Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

In the nervous system, different extracellular signals are often required to coordinate complex neuronal activities such as neurotransmission and cognition. The multitude of extracellular signals is usually detected by a variety of cell surface receptors that use distinct yet overlapping signal transduction mechanisms. The ability to integrate and process incoming signals is an important characteristic of neurons. The superfamily of G protein-coupled receptors (GPCRs) constitutes a large array of cell surface detectors for neurotransmitters, hormones, lipids, pheromones, and photons. Multiple GPCRs are often coexpressed in any particular cell type, where they regulate the levels of intracellular second messengers independently, in synergism, or by antagonism. Of the two most widely studied effectors of GPCRs, adenylyl cyclase and phospholipase C (PLC), intricate regulatory mechanisms for the former have been discerned.

The mechanism by which signals generated from different GPCRs become integrated inside the cell is best exemplified by the type 2 adenylyl cyclase. Type 2 adenylyl cyclase can be stimulated by the G protein -subunits only when it is already preactivated by either G_s (Federman et al., 1992) or protein kinase C-mediated phosphorylation (Tsu and Wong, 1996). Hence, the -subunits released on the activation of G_i-linked receptors can enhance the activity of type 2 adenylyl cyclase only if G_s- or G_q-linked receptors are simultaneously activated. This unique property of type 2 adenylyl cyclase allows it to integrate and process signals from various GPCRs, perhaps providing a temporal distinction of the different inputs (Lustig et al., 1993a).

Equally important for coordinating cellular functions is the regulation of PLC that generates diacylglycerol and inositol phosphate (IP)₃, leading to the activation of protein kinase C and calcium mobilization. Many GPCRs stimulate PLC-isozymes through coupling to G proteins belonging to the G_q subfamily (Rhee and Bae, 1997). The regulation of PLC-isozymes by GPCRs bears some similarity to those of adenylyl cyclase. For instance, PLC can be stimulated by the -subunits of all G_q subfamily members as well as by the -dimers (Smrcka and Sternweis, 1993; Nakamura et al., 1995). The 2 and 3 isoforms of PLC are especially responsive to stimulation by -subunits. However, most G_i-coupled receptors are incapable of activating PLC despite their ability to generate free -subunits. In many biological systems such as the smooth muscles and cultured astrocytes, although activation of G_i-coupled receptors alone has no effect, it augments G_q-mediated responses (for review, see Selbie and Hill, 1998). The augmentation produced by the stimulation of G_i-coupled receptors is presumably mediated by the -dimers (Biber et al., 1997). These observations suggest that the -subunits released on the activation of G_i are insufficient to stimulate PLC, and other signals or conditions may be required. A distinct possibility is that PLC can integrate signals from G_i-, G_s-, and G_q-linked receptors in a manner akin to the one used by the type 2 adenylyl cyclase. In the course of examining the coupling of opioid receptors to G₁₆ (Lee et al., 1998), we noticed that although the opioid-induced response was mediated via G₁₆, it was partially sensitive to pertussis toxin (PTX) treatment. In this report, we describe our efforts to decipher the molecular mechansim behind such PTX sensitivity. Our results suggest that when PLC is preactivated by the -subunits of G_q, G₁₄, or G₁₆, it becomes responsive to stimulation by -dimers. Such a precondition by which G_i-linked receptors can stimulate PLC may have important mechanistic implications on signal processing by PLC.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

Reagents. cDNAs encoding the formyl peptide (fMLP) and -opioid receptors were kindly provided by F. Boulay (LBIO/Laboratoire, France) and C. Evans (UCLA), respectively. The bombesin and -opioid receptors were gifts from J. Battey (National Institute of Neurological Disorders and Stroke) and G. Bell (University of Chicago, IL), respectively. The cDNA encoding the -subunit of G_L1 (the bovine homolog of G₁₄; henceforth referred to as G₁₄ for generality) was generously provided by Dr. T. Nukada (Tokyo Institute of Psychiatry, Japan). The origin and construction of other cDNAs have been described elsewhere (Wong et al., 1992; Lee et al., 1998). PTX and plasmid purification columns were purchased from List Biological Laboratories (Campbell, CA) and Qiagen (Hilden, Germany), respectively. COS-7 cells were obtained from the American Type Culture Collection (ATCC CRL-1651). [³H]Myo-inositol was obtained from DuPont-NEN (Boston, MA). Receptor agonists and staurosporin were purchased from Research Biochemicals (Natick, MA). Antisera against G_q/11 (3A-180) and G₁₄ (3A-195) were purchased from Gramsch Laboratories (Schwabhausen, Germany). Antiserum G51820 against G_t1 was from Transduction Laboratories (Lexington, KY). Cell culture reagents were obtained from Life Technologies (Grand Island, NY) and all other chemicals were purchased from Sigma Chemical Co. (St. Louis, MO).

Construction of G₁₆Q212L and G₁₄R179C Mutants. Polymerase chain reactions (PCRs) were used to generate the two mutants. The cDNAs subjected to site-directed mutagenesis were subcloned into pcDNAI (Invitrogen, San Diego, CA), which contained T7 and SP6 promoter sequences as flanking priming regions. Human G₁₆ and bovine G₁₄ were used to generate G₁₆Q212L (G₁₆QL) and G₁₄R179C (G₁₄RC). Primers encoding the desired mutations were listed below with the mismatch nucleotides underlined: 16-QL/S: GACGTCGGAGGCCTGAAGTCAGAGCGT; 16-QL/AS: ACGCTCTGACTTCAGGCCTCCGACGTC; 14-RC/S: GTGCTCCGTGTCTGCGTGCCCACCACT; 14-RC/AS: AGTGGTGGGCACGCAGACACGGAGCAC. Two overlapping fragments that contained the mutation in their overlapping region were amplified separately with thermal cycling at 94°C (1 min)/50°C (1 min)/72°C (1 min) for 30 cycles with Robocycler 40 from Stratagene (La Jolla, CA). The PCR products were annealed together and the full-length fragments were made with the flanking primers. Extension time was increased to 1.5 min/cycle. Full-length G₁₆QL was ligated into EcoRV-cut pcDNAI, whereas G₁₄RC was subcloned into pcDNAI as a PstI/XbaI cassette. DNA sequences of the mutants were checked by dideoxynucleotide sequencing method with Sequenase V2.0 kit.

Transient Transfection and IP Assay. COS-7 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (v/v), 50 U/ml penicillin, and 50 µg/ml streptomycin, and grown at 37°C in an environment of 5% CO₂. Cells were seeded in 12-well plates at a density of ~1 × 10⁵ cells/ml and were transfected with the appropriate cDNAs 24 h later by means of the DEAE-dextran method (Wong, 1994). One day later, the transfected cells were labeled with [³H]myo-inositol (2.5 µCi/ml) in inositol-free DMEM (0.75 ml/well) containing 5% fetal calf serum (v/v) for 18 to 24 h. Where necessary, PTX (100 ng/ml) was added together with the radiolabel. Labeled cells were rinsed with 2 ml of assay medium (20 mM HEPES-buffered DMEM with 20 mM LiCl) followed by incubation at 37°C for 1 h in 1 ml of assay medium with the indicated drugs. The reaction was terminated by aspiration and addition of 0.75 ml of 20 mM formic acid. IP production was estimated by determining the ratio of [³H]IP to [³H]inositol plus [³H]IP as described previously (Tsu et al., 1995b).

Preparation of Plasma Membranes and Immunodetection of G-Subunits. COS-7 cells were grown on 150-mm dishes to 70 to 80% confluence and transfected as described for 12-well plates with proper adjustments to the volumes and amounts of the reagents used. Transfected cells were harvested 48 h later in PBS (Ca²⁺ and Mg²⁺ free) containing 10 mM EDTA. Cells were resuspended in lysis buffer (50 mM Tris-HCl containing 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine-HCl, 1 mM EGTA, 5 mM MgCl₂, and 1 mM dithiothreitol, pH 7.4) and lysed by one cycle of freeze-thawing followed by 10 passages through a 27-gauge needle. After removal of nuclei by centrifugation, membranes were collected, washed, and resuspended in lysis buffer. Protein concentrations were determined with the Bio-Rad protein assay kit. For each sample, 50 µg of membrane proteins was separated on a 12.5% polyacrylamide SDS gel and electrophorectically transferred to polyvinylidene difluoride membranes. Localization of protein markers on the polyvinylidene difluoride membrane was by Ponceau S staining. Antigen-antibody complexes were visualized by chemiluminescence with the enhanced chemiluminescence kit from Amersham (Arlington Heights, IL).

Data Analysis. The IP levels were interpreted as the ratios of the counts per minute of [³H]IP fractions to those of the total labeled inositol fractions and expressed as the ratio of [³H]IP over total [³H]inositols. Absolute values for IP accumulations varied between experiments, but variability within a given experiment was in general <10%. Data shown in the figures are means ± S.D. of triplicates within one single experiment. At least three independent experiments yielded similar results. Bonferroni t test with 95% confidence was adopted to verify the significance between different treatment groups within the experiments.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

G₁₆-Mediated Stimulation of PLC by G_i-Coupled Receptors Is Partially Sensitive to PTX Treatment. It has recently been shown that the -opioid receptor (DOR) can efficiently stimulate the formation of IP in COS-7 cells when it is coexpressed with G₁₆ (Lee et al., 1998). As a member of the G_q subfamily, G₁₆ lacks the ADP ribosylation site and is resistant to modification by PTX. G₁₆-mediated stimulation of PLC should thus be PTX-insensitive. Surprisingly, when we examined the ability of DOR to stimulate PLC via G₁₆ in transiently transfected COS-7 cells, the agonist-induced response was partially reduced by PTX. In the absence of PTX treatment, the -selective agonist [D-Pen^2,5]enkephalin (DPDPE) stimulated IP formation by 9-fold (Fig. 1). Pretreatment of transfected COS-7 cells with PTX suppressed the G₁₆-mediated response by 55%. Three other G_i-coupled receptors that are incapable of activating PLC in the absence of G₁₆ also were examined. COS-7 cells were cotransfected with cDNAs encoding G₁₆ and the fMLP, opioid receptor-like (ORL₁), or A₁ adenosine receptor. Like DOR, the ability of these G_i-coupled receptors to stimulate PLC via G₁₆ was attenuated by PTX (Fig. 1). Receptor-selective agonists induced 6- to 8-fold stimulation of PLC activity, but these G₁₆-mediated responses were partially sensitive to PTX treatment. In COS-7 cells coexpressing the -opioid receptor (KOR) and G₁₆, U50,488 (a -selective agonist) stimulated IP accumulation in a dose-dependent manner (Fig. 2A). Again, PTX treatment reduced the U50,488-induced IP formation by ~60% and raised the EC₅₀ of U50,488 for G₁₆-mediated stimulation of PLC from ~60 nM to ~200 nM (Fig. 2A). A similar shift in EC₅₀ values also was observed with DOR (J.W.M.L. and Y.H.W., unpublished data) and it may reflect the efficiency of coupling solely to the transfected G₁₆. The potency with which PTX affects the opioid-induced stimulation of PLC and inhibition of adenylyl cyclase was approximately the same. The EC₅₀ of PTX in suppressing the G₁₆-mediated stimulation of PLC was 0.3 ng/ml, whereas PTX blocked the opioid-induced inhibition of adenylyl cyclase with an EC₅₀ of 0.5 ng/ml (data not shown).

View larger version (26K): [in this window] [in a new window]   Fig. 1.   G16-mediated stimulation of PLC by Gi-coupled receptors is PTX-sensitive. COS-7 cells were cotransfected with cDNAs encoding G16 and a Gi-coupled receptor: DOR, fMLPR, ORL1R, or A1R (each at 0.25 µg/ml). After 24 h, the cells were labeled overnight with 2.5 µCi/ml [3H]myo-inositol with or without 100 ng/ml PTX as indicated. IP production was assayed in the absence or presence of an agonist: 100 nM DPDPE, 200 nM fMLP, 100 nM nociceptin, or 10 µM (+)-N6-(2-phenylisopropyl)-adenosine. *, agonist significantly increased IP accumulation over basal values. **, PTX significantly reduced the agonist-induced response; n = 3, Bonferroni t test, P < .05.

View larger version (29K): [in this window] [in a new window]   Fig. 2.   Permissive stimulation of PLC by opioid receptors through G16 is agonist dose-dependent and can be inhibited by Gt1. A, COS-7 cells were transfected and labeled as in (A) but with KOR instead of the other receptors. IP production increased dose-dependently with increasing concentrations of the KOR agonist U50,488 (0-3 µM). B, COS-7 cells were cotransfected with the DOR and G16 cDNAs (both at 0.25 µg/ml) only or with varying concentrations of Gt1 (0.25 to 0.75 µg/ml). Cells were assayed for IP production in the absence or presence of 100 nM DPDPE. *, all concentrations of Gt1 significantly reduced the DPDPE-induced IP accumulation; n = 3, Bonferroni t test, P < .05. Bottom, expression of Gt1 and G16 in the transfected cells as determined by immunodetection with antisera G51820 and 3A-180, respectively.

Involvement of -Subunits. The PTX sensitivity of the DPDPE response suggests the involvement of G_i proteins. Activation of G_i proteins by DOR will invariably lead to the dissociation of the - and -subunits. Because none of the G_i-subunits possess the ability to directly activate PLC, they are unlikely to stimulate the formation of IP. In contrast, the -dimer is known to regulate a host of effectors, including different isoforms of PLC (for review, see Clapham and Neer, 1997). To test if -subunits are involved in the G₁₆-dependent stimulation of PLC by DOR, we attempted to block the agonist-induced response with a -scavenger, the -subunit of transducin (G_t1). When G_t1 was transiently coexpressed with DOR and G₁₆, the DPDPE-induced response was suppressed by 60% (Fig. 2B). The extent of suppression by G_t1 was similar to that produced by PTX. Increasing the concentration of G_t1 cDNA used in the transfections from 0.25 µg/ml to 0.75 µg/ml did not further attenuate the DPDPE-induced response. The expression of G_t1 was confirmed by immunodetection with a G_t-specific antiserum (Fig. 2B). In our heterologous expression system, overexpression of G_t1 did not affect the expression level of G₁₆ (Fig. 2B). Coexpression of another -scavenger, the carboxyl fragment of -adrenergic receptor kinase (ARK_495-690), with DOR and G₁₆ also suppressed the DPDPE-induced response by ~40% (data not shown). Such experiments implicate the involvement of -subunits.

Constitutively Active G-Mutants Permit G_i-Linked Receptors to Stimulate PLC. Because DOR is incapable of stimulating endogenous PLC in the absence of G₁₆ (Lee et al., 1998), somehow the expression of G₁₆ allowed the endogenous PTX-sensitive G proteins to participate in the activation of PLC. Interestingly, mechanisms exist for permissive activation of effectors. The type 2 adenylyl cyclase can be stimulated by G protein -dimers when it is preactivated by G_s·GTP (Federman et al., 1992) or by protein kinase C-mediated phosphorylation (Tsu and Wong, 1996). It is conceivable that similar mechanisms exist for the regulation of PLC. This might explain why -complexes can participate in the stimulation of PLC when G₁₆ was coexpressed with DOR, but cannot do so in the absence of G₁₆. By drawing an analogy to the type 2 adenylyl cyclase system, we tested whether preactivation of PLC allows G_i-linked receptors to subsequently stimulate PLC. To induce preactivation of PLC, COS-7 cells were cotransfected with cDNAs encoding DOR and G₁₆QL, a constitutively activated mutant of G₁₆ (Heasley et al., 1996). Because G₁₆QL is "locked" in the GTP-bound state, it is relatively unresponsive to activation by DOR compared with G₁₆ wild-type. In the absence of any opioid agonist, G₁₆QL-expressing cells exhibited higher basal PLC activity, which is indicative of the constitutive activity of G₁₆QL (Fig. 3). Application of 100 nM DPDPE to the transfected cells further enhanced the IP formation by ~90%. The DPDPE-induced enhancement was completely PTX-sensitive (Fig. 3), indicating the involvement of G_i proteins instead of G₁₆. These results imply that when PLC is activated by G₁₆QL, it may then become responsive to stimulation by G_i-linked receptors through a G_i-mediated mechanism. This mechanism might involve the -subunits because coexpression of ₁₂ with G₁₆QL significantly increased the basal PLC activity by 25.7 ± 2.9% (n = 4; P < .05 by paired t test) compared with that obtained with the expression of G₁₆QL alone. No enhancement of G₁₆QL activity was observed by coexpressing the nonfunctional ₃₂-complex.

View larger version (30K): [in this window] [in a new window]   Fig. 3.   Constitutively active G-mutants permit stimulation of PLC by DOR. COS-7 cells were cotransfected with 0.25 µg/ml DOR and one of the following cDNAs: G16QL, GqRC, or G14RC (all at 0.15 µg/ml). After labeling with or without 100 ng/ml PTX, IP accumulation was assayed in the absence (basal) or presence of 100 nM DPDPE. *, DPDPE significantly increased IP production beyond basal levels; n = 3, Bonferroni t test, P < .05.

View larger version (32K): [in this window] [in a new window]   Fig. 4.   DPDPE-induced PLC-activation is protein kinase C-independent. COS-7 cells were transfected with 0.25 µg/ml DOR alone or together with one of the following: GsRC (0.25 µg/ml), GqWT (0.25 µg/ml), or GqRC (0.1 µg/ml). After labeling with [3H]myo-inositol, cells transfected with DOR alone were treated with 100 nM PMA. Where indicated, DOR/GqRC-transfected cells were pretreated with 500 nM staurosporin (stauro). After 15 min of pretreatment, cells were assayed for IP accumulation in the absence (basal) or presence of 100 nM DPDPE. *, DPDPE significantly enhanced IP production over basal values; n = 3, Bonferroni t test, P < .05.

View larger version (26K): [in this window] [in a new window]   Fig. 5.   cDNA dose-dependence of G14RC-mediated permissive activation of PLC by DOR. COS-7 cells were cotransfected with DOR (0.25 µg/ml), and varying concentrations of G14RC cDNAs (3 ng/ml to 5 µg/ml). Cells were then labeled and assayed with or without 100 nM DPDPE. Inset shows the expression of G14RC in cells transfected with the seven different doses of cDNA was determined by Western blot analysis with a G14-specific antiserum 3A-195.

View larger version (21K): [in this window] [in a new window]   Fig. 6.   DPDPE dose-dependently increases IP formation in cells coexpressing DOR and mutants of Gq, G16, or G14. COS-7 cells were cotransfected with cDNAs encoding DOR (0.25 µg/ml) and GqRC, G16QL (both at 0.1 µg/ml), or G14RC (0.25 µg/ml). The cells were labeled and stimulated with varying concentrations of DPDPE (0-200 nM for GqRC and 0-300 nM for G16QL or G14RC).

View larger version (30K): [in this window] [in a new window]   Fig. 7.   Permissive activation of PLC by other Gi-coupled receptors in the presence of GqRC. COS-7 cells were cotransfected either with GqWT (0.25 µg/ml) or GqRC (0.1 µg/ml) and either the fMLP or ORL1 receptor cDNAs (both at 0.25 µg/ml). After transfection, the cells were labeled in the absence or presence of 100 ng/ml PTX as indicated. IP accumulation was assayed in the absence (basal) or presence of agonist (200 nM fMLP or 100 nM nociceptin). *, agonist-induced responses were significantly higher than the corresponding basal values; n = 3, Bonferroni t test, P < .05.

Synergism between G_i- and G_q-Linked Receptors on PLC-Activity. Given that G_i-linked receptors can stimulate PLC-activity in the presence of G_qRC, they should be able to enhance signals derived from the activation of G_q-linked receptors. We tested this hypothesis by substituting G_qRC with either an endogenously or recombinantly expressed G_q-linked receptor. COS-7 cells were found to endogenously express a purinergic P2Y receptor. Over a concentration range from 0.1 to 300 µM, ATP dose-dependently stimulated the formation of IP (data not shown but they were similar to those presented in Fig. 8). Preliminary characterization with selective antagonists indicated that this purinergic receptor belongs to the P2Y₂ class (North and Barnard, 1997); suramin hexasodium blocked the ATP-induced stimulation of IP formation, whereas pyridoxal-phosphate-6-azophenyl-2',4'-disulphonic acid tetrasodium was ineffective (data not shown). The P2Y₂ receptor is known to stimulate PLC via G_q/11 proteins and is expressed in the kidney (Lustig et al., 1993b), which is the tissue origin of COS-7 cells. In COS-7 cells transiently expressing DOR, DPDPE alone did not stimulate IP formation (Lee et al., 1998), whereas ATP dose-dependently elevated the IP levels by ~4-fold with an EC₅₀ of ~6 µM (Fig. 8). When both -opioid and P2Y₂ receptors were simultaneously activated, the resultant IP accumulation was significantly greater than that obtained by activating P2Y₂ receptors alone (Fig. 8). Addition of 100 nM DPDPE to the ATP dose-response curve raised the maximal stimulation by ~65% with no change on the EC₅₀ value (~5 µM; Fig. 8). The DPDPE-induced enhancement of the P2Y₂ receptor-mediated stimulation of PLC was completely inhibited by PTX (Fig. 9).

View larger version (22K): [in this window] [in a new window]   Fig. 8.   Synergistic activation of PLC by Gq- and Gi-coupled receptors. COS-7 cells were transfected with DOR alone (top) or together with either the bombesin receptor or muscarinic m1 receptor (all cDNAs at 0.25 µg/ml). After transfection, the cells were labeled overnight and assayed for IP accumulation with varying concentrations of ATP (0-300 µM; the agonist for endogenous P2Y2 receptors), bombesin (0-1 µM), or carbachol (0-200 µM; the m1 receptor agonist), with or without 100 nM DPDPE. Agonist stimulation of PLC with or without DPDPE was in all cases dose-dependent. DPDPE increased the maximal response of Gq-coupled receptor agonists alone.

View larger version (29K): [in this window] [in a new window]   Fig. 9.   The synergistic effect produced by DPDPE is abolished by PTX. COS-7 cells were transfected as in Fig. 8 but treated with or without 100 ng/ml PTX as indicated. IP production was assayed with 100 µM ATP, 100 nM bombesin, or 200 µM carbachol with or without 100 nM DPDPE. *, DPDPE significantly enhanced IP production; n = 3, Bonferroni t test, P < .05. The DPDPE induced increase in IP accumulation was in all cases abolished by PTX.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

The complex network of signal transduction pathways regulated by GPCRs must possess critical loci for signal integration and processing. Synergistic cross talk interactions between G_i/G_s- and G_q-coupled receptors may provide a mechanism for the fine-tuning of signals generated from GPCRs. For example, activation of the G_i-linked adenosine A₁ receptor augments the stimulation of PLC evoked by G_q-linked receptors such as ₁-adrenergic, bradykinin, histamine H₁, and muscarinic receptors (for review, see Selbie and Hill, 1998). Often, stimulation of G_i-coupled receptors alone has no effect, but augments G_q-mediated responses when both are stimulated concurrently. The present study provides a mechanistic basis for synergistic cross talk between G_q- and G_i-coupled receptors because preactivation of PLC by the -subunit of G_q subfamily members apparently allows -dimers to further stimulate PLC.

Several observations support our notion that preactivation of PLC permits subsequent stimulation by G_i-coupled receptors. First, DOR could not stimulate PLC in COS-7 cells unless activated G-subunits of the G_q subfamily are available. Active G-subunits can be provided in the form of constitutively active mutants (G_qRC, G₁₆QL, and G₁₄RC) or generated through receptor coupling to the promiscuous G₁₆. Second, the constitutively active G_s-mutant did not permit DPDPE to stimulate PLC. Third, in the presence of a mutationally activated -subunit of the G_q subfamily, DPDPE-induced enhancement of IP production occurs in a dose-dependent and PTX-sensitive manner. Fourth, concurrent activation of G_q- and G_i-linked receptors resulted in significantly higher PLC activities compared with stimulating a G_q-linked receptor alone. And fifth, the G₁₆-dependent stimulation of PLC by DOR was partially sensitive to PTX, suggesting dual mechanisms of activation of PLC. Collectively, these results indicate that PLC can integrate coincident signals in much the same way as the type 2 adenylyl cyclase, where prior activation by one type of signal allows subsequent detection of other signals.

The mechanism by which G_i-linked receptors synergise with G_q-mediated stimulation of PLC appears to involve the -dimer. It is well established that the -dimer can directly activate PLC1- to 3-isozymes and the sensitivity of PLC-isozymes to -subunits decreases in the order PLC3 > 2 > 1 (for review, see Rhee and Bae, 1997). In the present study, there are strong indications for the involvement of -subunits in mediating the synergistic effects of G_i- and G_q-coupled receptors on PLC. The synergistic effect can be potently inhibited by G_t1, a known scavenger of -subunits. Moreover, the EC₅₀ for DPDPE to stimulate PLC in the presence of activated G_q-subunits (10-50 nM; Fig. 6) is much higher than that required for its inhibitory effect on adenylyl cyclase (~1 nM; Tsu et al., 1995b). This is in agreement with the concept that the EC₅₀ for a -mediated response is considerably higher than responses mediated through the corresponding -subunits (Iñiguez-Lluhi et al., 1993). Likewise, adenosine A₁ receptor-mediated potentiation of PLC activity in cultured astrocytes requires higher concentrations of agonist than for adenylyl cyclase inhibition (Biber et al., 1997).

It is not clear by which mechanism preactivation of PLC allows subsequent stimulation by -subunits. Activation of PLC by G_q requires the C-terminal extension unique to the -isozymes (Park et al., 1993; Wu et al., 1993), whereas interacts with the pleckstrin homology and EF-hand domains (Kuang et al., 1996). Reconstitution experiments have demonstrated that the effects of G_q and on PLC3 are additive (Smrcka and Sternweis, 1993). The present study provides evidence that, in intact cells, regulation of PLC by activated G_q may modulate its responsiveness to -dimers. Structural information on the PLC-isozymes in the future will hopefully resolve how the binding of G_q might modulate the -binding site.

Unlike the type 2 adenylyl cyclase, phosphorylation of PLC by protein kinase C does not permit subsequent stimulation by -dimers. Although avian PLC is phosphorylated by protein kinase C in vivo, it is accompanied by a concomitant loss of enzyme activity (Filtz et al., 1999). Because the role of G_qRC in permitting DOR to stimulate PLC could not be substituted by phorbol ester treatment, and that the response was not suppressed by staurosporin, the G_i-mediated enhancement did not seem to require the activation of protein kinase C. However, these studies do not exclude the possibility that protein kinase C can regulate long-term potentiation of PLC-activity (Schmidt et al., 1998) or suppress receptor-induced stimulation of PLC mediated via G₁₆ (Aragay and Quick, 1999).

It is well documented that in many cells and tissues, G_i- and G_s-coupled receptors rarely stimulate PLC on their own. COS-7 cells endogenously express the PLC1 and PLC3, but not PLC2 (Katz et al., 1992). Both 1 and 3 isoforms can be efficiently stimulated by G_q, but only PLC3 can exhibit augmentation by -dimers (Smrcka and Sternweis, 1993). With a 10-fold greater potency, only G_q-mediated signals can efficiently stimulate PLC in COS-7 cells. If preactivation facilitates the -mediated stimulation of PLC, then those G_i-coupled receptors that possess a weak ability to activate G_q will be able to induce a PLC-response. An example of such an occurrence is the ₂-adrenergic receptor (Conklin et al., 1992). Efficient stimulation of PLC2 by G_i-linked receptors in some cell types (e.g., HL-60; Camps et al., 1992; Katz et al., 1992) suggests that this isoform probably does not require preactivation for -mediated stimulation. Supportive evidence from fluorescence spectroscopy indicates that -dimers bind to PLC2 more tightly than to 1 or 3 (Runnels and Scarlata, 1999). Moreover, it has been shown that recombinant G₁₆ and G_q do not change the sensitivity of PLC2 to stimulation by -dimers (Kozasa et al., 1993). Whether preactivation-dependent, -mediated stimulation of PLC is generally applicable to 1-3 isoforms, or if these isozymes are indeed differentially regulated, would require further studies.

The need of preactivation for -dimers to efficiently stimulate PLC in intact cells has major mechanistic implications on signal processing via the PLC-pathway. In the absence of stimulation by G_q, PLC (perhaps except the 2 subtype) is relatively nonresponsive to free -dimers, hence activation of G_i-coupled receptors will only lead to the regulation of adenylyl cyclase (Fig. 10A). This might explain why many G_i-coupled receptors require the coexpression of PLC2 in COS-7 cells to manifest a -mediated stimulation of IP formation (Lee et al., 1993). Activation of a G_q-coupled receptor will generate two signaling components, G_q- and the -dimer, that exhibit differential abilities to stimulate PLC (Fig. 10B). Costimulation of G_i- and G_q-linked receptors will produce a stronger stimulation of PLC because the -subunits released from G_i activation can now augment the G_q-derived signal (Fig. 10C). The G_i-linked adenosine A₁ receptor can certainly augment IP signals generated from a variety of G_q-linked receptors (Selbie and Hill, 1998). The present study shows that DOR can augment the PLC-activities evoked by purinoceptor, muscarinic, or bombesin receptors. In the central nervous system, cholecystokinin has been reported to enhance the analgesic potentials of opioid peptides (Noble et al., 1993). Because the cholecystokinin receptors are typically coupled to G_q, and opioid receptors are associated with G_i proteins, it is conceivable that PLC may act as the point of signal convergence in neurons where both receptors are colocalized. Last, a single receptor that can activate both G_i and G₁₆ should be able to stimulate the PLC-activity efficiently (Fig. 10D). Because part of the signal is derived from G_i, the overall response should be partially sensitive to PTX treatment. Examples of such observations can be readily found. G₁₆-dependent signaling by the P2Y₁ purinoceptor (Baltensperger and Porzig, 1997) and leukotriene B₄ receptor (Gaudreau et al., 1998) are indeed partially sensitive to PTX. These results are in good agreement with our findings on the PTX sensitivity of the G₁₆-mediated stimulation of PLC by DOR. Although G₁₆ is not expressed in the central nervous system, it colocalizes with neuropeptide receptors, such as the opioid receptors, in a number of hematopoietic cells. The mechanism depicted in Fig. 10D may in fact be applicable to neuropeptides involved in the modulation of immune and endocrine responses.

View larger version (33K): [in this window] [in a new window]   Fig. 10.   Mechanistic models in which Gi-coupled receptors can activate PLC in the absence or presence of costimulation by Gq-coupled receptors. Four models (A-D) for the activation of PLC by Gi-released -subunits are depicted. For simplicity, the adenylyl cyclase (AC) isoforms are assumed to be nonresponsive to -dimers. H, hormone; Ri, Gi-coupled receptor; Rq, Gq-coupled receptor. Arrows indicate activation of signaling pathways. Inactive PLC is shown as a rectangle, whereas activated isoforms are illustrated as ovals.

In conclusion, this study provides evidence that augmentation of G_q-stimulated PLC-activity by G_i-linked receptors requires preactivation. The proposed mechanism resembles the one used by type 2 adenylyl cyclase. Signal integration by cells or neurons is a complex and delicate process that often requires fine-tuning to discern an array of incoming signals. Temporal summation of various signals allows a cell to reinforce critical inputs and perhaps to establish itself as part of a distinct neural circuit. We envisage that many G_i- and G_s-coupled receptors when costimulated with G_q-coupled receptors can produce synergistic actions on PLC in neurons and other target cells.