![]() |
|
|
Vol. 57, Issue 5, 961-967, May 2000
1A-Adrenergic Receptor Stimulation in PC12 Cells
Department of Pharmacology, Emory University, Atlanta, Georgia
| |
Abstract |
|---|
|
|
|---|
In PC12 cells stably expressing
1A-adrenergic receptors
(ARs), norepinephrine (NE) activates several mitogen-activated protein kinase pathways and causes differentiation (Williams et al., 1998
). Using retroviral luciferase reporters, we found that NE also activated both signal transducers and activators of transcription (Stat) and
-interferon-activated sequence-mediated transcriptional
responses, with maximal effects similar to those caused by
interleukin-6 (IL-6). UTP and epidermal growth factor had no effect,
whereas nerve growth factor caused a small Stat activation. Responses to NE were blocked by prazosin and depended on receptor density. Responses to NE were not blocked by inhibitors of mitogen-activated protein kinase kinase (PD98059), protein kinase C (GFX203290), Src (PP2), Jak2 (AG490), or the calcium chelator
1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid. The p38 mitogen-activated protein kinase inhibitors
SB202190 and SB203580 blocked Stat activation by NE, the epidermal
growth factor receptor inhibitor AG1478 caused a small inhibition, but the phosphoinositide 3 kinase inhibitor LY294002 potentiated both responses. Gel shifts confirmed formation of nuclear factors binding to
both Stat and
-interferon-activated sequence consensus sequences in
response to NE and IL-6. Immunoprecipitation experiments showed that
IL-6 increased tyrosine phosphorylation of Stat1 and Stat3 in PC12
cells, whereas NE caused a sustained increase in tyrosine phosphorylation of Stat1. These results suggest that
1A-AR stimulation causes Stat-mediated transcriptional
responses in PC12 cells that are not downstream of known second
messenger or tyrosine kinase pathways.
| |
Introduction |
|---|
|
|
|---|
1-Adrenergic
receptors (ARs) are members of the G protein-coupled receptor (GPCR)
superfamily. There are three closely related
1-AR subtypes (
1A,
1B, and
1D), all of
which couple to the Gq/11 family of G proteins,
thereby activating phospholipase C
and generating the second
messengers inositol-1,4,5-trisphosphate and diacylglycerol (Zhong and
Minneman, 1999a
). These second messengers release stored intracellular
calcium and activate protein kinase C, respectively, mechanisms that
are thought to underlie most cellular responses to
1-ARs.
We have recently been studying the mitogenic actions of
1-ARs stably expressed in PC12 cells.
1-ARs, like other GPCRs, activate mitogenic
responses in many cells, and play important roles in regulating growth
and proliferation (Zhong and Minneman, 1999a
). In rat PC12 cells
transfected with
1A-ARs, norepinephrine (NE) activates a variety of mitogen-activated protein kinase (MAPK) pathways
and causes the cells to differentiate into a neuronal-like phenotype
similar to that caused by nerve growth factor (NGF) (Williams et al.,
1998
; Zhong and Minneman, 1999b
). These mitogenic responses appear to
be independent of inositol phosphate and calcium production (Berts et
al., 1999
), but are associated with activation of a variety of tyrosine
kinases, particularly Pyk 2 and Src (Zhong and Minneman, 1999c
).
Because
1A-ARs also activate growth
factor-signaling pathways, there is a possibility that these receptors
might activate other signaling pathways. Cytokine receptors, including
those for interleukins, interferons, and other polypeptides, are known to activate signal transducers and activators of transcription (Stats).
Ligand-induced receptor dimerization results in binding of Janus
tyrosine kinases and direct phosphorylation of Stats on a single
tyrosine residue (Darnell, 1997
). The Stats then dimerize and are
translocated to the nucleus, where they bind to specific consensus DNA
sequences and alter transcription. Growth factor receptors with
intrinsic tyrosine kinase activity, such as the receptor for epidermal
growth factor (EGF), also have been shown to cause Stat activation in
some instances (Silvennoinen et al., 1993
; Leaman et al., 1996
). A few
GPCRs, particularly the AT1 receptor for
angiotensin II, also have been reported to activate Stat pathways in a
variety of cells (Bhat et al., 1994
; Marrero et al., 1995
, 1997
; Peeler
et al., 1996
). The mechanisms underlying this activation are
controversial, but may be due to a direct association of the GPCR with
Jak2 (Marrero et al., 1995
, 1997
; Ali et al., 1997
).
Due to the variety of mitogenic and transcriptional responses observed
after
1A-AR activation in transfected PC12
cells (Williams et al., 1998
; Zhong and Minneman, 1999a
,b
), we wondered
whether these receptors also might activate Stats. Herein, we use a
variety of approaches, including luciferase reporter constructs, gel
shifts, and immunoprecipitation, to demonstrate Stat activation by
1A-AR stimulation in PC12 cells. Comparison
with growth factors and interleukin-6 (IL-6), and use of specific
inhibitors, suggests that this response is not downstream of known
second messenger pathways, release of growth factors, and/or release of
IL-6, but may involve p38 MAPK activation.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials
Materials were obtained from the following sources:
[
-32P]ATP (Amersham, Arlington Heights, IL);
T4 polynucleotide kinase (New England Biolabs, Beverly, MA);
poly(dI-dC) (Pharmacia, Piscataway, NJ); AG1478, AG490, SB203580,
GFX203290, PP2, PD98059, and
1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid-AM (Calbiochem, La Jolla, CA); (
)-NE bitartrate, Dulbecco's modified Eagle's medium, penicillin, streptomycin, and LY294002 (Sigma
Chemical Co., St. Louis, MO); antiphosphotyrosine antibody (P-Y 99),
anti-Stat antibodies, and anti-Jak2 antibody (Santa Cruz Biotechnology,
Santa Cruz, CA); enhanced chemiluminescence reagent (Amersham); and
horseradish peroxidase-conjugated anti-rabbit IgG (Bio-Rad, Hercules, CA).
Methods
Cell Culture.
PC12 cells were propagated in
75-cm2 flasks at 37°C in a humidified 5%
CO2 incubator in Dulbecco's modified Eagle's
medium containing 4.5 g/l glucose, 1.4% glutamine, 20 mM HEPES, 100 mg/l streptomycin, 105 U/l penicillin, 10% donor
horse serum, and 5% fetal bovine serum (Williams et al., 1998
). Cells
were detached by gentle trituration and subcultured at a ratio of 1:3
on reaching confluency. Cells were grown to confluency before use.
Preparation of Cell Lines.
PC12 cells stably expressing the
human
1A-AR cDNA in an isopropyl
-D-thiogalactoside (IPTG)-inducible expression vector (Hirasawa et al., 1993
; Esbenshade et al., 1995
) were used for all experiments (Williams et al., 1998
). Except where noted, cells were
treated at 24 h with 1 mM IPTG to induce receptor expression. Subclone 28 characterized previously (Zhong and Minneman, 1999b
) was
further transfected with retrovirus coding for reporters. Sequences
consisted of concatemers of Stat (two copies of
GATCCAGTTCCGGGAATCA; Ihle, 1996
) or
-interferon-activated sequence (GAS; four copies of
GATCAGCCTGATTTCCCCGAAATGACGGCACG; Sims et al., 1993
) consensus-binding sequences (in bold) upstream of a minimal human IL-2
gene promoter cloned into the promoterless retroviral luciferase plasmid pKA9 (Boss et al., 1998
; Abbott et al., 2000
).
Phoenix-producer cells (American Type Culture Collection, Manassas, VA)
were purchased with the permission of Dr. G. P. Nolan (Stanford
University) for transient production of nonreplicating recombinant
retrovirus. Infectious retroviral supernatants were generated by a
helper virus-free protocol and PC12 cells infected as described in
Abbott et al. (2000)
.
Luciferase Measurements. Confluent cells were incubated in serum-free medium with various stimuli for 4 h at 37°C. When inhibitors were used, they were added 30 min before addition of stimulus. Cells were then washed twice with PBS and lysed in buffer containing 25 mM Tris (pH 7.8), 4 mM EGTA, 1% Triton X-100, 10% glycerol, and 2 mM dithiothreitol (DTT). Lysates were centrifuged briefly in a microfuge, and the supernatant containing ~50 µg of protein was used for activity measurements. Luciferase activity was determined by mixing the lysate with 0.35 ml of assay buffer containing 25 mM Tris (pH 7.8), 40 mM MgSO4, 4 mM EGTA, 2 mM ATP, and 1 mM DTT, and 100 µl of 0.75 mM luciferin (Life Technologies, Grand Island, NY).
Gel Shifts.
Nuclear extracts were prepared by serum starving
confluent PC12 cells and treating with the indicated compounds for
4 h. After aspiration of the medium, cells were suspended in 50 ml
of ice-cold PBS. After centrifuging for 10 min at 2000g,
buffer was aspirated and cells suspended in 0.5 ml of ice-cold buffer A
[10 mM HEPES (pH 7.9), 10 mM KCl, 0.15 mM MgCl2,
0.5 mM DTT, and 0.2 mM phenylmethylsulfonyl fluoride (PMSF)]. Cells
were allowed to swell on ice for 10 min, homogenized with a Kontes
glass homogenizer (10 strokes), and centrifuged at 3750 rpm at 4°C
for 15 min. The pellet was resuspended in 400 µl of buffer C [20 mM
HEPES (pH 7.9), 25% glycerol, 0.42 M NaCl, 1.5 mM
MgCl2, 0.2 mM EDTA, 0.5 mM DTT, and 0.2 mM PMSF), incubated with gentle rocking at 4°C for 30 min, and centrifuged at
19,000 rpm for 30 min at 4°C. The supernatant, the nuclear extract,
was dialyzed against buffer D [20 mM HEPES (pH 7.9), 20% glycerol,
0.1 M KCl, 0.2 mM EDTA, 0.5 mM DTT, and 0.2 mM PMSF) for 4 to 5 h
at 4°C. Samples were then microfuged at 4°C, and the supernatant
was aliquoted and frozen at
70°C. For the gel shifts, ~10 µg of
nuclear extract was incubated at 37o for 15 min
in a 30-µl mixture containing 20 mM HEPES (pH 7.9), 50 mM KCl, 1 mM
DTT, 1 mM EDTA, 5% glycerol, 1 µg of poly(dI-dC), and 0.4 ng of
labeled oligonucleotide. In some cases, a 100-fold excess of unlabeled
oligonucleotide was added 5 min before addition of radiolabeled
oligonucleotide. The unbound oligonucleotides and protein-DNA complexes
were separated on a 5% polyacrylamide gel in 1× TBE at a
constant 300 V. The gels were dried at 80°C for 1 h and exposed
to Kodak X-Omat AR-5 at
70°C.
Immunoprecipitation. Confluent cells were serum starved for 2 h before further treatment. Cells were treated as indicated, washed twice with ice-cold PBS containing 1 mM sodium orthovanadate, and lysed on ice with RIPA lysis buffer (1% Nonidet P-40, 25 mM HEPES, 50 mM NaCl, 50 mM NaF, 5 mM EDTA, 1 mM PMSF, 1 mM NaVanadate, 10 µg/ml aprotinin, and 10 µg/ml leupeptin). Cell lysate was centrifuged at 10,000 rpm for 15 min at 4°C in a microfuge. The supernatant containing 1 mg of protein was incubated with 10 µg of antiphosphotyrosine antibody at 4°C for 2 h followed by addition of 20 µl of protein A-agarose. After overnight incubation at 4°C, the sample was centrifuged and the immunoprecipitates washed three times with lysis buffer. After boiling in 30 µl of 2× SDS-sample buffer, 15 µl of supernatant was subjected to SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to a nitrocellulose membrane. Protein bands were detected by probing sequentially with the primary antibody, horseradish peroxidase-conjugated secondary antibody (1:5000), and enhanced chemiluminescence reagent.
Measurement of p38 MAPK Activity.
Stat reporter transfected
1A-PC12 cells were serum starved for 2 h,
exposed to 100 µM NE for 15 min, and lysed. p38 MAPK activity was
measured with the New England Biolabs assay kit in the presence or
absence of various concentrations of SB202190. This method relies on
immunoprecipitation of p38 MAPK with a phosphospecific antibody and
then measurement of phosphorylation of activating transcription
factor-2 in vitro, which is detected by Western blotting.
| |
Results |
|---|
|
|
|---|
Activation of Stat and GAS Reporters by Agonists in
1A-AR-Transfected PC12 Cells.
Retroviral luciferase
reporter constructs consisted of concatemers of consensus-binding
sequences for Stats (2×) or GAS (4×) upstream of a minimal IL-2
promoter, followed by the coding sequence for firefly luciferase.
1A-PC12 cells were infected with retroviral reporters for either Stats or GAS and screened for responses to the
cytokine IL-6. Figure 1 shows that IL-6
(100 ng/ml) caused a 5- to 15-fold increase in luciferase activity in
1A-PC12 cells harboring either the Stat or GAS
reporter constructs. NE (100 µM) also increased luciferase activity
to a similar extent in both cell lines. However, the purinergic agonist
UTP, which binds to endogenous P2Y2 receptors and also activates
Gq/11-mediated responses in PC12 cells (Soltoff
et al., 1998
; Berts et al., 1999
), had no measurable effect on
luciferase activity. Likewise, activation of endogenous EGF receptors
did not significantly activate either Stat- or GAS-mediated
transcriptional responses, whereas NGF (50 ng/ml) caused a small
2.5-fold increase in Stat- but not GAS-mediated reporter activity (Fig.
1).
|
Characterization of NE-Mediated Transcriptional Activation.
Concentration-response curves for NE in activating both Stat- and
GAS-mediated transcriptional responses are shown in Fig. 2. The EC50 for NE
was ~600 nM for activating the Stat reporter and ~4700 nM for
activating the GAS reporter (Fig. 2). Both Stat- and GAS-mediated
transcriptional responses to NE (10 µM) were blocked by the selective
1-AR antagonist prazosin (1 µM; Fig. 3), but not by the
-AR antagonist
l-propranolol (1 µM; data not shown). We also took advantage of the
IPTG-inducible expression of
1A-ARs in these
cells (Zhong and Minneman, 1999b
) to demonstrate that both
transcriptional responses are dependent on receptor density. Figure
4 shows that NE had no significant effect
on the activity of either reporter in the absence of IPTG when cells express a low density of
1A-ARs (27 ± 5.2 fmol/mg protein). However, NE caused a 5- to 9-fold increase in
luciferase expression from both reporters after a 48-h exposure to 1 mM
IPTG when cells express a much higher
1A-AR
density (373 ± 10.4 fmol/mg protein). Intermediate responses were
observed after exposure to lower concentrations of IPTG (data not
shown).
|
|
|
Effect of Inhibitors on NE-Mediated Luciferase Expression.
To
begin to define the mechanism by which NE activates Stat- and
GAS-mediated transcriptional responses, a variety of specific inhibitors were examined at concentrations reported to be maximal and
specific. Table 1 shows that neither the
protein kinase C inhibitor GFX203290 (Toullec et al., 1991
; 1 µM) nor
the intracellular calcium chelator
1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (50 µM) had any effect on either Stat- or GAS-mediated
transcriptional activation by NE. However, the p38 MAPK inhibitor
SB203580 (Cuenda et al., 1995
; 10 µM) caused a 71 ± 8%
inhibition of the Stat response to NE but had no effect on the GAS
response. The MAPK kinase inhibitor PD98059 (Pang et al., 1995
;
10 µM) had no effect on the NE-activated Stat response, but
potentiated NE-activated GAS transcription by 57 ± 35%. The
selective inhibitor of EGF receptor tyrosine kinase activity AG1478
(Levitzki and Gazit, 1995
; 500 nM) caused a small but significant
inhibition of the NE response for both the Stat and GAS reporters.
Neither the Src inhibitor PP2 (Hanke et al., 1996
; 10 µM) nor the
Jak2 (Meydan et al., 1996
) and EGF receptor (Gazit et al., 1991
)
inhibitor AG490 (20 µM) significantly affected NE activation of
either reporter. However, the phosphoinositide 3 kinase inhibitor
LY294002 (Vlahos et al., 1994
; 10 µM) significantly increased both
Stat and GAS responses to NE (Table 1).
|
|
Gel Shifts.
Gel shifts were performed to verify the results
with the reporter constructs. Nuclear extracts were prepared from
1A-PC12 cells after various treatments and
incubated with 32P-labeled
oligonucleotides containing Stat or GAS consensus sequences. Unbound
oligonucleotides and protein-DNA complexes were separated by
electrophoresis and exposed to film. Figure
6 shows that treatment with either NE or
IL-6 induces formation or translocation of nuclear factors that bind
specifically to Stat and GAS consensus sequences. With this approach,
the Stat response to IL-6 is greater than that to NE, whereas the GAS
response to NE is greater than that to IL-6 (Fig. 6). In all cases, the
signal is reduced by the presence of unlabeled competing
oligonucleotide (Fig. 6). Other experiments showed that NE stimulation
of nuclear protein binding to both Stat and GAS sequences was dependent
on IPTG induction (data not shown).
|
Tyrosine Phosphorylation.
Tyrosine phosphorylation of Stat1,
2, and 3 were examined by immunoprecipitation and Western blotting.
After treatment,
1APC12 cells were lysed, and
tyrosine phosphorylated proteins immunoprecipitated with an
antiphosphotyrosine antibody. Precipitated proteins were separated on
SDS-PAGE, transferred, and blotted with antibodies specific for Stat1,
Stat2, or Stat3. In the experiment shown in Fig.
7, it is clear that NE and IL-6 increased
tyrosine phosphorylation of Stat1, whereas IL-6 but not NE increased
tyrosine phosphorylation of Stat3. However, longer exposure of the
blots and other experiments also showed significant tyrosine
phosphorylation of Stat3 in response to NE (data not shown). NGF
treatment had no effect on either Stat1 or Stat3 (Fig. 7), despite the
small increase in reporter activity observed in Fig. 1. UTP and EGF did
not increase tyrosine phosphorylation of Stat1 or Stat3 (data not
shown). No tyrosine phosphorylation of Stat2 was observed in response
to any of the agonists tested (data not shown). The time course of NE
stimulation of Stat1 phosphorylation in PC12 cells is shown in the
lower part of Fig. 7. It is clear that this response occurs within 2 min, and is sustained for at least 20 min. Finally, Stat1
phosphorylation in response to NE was blocked by pretreatment with 10 µM SB202190, whereas Stat1 phosphorylation in response to IL-6 was
unaffected by this treatment (data not shown).
|
| |
Discussion |
|---|
|
|
|---|
Stats are transcription factors activated by cytokine receptors. After receptor activation, Stats are tyrosine phosphorylated, dimerize, and translocate to the nucleus where they bind to specific DNA target sequences. Tyrosine kinase growth factor receptors also have been shown to cause Stat activation, possibly by direct tyrosine phosphorylation.
A few GPCRs also have been found to activate Jak/Stat pathways. The
angiotensin AT1 receptor has been shown to
associate with Jak2 and cause Stat activation in vascular smooth muscle
cells and cardiomyocytes (Bhat et al., 1994
; Marrero et al., 1995
,
1997
; McWhinney et al., 1997
). This effect appears to involve direct interaction of Jak2 with the carboxy tail of the
AT1 receptor through a YIPP motif (Ali et
al., 1997
). Other GPCRs, including endothelin, thrombin, and serotonin
(5HT2A), also have been reported to activate
Jak/Stat pathways (Peeler et al., 1996
; Bhat et al., 1997
;
Guillet-Deniau et al., 1997
), although direct association of these
receptors with Jak/Stat molecules is controversial. Interestingly, all
of these receptors, like
1-ARs, couple to
Gq/11 and play an important role in smooth muscle growth.
Our results suggest that stimulation of
1A-ARs
leads to activation of Stat-mediated transcription in PC12 cells. We
used luciferase reporters containing either the Stat or GAS consensus sequences, and found that both IL-6 and NE caused a large activation of
transcription from both reporters. This effect was not observed with
the endogenous P2Y2 purinergic receptors in these cells, which couple
through Gq/11 to activate inositol phosphate
formation and increase intracellular calcium (Soltoff et al., 1998
).
Activation of these receptors with UTP did not increase activity of
either reporter. EGF also did not affect either reporter in our cells, whereas NGF caused a small activation of the Stat but not the GAS reporter.
Activation of both Stat and GAS reporters by NE was clearly due to
1-AR activation. Both responses were blocked
by low concentrations of prazosin and were dependent on induction of
receptor expression. However, NE was more potent in activating the Stat
than the GAS reporter, possibly because the GAS reporter may bind
multiple transcription factors, including Stats, nuclear factor-
B,
and cAMP response element-binding protein (Sims et al., 1993
; Abbott et
al., 2000
), and may require the concerted activity of multiple transcription factors. Activation of the Stat reporter should require
only Stat activation, which may explain the greater potency of NE.
The traditional second messengers mediating
1-AR activation, inositol-1,4,5-trisphosphate
and diacylglycerol, do not appear to be involved in activation of
either of the reporters. UTP, which causes similar second messenger
responses as NE in PC12 cells (Berts et al., 1999
), causes no
detectable activation of either reporter, and inhibitors of protein
kinase C or increases in intracellular calcium did not block the
responses. We have shown that these inhibitors are effective and
specific in PC12 cells (Berts et al., 1999
).
Activation of extracellular signal-regulated kinases (ERKs) has been
reported to reduce Stat activation. Chung et al. (1997)
showed that
serine phosphorylation of Stat3 by ERK-dependent pathways negatively
modulated its tyrosine phosphorylation. Sengupta et al. (1998)
showed
that ERK activation inhibited IL-6-induced Jak-Stat signaling in a
rapid and inducible manner. We found that the MAPK kinase inhibitor
PD98059 either had no effect or potentiated NE-activated responses.
Because NE strongly activates ERKs in
1A-PC12
cells (Williams et al., 1998
) this is partly consistent with the
inhibitory effects on Stat activation. It also suggests that the net
effect of NE may be a balance between stimulatory and inhibitory pathways.
Activation of tyrosine kinase receptors also appears to play little
role in the stimulation of Stat and GAS reporters by NE. Although these
receptors often directly or indirectly activate Stats (Leaman et al.,
1996
), we found no activation by EGF in our cells. In addition, the EGF
receptor inhibitor AG1478 caused only a small reduction in
transcriptional activation by NE. The Jak2 inhibitor AG490 also
inhibits EGF receptor activation (Gazit et al., 1991
), and this
compound had no effect on NE-mediated activation of either reporter,
suggesting that EGF receptor transactivation is not involved in the NE
responses. The selective Src inhibitor PP2 also did not affect
NE-mediated reporter activation, suggesting that this kinase does not
play a critical role.
The p38 MAPK inhibitors SB202190 and SB203580 were found to greatly
diminish activation of the Stat reporter by NE over concentrations similar to those necessary to inhibit p38 MAPK. This suggests that p38
MAPK is involved in Stat activation by NE, although NE stimulation of
the GAS reporter was not affected by these inhibitors. There is one
report suggesting that p38 MAPK is involved in IL-6-induced transcriptional activation of Stat3 (Zauberman et al., 1999
), however
this area clearly needs further investigation.
Phosphoinositide 3 kinase directly interacts with Jak/Stat signaling
pathways in a complex manner that depends on cell phenotype (de Groot
et al., 1998
). We found that the phosphoinositide 3 kinase inhibitor
LY294002 strongly potentiated activation of both Stat and GAS reporters
by NE.
1-ARs, like other GPCRs, can activate phosphoinositide 3 kinase in some cells (Hu et al., 1996
). Although we
have not directly studied this in PC12 cells, the potentiating effect
of LY294002 on NE-mediated Stat and GAS reporter activity may suggest
that such an activation may be occurring, thereby inhibiting Stat and
GAS reporter activity. The large size of the potentiation suggests that
it may play an important modulatory role.
The mechanisms underlying
1-AR stimulated Stat
transcriptional activity in PC12 cells are likely to be complex.
1-AR activation causes a wide range of
responses, including activation of Gq/11, production of inositol phosphates and diacylglycerol, activation of
protein kinase C, activation of ERKs, c-Jun
NH2-terminal kinases and p38 MAPKs, activation of
a variety of tyrosine kinases, and cell differentiation (Williams et
al., 1998
). Interactions between pathways potentiating Stat activation
(such as p38 MAPK activation) and pathways inhibiting Stat activation
(such as ERK and phosphoinositide 3 kinase activation) will be critical
to understanding the mechanisms involved. Although the use of specific
inhibitors can give useful information, additional experiments will be
required to elucidate these pathways.
Gel shifts were used to confirm that NE stimulated the binding of nuclear proteins to Stat and GAS DNA consensus sequences. Strong signals were observed in response to both NE and IL-6, consistent with the results from the luciferase reporter constructs. Interestingly, the Stat response in the gel shift assays was greater for IL-6 than NE, whereas the GAS response was greater for NE than IL-6. The reason for these differences is not clear because both reporter constructs showed similar responses to NE and IL-6.
Similarly, Western blots were used to confirm that Stat1 (and sometimes
Stat3) is tyrosine phosphorylated in response to NE in
1A-PC12 cells. The different patterns of
phosphorylation caused by NE and IL-6 suggest that the response to NE
is probably not due to local formation and release of IL-6. Stats 1 and
3 are commonly activated in response to a variety of stimuli (Darnell, 1997
), particularly growth factors. Tyrosine phosphorylation of Stat1
persisted for at least 20 min after NE exposure, consistent with the
sustained response observed with the gel shift protocol.
In summary, it is clear from a variety of approaches that
1A-ARs activate Stat-mediated transcriptional
responses in PC12 cells. These responses occur at physiological
receptor densities but do not appear to be downstream of known second
messengers. p38 MAPK appears to play an as-yet-undefined role in
stimulation of Stat-, but not GAS-mediated transcription, and these
responses may be blunted by concurrent activation of ERKs and
phosphoinositide 3 kinase. This extends the already large range of
signals known to be activated in response to
1-AR stimulation to those normally involved in
cytokine signaling, and provides further evidence for complex and
interconnected signaling networks activated by GPCRs.
| |
Acknowledgments |
|---|
We thank Karen Abbott for construction of the luciferase reporters and Deborah Lee for excellent technical assistance.
| |
Footnotes |
|---|
Received August 12, 1999; Accepted December 31, 1999
1 T.J.M. is an Established Investigator of the American Heart Association.
This study was supported by National Institutes of Health Grants NS 32706 (to K.P.M.) and HL52810 and HL 56107 (to T.J.M.).
Send reprint requests to: Kenneth P. Minneman, Ph.D., Department of Pharmacology, Emory University, Atlanta, GA. E-mail: kminneman{at}pharm.emory.edu
| |
Abbreviations |
|---|
AR, adrenergic receptor;
GPCR, G
protein-coupled receptor;
NE, norepinephrine;
MAPK, mitogen-activated
protein kinase;
NGF, nerve growth factor;
Stats, signal transducers and
activators of transcription;
EGF, epidermal growth factor;
IL-6, interleukin 6;
IPTG, isopropyl
-D-thiogalactoside;
GAS,
-interferon activated sequence;
DTT, dithiothreitol;
PMSF, phenylmethylsulfonyl fluoride;
PAGE, polyacrylamide gel
electrophoresis.
| |
References |
|---|
|
|
|---|
B by G
q-coupled and cytokine receptors.
J Mol Cell Cardiol
32:
391-403[Medline].
1A-adrenergic receptors expressed in PC12 cells.
Mol Pharmacol
55:
296-303
1A/D-adrenergic receptor and inducible expression of three human subtypes in SKNMC cells.
Mol Pharmacol
47:
977-985[Abstract].
1-,
2-, and
-adrenergic receptors to MAP kinase pathways and differentiation in transfected PC12 cells.
J Biol Chem
273:
24624-24632
1-Adrenoceptor subtypes.
Eur J Pharmacol
375:
261-276[Medline].
1-adrenergic receptor subtypes.
J Neurochem
72:
2388-2396[Medline].
1A-adrenergic and growth factor receptors in transfected PC12 cells.
Biochem J
344:
889-894.
This article has been cited by other articles:
![]() |
S.-F. Tseng, C.-Y. Chang, K.-J. Wu, and S.-C. Teng Importin KPNA2 Is Required for Proper Nuclear Localization and Multiple Functions of NBS1 J. Biol. Chem., November 25, 2005; 280(47): 39594 - 39600. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Foshay, G. Rodriguez, B. Hoel, J. Narayan, and G. I. Gallicano JAK2/STAT3 Directs Cardiomyogenesis Within Murine Embryonic Stem Cells In Vitro Stem Cells, April 1, 2005; 23(4): 530 - 543. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lee, A. Robeva, Z. Chen, and K. P. Minneman Mutational Uncoupling of {alpha}1A-Adrenergic Receptors from G Proteins Also Uncouples Mitogenic and Transcriptional Responses in PC12 Cells J. Pharmacol. Exp. Ther., August 1, 2003; 306(2): 471 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Gonzalez-Cabrera, R. J. Gaivin, J. Yun, S. A. Ross, R. S. Papay, D. F. McCune, B. R. Rorabaugh, and D. M. Perez Genetic Profiling of alpha 1-Adrenergic Receptor Subtypes by Oligonucleotide Microarrays: Coupling to Interleukin-6 Secretion but Differences in STAT3 Phosphorylation and gp-130 Mol. Pharmacol., May 1, 2003; 63(5): 1104 - 1116. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||