|
|
|
|
Vol. 56, Issue 3, 570-580, September 1999
Gilead Sciences, Foster City, California (T.C., D.C.L., M.D.F., D.B.M.); and Laboratory of Pharmacology and Chemistry, National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina (J.B.P., D.H.S)
| |
Summary |
|---|
|
|
|---|
Nephrotoxicity is the dose-limiting clinical adverse effect of cidofovir and adefovir, two potent antiviral therapeutics. Because renal uptake likely plays a role in the etiology of cidofovir- and adefovir-associated nephrotoxicity, we attempted to identify a renal transporter capable of interacting with these therapeutics. A cDNA clone was isolated from a human renal library and designated human organic anion transporter 1 (hOAT1). Northern analysis detected a specific 2.5-kilobase pair hOAT1 transcript only in human kidney. However, reverse transcription-polymerase chain reaction revealed hOAT1 expression in human brain and skeletal muscle, as well. Immunoblot analysis of human kidney cortex demonstrated that hOAT1 is an 80- to 90-kilodalton heterogeneous protein modified by abundant N-glycosylation. Xenopus laevis oocytes expressing hOAT1 supported probenecid-sensitive uptake of [3H]p-aminohippurate (Km = 4 µM), which was trans-stimulated in oocytes preloaded with glutarate. Importantly, both hOAT1 and rat renal organic anion transporter 1 (rROAT1) mediated saturable, probenecid-sensitive uptake of cidofovir, adefovir, and other nucleoside phosphonate antivirals. The affinity of hOAT1 toward cidofovir and adefovir (Km = 46 and 30 µM, respectively) was 5- to 9-fold higher compared with rROAT1 (Km = 238 and 270 µM, respectively). These data indicate that hOAT1 may significantly contribute to the accumulation of cidofovir and adefovir in renal proximal tubules and, thus, play an active role in the mechanism of nephrotoxicity associated with these antiviral therapeutics.
| |
Introduction |
|---|
|
|
|---|
Successful
management of viral infections often requires long-term therapy with
highly potent antivirals. However, various adverse effects may be
induced by prolonged administration of antiviral drugs. For example,
long-term azidothymidine and dideoxycytidine therapy causes myopathy
and peripheral neuropathy, respectively, in a number of AIDS patients
(Dalakas et al., 1990
; Dubinsky et al., 1989
). Similarly, extended
therapy with HIV protease inhibitors may be associated with peripheral
lipodystrophy, hyperlipidemia, and insulin-resistant diabetes (Carr et
al., 1998
). However, the main dose-limiting clinical factor for
cidofovir
[(S)-1-(3-hydroxy-2-phosphonylmethoxypropyl)cytosine] and
adefovir [9-(2-phosphonylmethoxyethyl)adenine], two potent antiviral
agents with unique resistance profiles, is nephrotoxicity characterized
by changes in laboratory markers of renal function (Lalezari et al.,
1997
; Fisher et al., 1999
). Both cidofovir and adefovir are nucleoside
phosphonate analogs, a class of novel antivirals structurally related
to natural nucleotides (Fig. 1). Cidofovir is a potent inhibitor of almost all types of DNA viruses (Hitchcock et al., 1996
) and has been approved for treatment of cytomegalovirus retinitis in AIDS patients. Adefovir showed a strong in
vitro effect against herpesviruses, hepadnaviruses, and retroviruses
(Cihlar and Bischofberger, 1998
). Its orally available prodrug is
currently being evaluated as an anti-HIV agent in phase III clinical
studies. In addition, clinical trials exploring the application of
adefovir as a treatment for hepatitis B virus infections are under way.
|
Cidofovir and adefovir are actively secreted by the kidney (Cundy et
al., 1995a
,b
), suggesting that active drug accumulation in renal
proximal tubules may play a role in the etiology of the drug-associated
nephrotoxicity. In rabbits and rats, cidofovir is accumulated in
kidney, reaching significantly higher concentration levels compared
with other organs and tissues (Cundy et al., 1996a
,b
). Presumably, the
uptake of cidofovir across the basolateral tubular membrane is more
efficient than the subsequent secretion into tubular lumen resulting in
drug accumulation in renal tubules. Hence, inhibition of the active
drug uptake into proximal tubular cells may provide an effective
strategy to ameliorate the renal toxicity syndromes. Previously this
approach has been shown to be effective for some nephrotoxic
-lactam
antibiotics. For example, N-benzoyl-
-alanine (betamipron)
has been shown to reduce the nephrotoxicity of cephaloridine by
inhibiting its tubular uptake (Tune, 1997
). Similarly, in cynomolgus
monkeys receiving chronic i.v. cidofovir treatment, coadministration of
oral probenecid, an inhibitor of renal organic anion transport, reduced
the incidence and severity of the drug-associated nephrotoxicity (Lacy
et al., 1998b
). Thus, identification and characterization of renal
transporter(s) that mediate tubular uptake of cidofovir and/or adefovir
would contribute to a better understanding of the mechanisms of their nephrotoxicity, as well as aid in the design of novel, specific, and
effective nephroprotective agents.
The renal organic anion transport system, because of its sensitivity to
probenecid and broad substrate specificity, is a primary candidate to
mediate uptake of nucleoside phosphonate analogs into proximal tubules.
Probenecid-sensitive renal organic anion transporters from rat
(rROAT1/rOAT1), mouse [mNKT(mROAT1)], and winter flounder
(fROAT1) have been previously cloned and characterized (Lopez-Nieto et
al., 1997
; Sekine et al., 1997
; Sweet et al., 1997
; Wolff et al.,
1997
). Upon expression in Xenopus oocytes, rROAT1 functions
as an organic anion/dicarboxylate exchanger and mediates uptake of
p-aminohippurate (PAH), cyclic nucleotides, and other small
organic anions, indicating its broad substrate specificity (Sekine et
al., 1997
; Sweet et al., 1997
). rROAT1 clearly represents the
multispecific PAH/dicarboxylate exchanger previously detected by
functional studies in basolateral membrane vesicles and isolated renal
proximal tubules from a variety of species (Pritchard, 1988
). In this
study, we report the cloning and characterization of a human organic
anion transporter, hOAT1, and demonstrate its function as a
PAH/dicarboxylate exchanger. Importantly, we present data indicating
that several antiviral nucleoside phosphonate analogs are high-affinity
substrates for hOAT1 and that this transporter may be directly involved
in mediating cidofovir- and adefovir-associated nephrotoxicity.
| |
Materials and Methods |
|---|
|
|
|---|
Screening of a Human Renal cDNA Library. A human kidney cDNA library was purchased from Invitrogen (Carlsbad, CA) and screened by colony hybridization with a 42-mer oligonucleotide (5'-CACTGCCGCCCGCCTGCCGATGCCAACCTCAGCAAGAACGGG-3') corresponding to the 5'-end of clone expressed sequence tag (EST)58612 (GenBank accession number AA351032). The oligonucleotide was labeled with [32P]dATP using T4 polynucleotide kinase. Bacterial colonies were transferred onto Hybond-N membranes (Amersham Pharmacia Biotech, Arlington Heights, IL) and hybridized overnight with the labeled probe in hybridization buffer (5× standard saline citrate (SSC), 5× Denhardt's solution, 0.05% SDS) at 68°C. Final washing was performed twice with 0.1× SSC + 0.1% SDS. Filters were subjected to autoradiography overnight, and several positive colonies were identified. Plasmid DNA was purified from these clones, and the length of their cDNA inserts determined by polymerase chain reaction (PCR).
DNA Sequencing and Analysis. The clone containing the largest cDNA insert (pOAT-8) was subjected to complete sequence analysis of both complementary strands by simultaneous "walking" from the 5'- and 3'-ends of the insert. Automatic sequencing was performed with Cy5-labeled oligonucleotide primers (Integrated DNA Technologies, Coralville, IA) using the Thermosequenase cycle sequencing kit (Amersham Pharmacia Biotech). All ambiguities were resolved by manual sequencing using the Thermosequenase radiolabeled terminator cycle sequencing kit (Amersham Pharmacia Biotech). If necessary, dideoxy-ITP was substituted for dideoxy-GTP to resolve sequence compressions. Initially, a BLAST search of the GenBank database identified mNKT(mROAT1) and rROAT1 as being related sequences, but no human homologs were found, and we designated this cDNA clone as hOAT1. All DNA and peptide sequence comparisons and database searches were done with the Wisconsin Package software (Genetics Computer Group, Madison, WI) with default settings.
Northern Blotting.
A human multiple tissue Northern blot
(CLONTECH, Palo Alto, CA) was used for localization of hOAT1 expression
in human tissues. An hOAT1-specific
[32P]dATP-labeled probe was generated by random
priming the BsrGI/Bsu36I DNA fragment from
pOAT-8 (nucleotides 420-854 of hOAT1 coding region). The membrane was
hybridized for 1 h at 68°C in ExpressHyb hybridization buffer
(CLONTECH) and then washed twice in 2× SSC with 0.05% SDS for 30 min
at room temperature followed by a single wash in 0.1× SSC with 0.1%
SDS at 50°C. The membrane was autoradiographed for 7 days at
70°C
with intensifying screens. After stripping, the membrane was reprobed
with a
-actin control probe provided by the manufacturer and
autoradiographed for 3 h.
Tissue Localization by Reverse Transcription (RT)-PCR. The multiple choice cDNA kits I and II containing tissue-specific cDNAs (Origene Technologies, Rockville, MD) and two sets of hOAT1-specific primers were used for PCR detection of hOAT1 expression. The oligonucleotides, 5'-CCCGCTGGCACTCCTCCTCCGGGAG-3' (sense), and 5'-GTAGAGCTCGGCAGTCATGCTCACCA-3' (antisense), were used to amplify a 606-bp fragment from the hOAT1 coding region (nucleotides 815-1420). In the independent set of PCR reactions, a 295-bp hOAT1 fragment [composed of the last 175 coding nucleotides and 120 nucleotides of the 3'-untranslated region (UTR)] was amplified using the oligonucleotides, 5'-CCAGCGCTGTCACTGTCCTCCTGC-3' (sense), and 5'-AACCCCCACACTTGGGTCACCATTTCCTC-3' (antisense).
PCR reactions were carried out using the Expand High Fidelity PCR system (Roche Molecular Biochemicals) in a total volume of 25 µl containing 1 µg of tissue-specific cDNA. Thirty-five amplification cycles (95°C for 40 s, 58°C for 1 min, and 72°C for 45 s) were performed. A negative control without cDNA template was included in each set of reactions. As an internal control, a
-actin fragment was amplified using primers provided by the manufacturer.
In Vitro Expression of hOAT1. For efficient in vitro expression of hOAT1, the plasmid pOAT-8/ITT was constructed as follows. A fragment containing the first 500 bp of the hOAT1 coding region was amplified from pOAT-8 by the PCR using the sense primer 5'-ATGCCTGGATCCAAGCTATTTAGGTGACACTATAGAATACTCAAGCTTGTTTTTATTTTTAATTTTCTTTCAAATACGTCCACCATGGCCTTTAATGACC-3' to introduce a BamHI restriction site, the SP6 promoter, a truncated form of the 5'-UTR from alfalfa mosaic virus, and a favorable initiation context (these elements are underlined in the same order in the primer sequence). The oligonucleotide 5'-CGATGCCTGGCCTTTGCCCATGGTCAGCTC-3' was used as an antisense primer. The PCR product was digested with BamHI and BsrGI, and subcloned into BamHI/BsrGI-digested pOAT-8. Plasmid pOAT-8/ITT was expressed in vitro with the TNT SP6 Coupled Reticulocyte Lysate system (Promega, Madison, WI). A 25-µl reaction, containing 2 µg of circular plasmid and other components according to the manufacturer's protocol including complete amino acid mixture, was incubated for 2 h at 30°C and subjected to immunoblot analysis as described below.
Immunoblot Analysis of hOAT1. Rabbit anti-hOAT1 polyclonal antibody was prepared at AnaSpec (San Jose, CA) using standard immunological techniques. Briefly, a peptide corresponding to hOAT1 amino acids 515 to 528 was conjugated to keyhole limpet hemocyanine through a cysteine residue added to the C terminus of the peptide. Animal serum was collected after four immunizations in the presence of complete Freund's adjuvant and affinity-purified against the immunogenic peptide immobilized on a Sepharose resin.
For immunoblot analysis, human kidney cortex was obtained from the International Institute of Advanced Medicine (Exton, PA), frozen in liquid nitrogen, ground to a powder, and mixed with 10-fold excess (w/v) of extraction buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% SDS). After homogenization in the presence of complete proteinase inhibitor cocktail (Roche Molecular Biochemicals) the extract was clarified by high-speed centrifugation. An aliquot was deglycosylated by incubation in the presence of peptide:N-glycosidase F (New England Biolabs, Beverly, MA) for 2 h at 37°C without prior denaturation. Tissue extracts (50 µg of protein) and in vitro expression reactions (10 µl) were separated by electrophoresis on an 8% SDS-polyacrylamide gel and electroblotted onto a nitrocellulose membrane (Millipore, Bedford, MA). The membrane was subsequently blocked in PBS/5% dry milk (PBS-M) for 1 h, washed three times in PBS/0.05% Tween 20, and incubated overnight in PBS-M with the anti-hOAT1 antibody. Following washing in PBS/0.05% Tween 20, the membrane was incubated in PBS-M with goat anti-rabbit antibody conjugated to horseradish peroxidase (Zymed, South San Francisco, CA). After an additional wash and incubation with a chemiluminescent substrate (Amersham Pharmacia Biotech), the immunoblot was exposed to X-ray film.Xenopus Oocyte Expression Assay. For batch oocyte isolation, adult female Xenopus laevis (Xenopus One, Ann Arbor, MI) were anesthetized by hypothermia and decapitated. Ovaries were removed and divided into clumps of ~50 to 100 oocytes. Oocyte clumps were placed into a 50-ml conical tube containing oocyte Ringer's 2 (OR-2: 82.5 mM NaCl, 2.5 mM KCl, 1 mM Na2HPO4, 3 mM NaOH, 1 mM CaCl2, 1 mM MgCl2, 1 mM pyruvic acid, and 5 mM HEPES, pH 7.6) until they reached the 4-ml mark. Oocytes were rinsed three times with 10 ml of calcium-free OR-2 (82.5 mM NaCl, 2 mM KCl, 1 mM MgCl2, and 5 mM HEPES, pH 7.6), placed in collagenase solution [5 mg/ml collagenase A (Roche Molecular Biochemicals) and 1 mg/ml trypsin inhibitor type III-O (Sigma Chemical Co., St. Louis, MO) in calcium-free OR-2] and swirled at 100 rpm for 2 to 2.5 h at 18°C. After collagenase treatment, the oocytes were rinsed five times with OR-2 containing 1 mg/ml BSA and placed in a phosphate/BSA solution for 1 h (100 mM K2HPO4 with 1 mg/ml BSA, pH 6.5). Oocytes were agitated every 15 min to remove the follicle and then rinsed five times with OR-2 + BSA. Stages V and VI oocytes were collected and maintained at 18°C in OR-2 containing 0.05 mg/ml gentamycin sulfate, 2.5 mM sodium pyruvate, and 5% heat-inactivated horse serum. Overnight recovery was allowed before injection.
Capped cRNA for microinjection was synthesized from linearized plasmid DNA using Ambion's mMessage mMachine in vitro transcription kit (Ambion, Inc., Austin, TX). The cRNA products were quantitated in a spectrophotometer and diluted before injection to allow delivery of 20 ng of cRNA/oocyte in 16 nl with a 1- to 2-s injection. Uptake assay was performed as described previously (Sweet et al., 1997Statistics.
Data are presented as mean ± S.E.
Differences in mean values were considered to be significant when
p
.05 as determined by one-sample or paired
Student's t test. The degree of significance was as
indicated in the figure legends.
Chemicals.
[3H]PAH (3.7 Ci/mmol) was
obtained from NEN Life Science Products (Boston, MA).
[14C]Tetraethylammonium (53 mCi/mmol) was
obtained from American Radiolabeled Chemicals, Inc. (St. Louis, MO).
Adefovir (30 Ci/mmol), cidofovir (56 mCi/mmol),
[3H]9-(2-phosphonylmethoxyethyl)guanine (PMEG;
34 Ci/mmol), and [3H]9-(2-phosphonylmethoxyethyl)diaminopurine
(PMEDAP; 32 Ci/mmol) were purchased from Moravek Biochemicals (Brea,
CA). All unlabeled nucleoside phosphonates were synthesized at Gilead
Sciences according to previously published procedures (Holy and
Rosenberg, 1987
). Unlabeled PAH, probenecid, and glutarate were
obtained from Sigma.
| |
Results |
|---|
|
|
|---|
Cloning of hOAT1 cDNA.
To identify potential cDNA sequences
encoding a hOAT homolog, a BLAST search of the GenBank EST database was
performed with the full-length rROAT1 cDNA sequence (Sweet et al.,
1997
). Two EST cDNA clones from human infant brain (accession number
R25797 and AA351032), whose 5'-end regions exhibited a high level of
sequence homology to rROAT1 between coding nucleotides 390 and 730, were identified. Therefore, an oligonucleotide probe derived from EST
clone AA351032 was used to screen a human kidney cDNA library, and a
positive clone was identified (pOAT-8). We refer to this cDNA clone as
hOAT1.
Molecular Characterization of hOAT1.
The complete DNA sequence
of both strands of hOAT1 was determined, and the sense strand sequence
is presented in Fig. 2A. The hOAT1 cDNA
is 2118-bp long, including: 257 bp of 5'-UTR; a single, large open
reading frame 1650-bp long; and 211 bp of 3'-UTR. The ATG at position
258 to 260 is the first start codon and has a correlation with Kozak's
consensus for the translation initiation (Kozak, 1987
) giving a
predicted protein length of 550 amino acids with a molecular
mass of 60.3 kDa. Hydropathy analysis (Kyte and Doolittle, 1982
)
predicted 12 potential
-helical membrane-spanning domains with both
the amino and carboxyl termini located intracellularly (Fig. 2).
According to this analysis, there is a large extracellular loop between
transmembrane domains 1 and 2. Within this loop are five potential
N-linked glycosylation sites at Asn39, Asn56, Asn92, Asn97,
and Asn113 and four cysteine residues at positions 49, 78, 105, and 128 that could participate in disulfide bond formation (Fig. 2A). A
significant intracellular loop between transmembrane domains 6 and 7, from approximately amino acid residues 271 to 336, contains four
protein kinase C (PKC) consensus sites located at Ser271, Ser278,
Thr284, and Thr334 and a potential casein kinase II (CKII) site at
Ser325 (Fig. 2A). Finally, within the carboxyl-terminal domain there is
another putative PKC site at Thr521, two potential CKII sites at Thr515
and Ser543, and a tyrosine kinase consensus site at Tyr536. Whether any
or all of these consensus sites participate in protein modification or
function requires further experimentation.
|
|
Expression of hOAT1 in Human Tissues.
Northern blot analysis
was used to examine hOAT1 expression in different human tissues with an
hOAT1-specific DNA probe. A strong signal was detected in kidney
corresponding to a transcript 2.5-kb in size (Fig.
3a, top). In addition, there was a very
weak signal of about 3.5 kb in liver that was detectable only after prolonged exposure. No positive signal was found in brain, heart, skeletal muscle, colon, thymus, spleen, small intestine, placenta, lung, or peripheral blood leukocytes. The lack of a detectable signal
in brain was an unexpected result because, as mentioned above, two EST
clones from a human infant brain cDNA library were identified with
sequence identical to a 340-bp region of hOAT1. Therefore, we used the
more sensitive technique of RT-PCR amplification to examine hOAT1
expression in various human tissues. Each sample was analyzed
independently using two distinct sets of primers with proper negative
controls (Fig. 3B, top and middle). A strong positive signal was
consistently detected in kidney with both sets of primers. In contrast
with the Northern analysis, RT-PCR amplification consistently yielded a
product from brain. Interestingly, a strong positive signal was also
detected in skeletal muscle, although only with one set of
hOAT1-specific primers.
|
Immunoblot Analysis of hOAT1.
A polyclonal antibody was
generated in rabbits immunized with a synthetic peptide derived from a
region of hOAT1 with predicted high antigenicity. In the immunoblot
analysis of an extract from human kidney cortex, the antibody
recognized a heterogeneous product with an apparent molecular
mass of approximately 80 to 90 kDa (Fig.
4). This was significantly larger than
the predicted molecular mass from the hOAT1 amino acid sequence.
However, when the cortex extract was treated with
peptide/N-glycosidase F, which specifically cleaves
N-linked oligosaccharide chains, a 60-kDa homogeneous product was detected on the immunoblot. To determine whether this treatment completely removes all modifications from the hOAT1 peptide,
we attempted to generate a control for the unmodified polypeptide by in
vitro expression of hOAT1 cDNA in rabbit reticulocyte lysate. At first,
no product of in vitro expression was detected in the presence of
pOAT-8 plasmid. To achieve efficient expression, the original hOAT1
5'-UTR was replaced by a truncated form of the alfalfa mosaic virus
RNA4 5'-UTR, which has been previously shown to significantly stimulate
in vitro expression in reticulocyte lysate (Cihlar et al., 1997
). In
addition, the sequence surrounding the starting ATG codon was modified
to match an optimal initiation context (Kozak, 1987
). As shown in Fig.
4, the modified plasmid yielded a single polypeptide whose size was
identical to that of the deglycosylated hOAT1. Together, these findings
indicate that hOAT1 is modified by abundant N-glycosylation,
which could account for up to 30% of its total molecular weight.
Importantly, because all potential N-glycosylation sites
reside within the large loop between the first and second putative
transmembrane domain, it also shows that this loop is indeed located
extracellularly as predicted from the hOAT1 hydropathy plot.
|
Functional Characterization of hOAT1 Transport.
That the hOAT1
cDNA does indeed encode an organic anion transporter was confirmed by
Xenopus oocyte expression assay. After cRNA injection,
hOAT1-mediated uptake of 50 µM [3H]PAH was
equivalent to that seen with the previously identified basolateral
organic anion transporter rROAT1 (Fig. 5;
Sweet et al., 1997
). Addition of 1 mM probenecid reduced PAH uptake by 98%, proving that virtually all of the uptake was carrier mediated. Water-injected oocytes showed no appreciable uptake and were unaffected by probenecid.
|
-ketoglutarate (
-KG), bromcresol green, and 2,4-dichlorophenoxyacetic acid, as well as excess unlabeled PAH, each
reduced [3H]PAH uptake by at least 95% at 1 mM
concentration. Interestingly, unlike the results reported for rROAT1
(Sweet et al., 1997
-KG to
cis-inhibit PAH uptake is indicative of a basolateral location for hOAT1, because the basolateral dicarboxylate/organic anion
exchangers (e.g., rROAT1) should be inhibited by external
-KG as
opposed to the luminal PAH carriers, which should be insensitive to
this inhibition (Pritchard and Miller, 1993
|
-KG,
it is not extensively metabolized (Pritchard, 1990
|
Nucleoside Phosphonate Analogs Are High-Affinity Substrates for
hOAT1.
Finally, the ability of rROAT1 and hOAT1 to mediate the
transport of therapeutically important antiviral nucleoside
phosphonates was tested. Together with adefovir (10 µM) and cidofovir
(36 µM), two other nucleoside phosphonates with broad-spectrum
antiviral and antiproliferative activity, PMEG (10 µM) and PMEDAP (10 µM), were found to be substrates for both rROAT1 and hOAT1 (Fig.
8). However, uptake of all antivirals
tested was markedly higher for hOAT1 compared with rROAT1. Little to no
uptake was measured in water-injected oocytes, indicating the complete
lack of diffusive uptake of these nucleotide analogs. Like PAH, both
hOAT1- and rROAT1-mediated uptake of all nucleoside phosphonates was
efficiently blocked by 1 mM probenecid. In contrast to hOAT1 and
rROAT1, the renal organic cation transporter 2, did not mediate
detectable uptake of adefovir or cidofovir in renal organic cation
transporter 2 cRNA-injected oocytes (data not shown). Finally, similar
to PAH, preloading the oocytes in 5 mM glutarate for 90 min before exposure to adefovir significantly stimulated adefovir uptake in rROAT1
(5.3-fold increase, p < .001) and hOAT1 (1.5-fold
increase, p < .01)-expressing oocytes, as compared
with nonpreloaded oocytes. Thus, hOAT1-mediated adefovir uptake
correlates with the countertransport of dicarboxylate.
|
|
|
| |
Discussion |
|---|
|
|
|---|
Besides other important functions, the kidney plays an
indispensable role in maintaining body homeostasis, and it is highly specialized for this purpose. Its functional unit, the nephron, is a
polarized epithelium equipped with transport systems that mediate
active secretion and/or reabsorption of a variety of small molecules.
For drugs and other foreign compounds, secretion is achieved through
coordinated function of basolateral and apical transporters operating
in series (Pritchard and Miller, 1993
). The elimination of some drugs
and xenobiotics is so effective that they are completely cleared from
renal plasma in a single pass through the kidney. Because the kidney
handles one-fifth of the entire cardiac output, proximal tubular
epithelium must possess a remarkable transport capacity. This has a
significant implication for drug therapy, because the secretory
transport may lead to an active drug accumulation within proximal
tubular cells with associated risk of nephrotoxicity. Animal toxicology and pharmacokinetic studies suggested that such mechanisms may also be
involved in the nephrotoxicity induced by cidofovir and adefovir
therapy. In this study, we have cloned and expressed hOAT1 and shown
that it exhibits a high affinity toward these clinically important antivirals.
The clone hOAT1 is virtually identical with a human clone identified as
hROAT1 by Reid et al. (1998)
, differing only in the terminal amino
acid, Phe in hROAT1 versus Leu in hOAT1. Notably, Leu has been reported
as the final amino acid in rROAT1, mNKT(mROAT1), hOAT1-1, hOAT1-2,
and hPAHT. The recent study by Lu et al. (1999)
describes the isolation
of hPAHT, which differs from hOAT1 at position 14 (Gly in hOAT1 versus
Ser in hPAHT). In this instance, rROAT1, mNKT(mROAT1), hOAT1-2,
hROAT1, and even fROAT, all have Gly at position 14. These two sequence
differences may be the result of PCR errors introduced by the method
used to clone hROAT1 and hPAHT. hOAT1 also appears to be the same clone
as that designated as hOAT1-2 by Hosoyamada et al. (1999)
. However,
the transport properties of hOAT1-2 were not characterized in the
study. Finally, a fourth closely related human clone was designated
as hOAT1-1 by Hosoyamada et al. (1999)
, which differs from hOAT1-2
by an extra 13 amino acid stretch in the C terminus.
The presence of hOAT1-specific mRNA was detected in human kidney as
well as brain when the sensitive technique of RT-PCR amplification was
used. Similarly, presence of mouse OAT1/NKT-specific mRNA has been
localized to kidney as well as brain (Lopez-Nieto et al., 1997
).
However, although organic anion transport activity has been previously
detected in choroid plexus (Miller and Ross, 1976
), presence of hOAT1
protein as well as its precise localization and function in brain
remains to be elucidated.
Characterization of hOAT1 in Xenopus oocytes indicated that,
like rROAT1, it functions as a PAH/dicarboxylate exchanger.
Specifically, it mediates PAH accumulation, which was effectively
inhibited by a variety of organic anions, including urate (although
urate itself was not a substrate). Importantly, substrate uptake into oocytes was trans-stimulated by glutarate, indicating that
hOAT1 mediates dicarboxylate/organic anion exchange (Fig. 7). This is consistent with a role of hOAT1 in basolateral uptake of anionic drugs
from the plasma, as previously established for rROAT1 (Pritchard, 1988
;
Sekine et al., 1997
; Sweet et al., 1997
). However, it must be noted
that unlike rat kidney, the human kidney appears capable of
dicarboxylate/organic anion exchange at luminal as well as basolateral
membranes (Roch-Ramel et al., 1996
). Kidney tissue immunostaining
revealed predominant, if not exclusive, localization of hOAT1-1 in the
basolateral membrane of the proximal tubule (Hosoyamada et al., 1999
).
However, in either location, basolateral or apical, the in vivo
orientation of the dicarboxylate gradient (in > out) (Pritchard
and Miller, 1993
) dictates that hOAT1 must mediate cellular uptake of
its exogenous substrates.
We showed that four antiviral nucleoside phosphonate analogs were
substrates for hOAT1 (Table 2 and Fig. 8). Interestingly, hOAT1 has
significantly higher affinity to nucleoside phosphonates compared with
rROAT1. This may explain, in part, the observation that a higher dose
of adefovir is required to induce nephrotoxicity syndromes in rats
(Lacy et al., 1998a
) compared with humans (Fisher et al., 1999
). If
hOAT1 is involved in cidofovir- and/or adefovir-associated nephrotoxicity, these drugs should show their highest renal
accumulation in those segments of the proximal tubule expressing the
organic anion/dicarboxylate exchanger. In rabbits, PAH/dicarboxylate
transport activity is most abundantly expressed in the S2 segment of
proximal tubule (Shpun et al., 1995
). Furthermore, in situ
hybridization using a specific cRNA probe demonstrated high levels of
rROAT1 expression in the S2 segment of rat renal proximal tubules
(Sekine et al., 1997
). Notably, rabbits show the highest accumulation of cidofovir in the most superficial part of cortex (Cundy et al.,
1996b
), which contains S1 and S2 proximal tubular segments, suggesting
that cidofovir accumulation does colocalize with expression of the
basolateral organic anion/dicarboxylate exchanger (i.e., rROAT1 and by
inference, hOAT1). In addition, clinical pharmacokinetic studies
demonstrated that the peak plasma drug levels
(Cmax) generated by therapeutically
relevant doses of cidofovir and adefovir are 30 to 40 µM (Cundy et
al., 1995b
) and 0.5 to 1 µM (Barditch-Crovo et al., 1997
),
respectively, suggesting that tubular uptake of the two antivirals may
proceed below saturation of hOAT1. However, it should be noted that
Xenopus oocytes may exhibit a somewhat unique pattern of
post-translational modifications, which could result in some functional
differences between the native and expressed hOAT1. Therefore, it would
be important to study hOAT1 in a more relevant, e.g., mammalian,
expression system to confirm the suggested relationship between
pharmacokinetics and tubular transport of adefovir and cidofovir.
Nevertheless, the findings discussed above argue that hOAT1 can mediate
active accumulation of nucleoside phosphonates in human proximal
tubules and, thus, may be directly involved in the etiology of
cidofovir- and/or adefovir-associated nephrotoxicity.
Besides hOAT1, other renal transporters may also potentially contribute
to active tubular accumulation of these drugs. Among others, recently
identified rat organic anion transporting polypeptide (oatp) type 3 is
expressed almost exclusively in kidney, and transports organic anions
like thyroxine or taurocholic acid (Abe et al., 1998
). Closely related
rat oatp-1 and its human homolog are expressed in liver, as well as in
kidney, and transport steroid hormones, sulfobromophthalein, and other
organic anions (Jacquemin et al., 1994
; Kullak-Ublick et al., 1995
).
Another renal transporter OAT-K1 transports folate, methotrexate, and
nonsteroidal anti-inflammatory drugs (Saito et al., 1996
). Some
structural similarity was found between OAT-K1, oatp-1, and oatp-3
(Jacquemin et al., 1994
; Kullak-Ublick et al., 1995
; Saito et al.,
1996
; Abe et al., 1998
). Accordingly, they all exhibit low sensitivity
to probenecid and are unable to transport PAH. On the contrary, rOAT-2
expressed in liver and kidney is more likely to recognize nucleoside
phosphonates because of its broad substrate specificity, which includes
PAH and
-KG (Sekine et al., 1998
).
In addition to uptake across the basolateral membrane, efflux across
the apical membrane should also influence the steady-state tubular
accumulation of nucleoside phosphonates. The accumulation of nucleoside
phosphonates in kidney cortex suggests that the luminal efflux is
presumably the rate-limiting step in their tubular secretion pathway
(Cundy et al., 1996a
,b
). To date, it is not clear how the apical efflux
of PAH functions and whether nucleoside phosphonates share this route
with PAH. There are some suggestions that PAH/
-KG exchanger may be
present in human renal apical tubular membrane (Roch-Ramel, 1998
).
However, its relation to hOAT1 remains to be elucidated. Notably,
multidrug resistance-associated protein, which mediates ATP-dependent
efflux of hydrophobic anions, has been detected in the apical membrane
of kidney proximal tubules (Schaub et al., 1997
), suggesting that it
may be a potential candidate for mediating apical efflux of nucleoside phosphonates.
In summary, we cloned and characterized a human renal organic anion transporter and identified several novel substrates among a class of clinically important antivirals. Further characterization of the substrate specificity of hOAT1 may help to identify new potentially nephrotoxic agents. In addition, progress in elucidation of the structure/function relationships of hOAT1, including identification of its substrate/inhibitor binding domains, will be invaluable toward the rational design of novel, specific, and potent inhibitors that may serve as efficient nephroprotectants.
| |
Acknowledgments |
|---|
We thank Laura A. Hall from the National Institute of Environmental Health Sciences for invaluable technical assistance with the Xenopus oocyte expression assay experiments. We also thank Norbert Bischofberger and Mick Hitchcock from Gilead Sciences for helpful discussions and critical reading of the manuscript.
| |
Footnotes |
|---|
Received April 5, 1999; Accepted June 17, 1999
The nucleotide sequence reported in this paper has been submitted to the GenBank/EBI Data Bank with accession number AF124373.
Send reprint requests to: Dr. Tomas Cihlar, Gilead Sciences, 333 Lakeside Dr., Foster City, CA 94404. E-mail: tomas_cihlar{at}gilead.com
| |
Abbreviations |
|---|
rROAT1, rat renal organic anion transporter 1;
-KG,
-ketoglutarate;
bp, base;
CKII, casein kinase II;
EST, expressed sequence tag;
hPAHT, human p-aminohippurate
transporter;
kb, kilobase pair;
oatp, organic anion transporting
polypeptide;
OR-2, oocyte Ringer's 2;
PAH, p-aminohippurate;
PBS-M, phosphate-buffered saline/5%
dry milk;
PCR, polymerase chain reaction;
PKA, protein kinase A;
PKC, protein kinase C;
PMEG, 9-(2-phosphonylmethoxyethyl)guanine;
PMEDAP, 9-(2-phosphonylmethoxyethyl)diaminopurine;
RT-PCR, reverse
transcription-PCR;
SSC, sodium chloride/sodium citrate solution;
TK, tyrosine kinase;
UTR, untranslated region;
hOAT1, human renal organic
anion transporter 1;
mNKT(mROAT1), mouse renal organic anion
transporter 1;
fROAT1, winter flounder renal organic anion transporter
1.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. Duan and G. You Novobiocin Is a Potent Inhibitor for Human Organic Anion Transporters Drug Metab. Dispos., June 1, 2009; 37(6): 1203 - 1210. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Tsai, A. S. Ray, D. B. Tumas, M. J. Keating, H. Reiser, and W. Plunkett Targeting DNA Repair in Chronic Lymphocytic Leukemia Cells with a Novel Acyclic Nucleotide Analogue, GS-9219 Clin. Cancer Res., June 1, 2009; 15(11): 3760 - 3769. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Li, P. Duan, and G. You Regulation of human organic anion transporter 1 by ANG II: involvement of protein kinase C{alpha} Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E378 - E383. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Barros, C. Srimaroeng, J. L. Perry, R. Walden, N. Dembla-Rajpal, D. H. Sweet, and J. B. Pritchard Activation of Protein Kinase C{zeta} Increases OAT1 (SLC22A6)- and OAT3 (SLC22A8)-mediated Transport J. Biol. Chem., January 30, 2009; 284(5): 2672 - 2679. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. McSharry, M. R. Deziel, K. Zager, Q. Weng, and G. L. Drusano Pharmacodynamics of Cidofovir for Vaccinia Virus Infection in an In Vitro Hollow-Fiber Infection Model System Antimicrob. Agents Chemother., January 1, 2009; 53(1): 129 - 135. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhang, M. Hong, P. Duan, Z. Pan, J. Ma, and G. You Organic Anion Transporter OAT1 Undergoes Constitutive and Protein Kinase C-regulated Trafficking through a Dynamin- and Clathrin-dependent Pathway J. Biol. Chem., November 21, 2008; 283(47): 32570 - 32579. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. VanWert, C. Srimaroeng, and D. H. Sweet Organic Anion Transporter 3 (Oat3/Slc22a8) Interacts with Carboxyfluoroquinolones, and Deletion Increases Systemic Exposure to Ciprofloxacin Mol. Pharmacol., July 1, 2008; 74(1): 122 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Abla, L. W. Chinn, T. Nakamura, L. Liu, C. C. Huang, S. J. Johns, M. Kawamoto, D. Stryke, T. R. Taylor, T. E. Ferrin, et al. The Human Multidrug Resistance Protein 4 (MRP4, ABCC4): Functional Analysis of a Highly Polymorphic Gene J. Pharmacol. Exp. Ther., June 1, 2008; 325(3): 859 - 868. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Reiser, J. Wang, L. Chong, W. J. Watkins, A. S. Ray, R. Shibata, G. Birkus, T. Cihlar, S. Wu, B. Li, et al. GS-9219--A Novel Acyclic Nucleotide Analogue with Potent Antineoplastic Activity in Dogs with Spontaneous Non-Hodgkin's Lymphoma Clin. Cancer Res., May 1, 2008; 14(9): 2824 - 2832. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Cropp, T. Komori, J. E. Shima, T. J. Urban, S. W. Yee, S. S. More, and K. M. Giacomini Organic Anion Transporter 2 (SLC22A7) Is a Facilitative Transporter of cGMP Mol. Pharmacol., April 1, 2008; 73(4): 1151 - 1158. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Truong, G. Kaler, A. Khandelwal, P. W. Swaan, and S. K. Nigam Multi-level Analysis of Organic Anion Transporters 1, 3, and 6 Reveals Major Differences in Structural Determinants of Antiviral Discrimination J. Biol. Chem., March 28, 2008; 283(13): 8654 - 8663. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. VanWert, R. M. Bailey, and D. H. Sweet Organic anion transporter 3 (Oat3/Slc22a8) knockout mice exhibit altered clearance and distribution of penicillin G Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1332 - F1341. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bifano, J.-H. Yan, R. A. Smith, D. Zhang, D. M. Grasela, and F. LaCreta Absence of a Pharmacokinetic Interaction Between Entecavir and Adefovir J. Clin. Pharmacol., October 1, 2007; 47(10): 1327 - 1334. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Wolff, B. C. Burckhardt, G. Burckhardt, M. Oellerich, and V. W. Armstrong Mycophenolic acid (MPA) and its glucuronide metabolites interact with transport systems responsible for excretion of organic anions in the basolateral membrane of the human kidney Nephrol. Dial. Transplant., September 1, 2007; 22(9): 2497 - 2503. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Windass, S. Lowes, Y. Wang, and C. D. A. Brown The Contribution of Organic Anion Transporters OAT1 and OAT3 to the Renal Uptake of Rosuvastatin J. Pharmacol. Exp. Ther., September 1, 2007; 322(3): 1221 - 1227. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mizuno, T. Takahashi, Y. Iwase, H. Kusuhara, T. Niwa, and Y. Sugiyama Human Organic Anion Transporters 1 (hOAT1/SLC22A6) and 3 (hOAT3/SLC22A8) Transport Edaravone (MCI-186; 3-methyl-1-phenyl-2-pyrazolin-5-one) and Its Sulfate Conjugate Drug Metab. Dispos., August 1, 2007; 35(8): 1429 - 1434. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Y. Chu, K. Bleasby, J. Yabut, X. Cai, G. H. Chan, M. J. Hafey, S. Xu, A. J. Bergman, M. P. Braun, D. C. Dean, et al. Transport of the Dipeptidyl Peptidase-4 Inhibitor Sitagliptin by Human Organic Anion Transporter 3, Organic Anion Transporting Polypeptide 4C1, and Multidrug Resistance P-glycoprotein J. Pharmacol. Exp. Ther., May 1, 2007; 321(2): 673 - 683. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nozaki, H. Kusuhara, T. Kondo, M. Hasegawa, Y. Shiroyanagi, H. Nakazawa, T. Okano, and Y. Sugiyama Characterization of the Uptake of Organic Anion Transporter (OAT) 1 and OAT3 Substrates by Human Kidney Slices J. Pharmacol. Exp. Ther., April 1, 2007; 321(1): 362 - 369. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hong, F. Zhou, K. Lee, and G. You The Putative Transmembrane Segment 7 of Human Organic Anion Transporter hOAT1 Dictates Transporter Substrate Binding and Stability J. Pharmacol. Exp. Ther., March 1, 2007; 320(3): 1209 - 1215. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Imaoka, H. Kusuhara, M. Adachi, J. D. Schuetz, K. Takeuchi, and Y. Sugiyama Functional Involvement of Multidrug Resistance-Associated Protein 4 (MRP4/ABCC4) in the Renal Elimination of the Antiviral Drugs Adefovir and Tenofovir Mol. Pharmacol., February 1, 2007; 71(2): 619 - 627. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Belinsky, P. Guo, K. Lee, F. Zhou, E. Kotova, A. Grinberg, H. Westphal, I. Shchaveleva, A. Klein-Szanto, J. M. Gallo, et al. Multidrug Resistance Protein 4 Protects Bone Marrow, Thymus, Spleen, and Intestine from Nucleotide Analogue-Induced Damage Cancer Res., January 1, 2007; 67(1): 262 - 268. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Aslamkhan, D. M. Thompson, J. L. Perry, K. Bleasby, N. A. Wolff, S. Barros, D. S. Miller, and J. B. Pritchard The flounder organic anion transporter fOat has sequence, function, and substrate specificity similarity to both mammalian Oat1 and Oat3 Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1773 - R1780. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Vidal, J. C. Domingo, J. Guallar, M. Saumoy, B. Cordobilla, R. Sanchez de la Rosa, M. Giralt, M. L. Alvarez, M. Lopez-Dupla, F. Torres, et al. In Vitro Cytotoxicity and Mitochondrial Toxicity of Tenofovir Alone and in Combination with Other Antiretrovirals in Human Renal Proximal Tubule Cells Antimicrob. Agents Chemother., November 1, 2006; 50(11): 3824 - 3832. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xu, K. Tanaka, A.-q. Sun, and G. You Functional Role of the C Terminus of Human Organic Anion Transporter hOAT1 J. Biol. Chem., October 20, 2006; 281(42): 31178 - 31183. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. W. Schnabolk, G. L. Youngblood, and D. H. Sweet Transport of estrone sulfate by the novel organic anion transporter Oat6 (Slc22a20) Am J Physiol Renal Physiol, August 1, 2006; 291(2): F314 - F321. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kato, T. Maeda, T. Akaike, and I. Tamai Characterization of novel Na+-dependent nucleobase transport systems at the blood-testis barrier Am J Physiol Endocrinol Metab, May 1, 2006; 290(5): E968 - E975. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Eraly, V. Vallon, D. A. Vaughn, J. A. Gangoiti, K. Richter, M. Nagle, J. C. Monte, T. Rieg, D. M. Truong, J. M. Long, et al. Decreased Renal Organic Anion Secretion and Plasma Accumulation of Endogenous Organic Anions in OAT1 Knock-out Mice J. Biol. Chem., February 24, 2006; 281(8): 5072 - 5083. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hong, W. Xu, T. Yoshida, K. Tanaka, D. J. Wolff, F. Zhou, M. Inouye, and G. You Human Organic Anion Transporter hOAT1 Forms Homooligomers J. Biol. Chem., September 16, 2005; 280(37): 32285 - 32290. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C Whitley, D. H. Sweet, and T. Walle THE DIETARY POLYPHENOL ELLAGIC ACID IS A POTENT INHIBITOR OF hOAT1 Drug Metab. Dispos., August 1, 2005; 33(8): 1097 - 1100. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bleasby, L. A. Hall, J. L. Perry, H. W. Mohrenweiser, and J. B. Pritchard Functional Consequences of Single Nucleotide Polymorphisms in the Human Organic Anion Transporter hOAT1 (SLC22A6) J. Pharmacol. Exp. Ther., August 1, 2005; 314(2): 923 - 931. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Kearney, S. Ramanathan, A. K. Cheng, R. Ebrahimi, and J. Shah Systemic and Renal Pharmacokinetics of Adefovir and Tenofovir Upon Coadministration J. Clin. Pharmacol., August 1, 2005; 45(8): 935 - 940. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Srimaroeng, V. Chatsudthipong, A. G. Aslamkhan, and J. B. Pritchard Transport of the Natural Sweetener Stevioside and Its Aglycone Steviol by Human Organic Anion Transporter (hOAT1; SLC22A6) and hOAT3 (SLC22A8) J. Pharmacol. Exp. Ther., May 1, 2005; 313(2): 621 - 628. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Augustine, R. J. Markelewicz Jr., K. Boekelheide, and N. J. Cherrington XENOBIOTIC AND ENDOBIOTIC TRANSPORTER MRNA EXPRESSION IN THE BLOOD-TESTIS BARRIER Drug Metab. Dispos., January 1, 2005; 33(1): 182 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Tenney, S. M. Levine, R. E. Rose, A. W. Walsh, S. P. Weinheimer, L. Discotto, M. Plym, K. Pokornowski, C. F. Yu, P. Angus, et al. Clinical Emergence of Entecavir-Resistant Hepatitis B Virus Requires Additional Substitutions in Virus Already Resistant to Lamivudine Antimicrob. Agents Chemother., September 1, 2004; 48(9): 3498 - 3507. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Youngblood and D. H. Sweet Identification and functional assessment of the novel murine organic anion transporter Oat5 (Slc22a19) expressed in kidney Am J Physiol Renal Physiol, August 1, 2004; 287(2): F236 - F244. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Wright and W. H. Dantzler Molecular and Cellular Physiology of Renal Organic Cation and Anion Transport Physiol Rev, July 1, 2004; 84(3): 987 - 1049. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ljubojevic, C. M. Herak-Kramberger, Y. Hagos, A. Bahn, H. Endou, G. Burckhardt, and I. Sabolic Rat renal cortical OAT1 and OAT3 exhibit gender differences determined by both androgen stimulation and estrogen inhibition Am J Physiol Renal Physiol, July 1, 2004; 287(1): F124 - F138. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tanaka, W. Xu, F. Zhou, and G. You Role of Glycosylation in the Organic Anion Transporter OAT1 J. Biol. Chem., April 9, 2004; 279(15): 14961 - 14966. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bahn, C. Ebbinghaus, D. Ebbinghaus, E. G. Ponimaskin, L. Fuzesi, G. Burckhardt, and Y. Hagos EXPRESSION STUDIES AND FUNCTIONAL CHARACTERIZATION OF RENAL HUMAN ORGANIC ANION TRANSPORTER 1 ISOFORMS Drug Metab. Dispos., April 1, 2004; 32(4): 424 - 430. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sauvant, D. Hesse, H. Holzinger, K. K. Evans, W. H. Dantzler, and M. Gekle Action of EGF and PGE2 on basolateral organic anion uptake in rabbit proximal renal tubules and hOAT1 expressed in human kidney epithelial cells Am J Physiol Renal Physiol, April 1, 2004; 286(4): F774 - F783. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Eraly, K. T. Bush, R. V. Sampogna, V. Bhatnagar, and S. K. Nigam The Molecular Pharmacology of Organic Anion Transporters: from DNA to FDA? Mol. Pharmacol., March 1, 2004; 65(3): 479 - 487. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hannon, C. Isnard Bagnis, Y. Benhamou, H. Beaufils, M. Sullivan, C. Brosgart, H. Izzedine, T. Poynard, and G. Deray The renal tolerance of low-dose adefovir dipivoxil by lamivudine-resistant individuals co-infected with hepatitis B and HIV Nephrol. Dial. Transplant., February 1, 2004; 19(2): 386 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sauvant, H. Holzinger, and M. Gekle Short-Term Regulation of Basolateral Organic Anion Uptake in Proximal Tubular Opossum Kidney Cells: Prostaglandin E2 Acts via Receptor-Mediated Activation of Protein Kinase A J. Am. Soc. Nephrol., December 1, 2003; 14(12): 3017 - 3026. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. De Clercq Clinical Potential of the Acyclic Nucleoside Phosphonates Cidofovir, Adefovir, and Tenofovir in Treatment of DNA Virus and Retrovirus Infections Clin. Microbiol. Rev., October 1, 2003; 16(4): 569 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aslamkhan, Y.-H. Han, R. Walden, D. H. Sweet, and J. B. Pritchard Stoichiometry of organic anion/dicarboxylate exchange in membrane vesicles from rat renal cortex and hOAT1-expressing cells Am J Physiol Renal Physiol, October 1, 2003; 285(4): F775 - F783. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mizuno, T. Niwa, Y. Yotsumoto, and Y. Sugiyama Impact of Drug Transporter Studies on Drug Discovery and Development Pharmacol. Rev., September 1, 2003; 55(3): 425 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Sweet, L. M. S. Chan, R. Walden, X.-P. Yang, D. S. Miller, and J. B. Pritchard Organic anion transporter 3 (Slc22a8) is a dicarboxylate exchanger indirectly coupled to the Na+ gradient Am J Physiol Renal Physiol, April 1, 2003; 284(4): F763 - F769. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Aslamkhan, Y.-H. Han, X.-P. Yang, R. K. Zalups, and J. B. Pritchard Human Renal Organic Anion Transporter 1-Dependent Uptake and Toxicity of Mercuric-Thiol Conjugates in Madin-Darby Canine Kidney Cells Mol. Pharmacol., March 1, 2003; 63(3): 590 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Sauvant, H. Holzinger, and M. Gekle Short-Term Regulation of Basolateral Organic Anion Uptake in Proximal Tubular OK cells: EGF Acts via MAPK, PLA2, and COX1 J. Am. Soc. Nephrol., August 1, 2002; 13(8): 1981 - 1991. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Sweet, D. S. Miller, J. B. Pritchard, Y. Fujiwara, D. R. Beier, and S. K. Nigam Impaired Organic Anion Transport in Kidney and Choroid Plexus of Organic Anion Transporter 3 (Oat3 (Slc22a8)) Knockout Mice J. Biol. Chem., July 19, 2002; 277(30): 26934 - 26943. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Enomoto, M. Takeda, A. Tojo, T. Sekine, S. H. Cha, S. Khamdang, F. Takayama, I. Aoyama, S. Nakamura, H. Endou, et al. Role of Organic Anion Transporters in the Tubular Transport of Indoxyl Sulfate and the Induction of its Nephrotoxicity J. Am. Soc. Nephrol., July 1, 2002; 13(7): 1711 - 1720. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Motohashi, Y. Sakurai, H. Saito, S. Masuda, Y. Urakami, M. Goto, A. Fukatsu, O. Ogawa, and K.-i. Inui Gene Expression Levels and Immunolocalization of Organic Ion Transporters in the Human Kidney J. Am. Soc. Nephrol., April 1, 2002; 13(4): 866 - 874. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takeda, S. Khamdang, S. Narikawa, H. Kimura, Y. Kobayashi, T. Yamamoto, S. H. Cha, T. Sekine, and H. Endou Human Organic Anion Transporters and Human Organic Cation Transporters Mediate Renal Antiviral Transport J. Pharmacol. Exp. Ther., March 1, 2002; 300(3): 918 - 924. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. M. H. van Aubel, P. H. E. Smeets, J. G. P. Peters, R. J. M. Bindels, and F. G. M. Russel The MRP4/ABCC4 Gene Encodes a Novel Apical Organic Anion Transporter in Human Kidney Proximal Tubules: Putative Efflux Pump for Urinary cAMP and cGMP J. Am. Soc. Nephrol., March 1, 2002; 13(3): 595 - 603. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hill, T. Cihlar, C. Oo, E. S. Ho, K. Prior, H. Wiltshire, J. Barrett, B. Liu, and P. Ward The Anti-Influenza Drug Oseltamivir Exhibits Low Potential to Induce Pharmacokinetic Drug Interactions via Renal Secretion---Correlation of in Vivo and in Vitro Studies Drug Metab. Dispos., January 1, 2002; 30(1): 13 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lee, S. Dallas, M. Hong, and R. Bendayan Drug Transporters in the Central Nervous System: Brain Barriers and Brain Parenchyma Considerations Pharmacol. Rev., December 1, 2001; 53(4): 569 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Sweet, D. S. Miller, and J. B. Pritchard Ventricular Choline Transport. A ROLE FOR ORGANIC CATION TRANSPORTER 2 EXPRESSED IN CHOROID PLEXUS J. Biol. Chem., November 2, 2001; 276(45): 41611 - 41619. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Miller Nucleoside Phosphonate Interactions with Multiple Organic Anion Transporters in Renal Proximal Tubule J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 567 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Islinger, M. Gekle, and S. H. Wright Interaction of 2,3-Dimercapto-1-propane Sulfonate with the Human Organic Anion Transporter hOAT1 J. Pharmacol. Exp. Ther., November 1, 2001; 299(2): 741 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Pombrio, A. Giangreco, L. Li, M. F. Wempe, M. W. Anders, D. H. Sweet, J. B. Pritchard, and N. Ballatori Mercapturic Acids (N-Acetylcysteine S-Conjugates) as Endogenous Substrates for the Renal Organic Anion Transporter-1 Mol. Pharmacol., November 1, 2001; 60(5): 1091 - 1099. [Abstract] [Full Text] |
||||
![]() |
N. A. WOLFF, B. GRUNWALD, B. FRIEDRICH, F. LANG, S. GODEHARDT, and G. BURCKHARDT Cationic Amino Acids Involved in Dicarboxylate Binding of the Flounder Renal Organic Anion Transporter J. Am. Soc. Nephrol., October 1, 2001; 12(10): 2012 - 2018. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Sweet, K. T. Bush, and S. K. Nigam The organic anion transporter family: from physiology to ontogeny and the clinic Am J Physiol Renal Physiol, August 1, 2001; 281(2): F197 - F205. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liekens, J. Neyts, E. De Clercq, E. Verbeken, D. Ribatti, and M. Presta Inhibition of Fibroblast Growth Factor-2-induced Vascular Tumor Formation by the Acyclic Nucleoside Phosphonate Cidofovir Cancer Res., July 1, 2001; 61(13): 5057 - 5064. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Sweet, D. S. Miller, and J. B. Pritchard Basolateral localization of organic cation transporter 2 in intact renal proximal tubules Am J Physiol Renal Physiol, November 1, 2000; 279(5): F826 - F834. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Mulato, E. S. Ho, and T. Cihlar Nonsteroidal Anti-Inflammatory Drugs Efficiently Reduce the Transport and Cytotoxicity of Adefovir Mediated by the Human Renal Organic Anion Transporter 1 J. Pharmacol. Exp. Ther., October 1, 2000; 295(1): 10 - 15. [Abstract] [Full Text] |
||||
![]() |
S. Wada, M. Tsuda, T. Sekine, S. H. Cha, M. Kimura, Y. Kanai, and H. Endou Rat Multispecific Organic Anion Transporter 1 (rOAT1) Transports Zidovudine, Acyclovir, and Other Antiviral Nucleoside Analogs J. Pharmacol. Exp. Ther., September 1, 2000; 294(3): 844 - 849. [Abstract] [Full Text] |
||||
![]() |
E. S. HO, D. C. LIN, D. B. MENDEL, and T. CIHLAR Cytotoxicity of Antiviral Nucleotides Adefovir and Cidofovir Is Induced by the Expression of Human Renal Organic Anion Transporter 1 J. Am. Soc. Nephrol., March 1, 2000; 11(3): 383 - 393. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Pritchard, D. H. Sweet, D. S. Miller, and R. Walden Mechanism of Organic Anion Transport across the Apical Membrane of Choroid Plexus J. Biol. Chem., November 19, 1999; 274(47): 33382 - 33387. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||