receptor (McKernan et al., 1991; Sieghart, 1995). Here, pharmacological study of rat thalamus revealed the presence of multiple GABA_A receptor subtypes.

Analysis with zolpidem, an 1 subunit benzodiazepine site-selective ligand revealed that 1 subunit-containing GABA_A receptors contribute around two-thirds of total thalamic [³H]Ro15-4513 sites. This is consistent with the predominant expression of 1 mRNA and protein in thalamus (Wisden et al., 1992; Fritschy and Mohler, 1995).

DIS [³H]Ro15-4513 sites were shown to be present in thalamus, where they account for 6 to 11% of total [³H]Ro15-4513 sites in agreement with previous autoradiographic and binding studies (Turner et al., 1991; Benke et al., 1997). The pharmacology of the DIS [³H]Ro15-4513 sites in rat thalamus has been characterized and shown to be similar to the benzodiazepine binding site conferred by 4 in combination with 2 in recombinant 432 receptor. This is in agreement with a report showing the congruence between 432 subtype and DIS [³H]Ro15-4513 sites in rat forebrain (Benke et al., 1997).

Quantitative immunoprecipitation with 4- and 2-specific antisera and [³H]muscimol binding to label all GABA_A receptors showed that 42 receptors are indeed present in the thalamus, where they represent a minor population (8%) of total GABA_A receptors. Our 4 antibody also specifically immunoprecipitated 7% of total thalamic [³H]Ro15-4513 binding sites. Binding sites measured either by 42 coprecipitation of [³H]muscimol sites (8%), 4 precipitation of [³H]Ro15-4513 sites (7%), or saturation analysis of DIS [³H]Ro15-4513 binding sites (6%) all support the conclusion that they represent the same receptor population and 42-containing receptors in the thalamus account for a relatively minor proportion of total GABA_A receptors.

Our experiments also indicated that 4 subunit-containing receptors account for one-fifth of total thalamic GABA_A receptors, a proportion similar to the 27% reported by Khan and colleagues (1996) using another specific 4 antibody. The difference in the amount of 4-containing receptors and both 42 subtype and DIS [³H]Ro15-4513 sites suggested that the 4 subunit could be present in another subunit assembly that does not contain a  subunit and [³H]Ro15-4513 binding site. This observation prompted us to investigate the putative coassembly of 4 with  subunit. Indeed, the thalamus has been shown to be a high  subunit-expressing area by both in situ hybridization and immunocytochemistry (Wisden et al., 1992; Fritschy and Mohler, 1995). Coimmunoprecipitation with 4 and  antisera demonstrated the existence of 4 subtype in rat thalamus that accounts for all  subunit-containing receptors and around 60 to 70% of the 4 population. Concomitantly, the sum of 42 (8%) and 4 (13%) populations measured using [³H]muscimol is roughly equivalent to the total 4 population (22%). The 4 subtype receptor is also present in rat hippocampus but in contrast to thalamus it accounts for only half of both 4 and  receptor populations, suggesting the existence of other 4 subunit- and  subunit-containing GABA_A receptor subtypes. Indeed, Benke and coworkers (1997) have reported the presence of 42 receptors in rat hippocampus. Future experiments should reveal which  subunit besides 4 coassembles with the  subunit in hippocampus as well as which  subunit is present in thalamic and hippocampal 4 receptors.

It should be noted that these binding and immunoprecipitation experiments were performed with membranes that probably contain both surface and intracellularly (i.e., endoplasmic reticulum) located receptors. One cannot exclude the possibility that 42 isoform represents intracellular, nonfunctional receptors. However, given that this subtype can be expressed in vitro (Wafford et al., 1996; Knoflach et al., 1996) it is probable that at least some of these receptors are localized to the cell surface. Furthermore, the 4 subtype is presumed to be functional because  subunit knockout mice show epileptic seizures (Olsen et al., 1997), a phenotype probably resulting from the lack of 4 receptors in thalamus and/or hippocampus because 6 isoform knockout mice have no seizures (Jones et al., 1997). Recent studies on the assembly of GABA_A receptors conclude that the  subunit is the last to be included in the receptor complex, yet it is needed for correct clustering of GABA_A receptors (Gunther et al., 1995; Essrich et al., 1998). Because the  subunit substitutes for a  subunit (Quirk et al., 1995) it is more likely that  and  subunits are first assembled in the endoplasmic reticulum and then are joined by a  or  subunit. If 4 dimers expressed in endoplasmic reticulum contribute significantly to total immunoprecipitated [³H]muscimol binding, then the proportion of 4 receptors on the surface may be underestimated by this technique.

Receptors that contain the 6 subunit in combination with the  subunit do not bind benzodiazepine ligands with high affinity (Quirk et al., 1994). Given the qualitatively similar benzodiazepine pharmacology of 4- and 6-containing GABA_A receptors (Knoflach et al., 1996), it is anticipated that benzodiazepine site ligands will have low affinity for 4 receptors. However, this subtype probably has some unique pharmacological properties conferred by the combination of both 4 and  subunits. Electrophysiological recordings have demonstrated that 4 subunit-containing receptors display a higher GABA sensitivity than other  subunit-containing receptors (Knoflach et al., 1996). This effect may even be exacerbated by the presence of a  subunit because 63 receptors are more sensitive to GABA (EC₅₀ of 0.4 µM) than those containing a 2 subunit (EC₅₀ of 2 µM; Saxena and MacDonald, 1996). In addition to a putative relatively high sensitivity for GABA, 4 subtypes might be particularly sensitive to modulation by Zn²⁺. Thus, 422 receptors are sensitive to Zn²⁺ despite the presence of a 2 subunit (Knoflach et al., 1996) and the presence of a  subunit has been shown to increase Zn²⁺ sensitivity to 1- or 6-containing receptors (Saxena and MacDonald, 1994, 1996). Furthermore, -containing receptors exhibit currents of low amplitude, but with a slow rate of desensitization even in the presence of GABA (Saxena and MacDonald, 1994), suggesting that they might be involved in the generation of long-lasting inhibitory postsynaptic potentials and consequently in tonic neuronal inhibition. Such a proposal has received a recent morphological support as Nusser and coworkers (1998) have clearly shown that in rat cerebellum all -containing receptors are located at extrasynaptic sites.

Recent reports (Schwarzer et al., 1997; Brooks-Kayal et al., 1998) have shown an up-regulation of both 4 and  subunit immunoreactivities and mRNA levels in dentate gyrus neurons after chemically induced temporal lobe epilepsy in rat. It is tempting to speculate that an overexpression of 4 receptor subtype with its putative long-lasting inhibitory potential and wide nonsynaptic membrane localization (see above) may represent an adaptive change to compensate neuronal hyperexcitability. Future studies are needed to clarify these issues and to establish the involvement of 4 receptors in animal seizure models.

In conclusion, our results show that a heterogeneous complement of GABA_A receptors is expressed in rat thalamus and provides evidence for the existence of 4 subtype. Although this receptor subtype accounts for 13% of total GABA_A receptors, its pharmacological and anatomical features may confer it a unique role in monitoring both normal and hyperactive neuronal networks.