|
|
|
|
Vol. 58, Issue 1, 48-57, July 2000
Department of Oncology and the Environmental Toxicology Program, McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, Wisconsin
| |
Abstract |
|---|
|
|
|---|
Glucocorticoid inducibility of the CYP3A23 gene is
conferred by a multisite unit comprising binding sites for several
members of the nuclear receptor superfamily of transcription factors, including the chicken ovalbumin upstream promoter-transcription factor
COUP-TF, pregnane X receptor (PXR), and hepatocyte nuclear factor 4 (HNF-4). The presence of three binding sites, each of which
interacts with more than one factor, contributes to the complexity of
the CYP3A23 glucocorticoid-responsive region. Despite the glucocorticoid sensitivity of this gene, direct binding of ligand-activated glucocorticoid receptor (GR) to the
CYP3A23 dexamethasone-responsive region (DexRE) is not
required for induction. This study demonstrates that DexRE-2 is the key
element within the CYP3A23 proximal promoter, conferring
ligand sensitivity via its interaction with the PXR/RXR
heterodimer. The DexRE-1 and HNF-4 sites are not ligand-responsive, but
are essential accessory elements required for full promoter inducibility. In addition to ligand-mediated activation of PXR, the
overall induction response involves a GR-mediated stimulation of PXR
and RXR
expression. Hence, the induction pathway can be divided into
two stages. In stage one, maximal induction requires a GR-dependent
increase in PXR and RXR
expression, and stage two is characterized
by direct transcriptional activation of CYP3A23, which
is dependent on ligand-activated PXR as well as accessory factors bound
at the DexRE-1 and HNF-4 sites. Because multiple proteins bind at each
element within the glucocorticoid-responsive region, factors not
contributing to ligand responsiveness, such as chicken ovalbumin
upstream promoter-transcription factor, may modulate the response
through competitive interactions.
| |
Introduction |
|---|
|
|
|---|
The
cytochrome P450 (CYP) superfamily of heme-thiolate mono-oxygenases is
involved in biosynthetic pathways (steroids, prostaglandins) as well as
in the metabolism of both endogenous and foreign compounds (Nelson et
al., 1996
). Approximately 6 isoforms of the 40 found in humans
metabolize most clinically administered drugs; therefore, direct
substrate competition for a given isozyme presents a potential mechanism for drug interactions (Rendic and DiCarlo, 1997
; Michalets, 1998
). Expression of the xenobiotic metabolizing enzymes is regulated transcriptionally by several classes of compounds, including hormones, peroxisome proliferators, anticonvulsants, and polycyclic aromatic hydrocarbons; therefore, both substrates and compounds not metabolized by CYP can influence the cellular levels of these enzymes (Dogra et
al., 1998
). Glucocorticoid activation of the CYP3A subfamily of enzymes
has long been a topic of clinical interest, because CYP3A4, the major
human isoform in adults, metabolizes 50 to 60% of drugs (Wilkinson,
1996
).
Studies aimed at elucidating the precise mechanism of CYP3A
activation by glucocorticoids have predominantly focused on the rat
isoforms, particularly the major glucocorticoid-inducible form,
CYP3A23 (Schuetz and Guzelian, 1984
; Schuetz et al., 1984
; Gonzalez et al., 1985
; Simmons et al., 1987
; Ribeiro and Lechner, 1992
;
Cooper et al., 1993
; Komori and Oda, 1994
; Sidhu and Omiencinski, 1995
). Insights gained from studying rat genes have led directly to a
greater understanding of the regulation of CYP3A isoforms from various species (Wrighton et al., 1985
; Barwick et al., 1996
; Lehmann et al., 1998
). Within the CYP3A23 proximal
5'-flanking region, three elements, dexamethasone response element 1 (DexRE-1), DexRE 2 (DexRE-2), and Site A, were shown to be essential
for the full induction response (Huss et al., 1996
). All of the
CYP3A23 elements contain imperfect AGGTCA direct repeats and
bind members of the nuclear receptor superfamily of ligand-activated
transcription factors (Huss and Kasper, 1998
; Quattrochi et al., 1998
).
Chicken ovalbumin upstream promoter-transcription factors (COUP-TFs)
bind the two distal elements, DexRE-1 (
144 to
169) and DexRE-2
(
118 to
136). Hepatocyte nuclear factor 4 (HNF-4) binds to the
proximal site, Site A (
85 to
110), and directly activates the
CYP3A23 promoter in HeLa cells, which lack endogenous HNF-4
(Huss and Kasper, 1998
). Interactions at each of the sites were
demonstrated to correlate with functional activity in mutagenesis
experiments; therefore, it is likely that these factors play a direct
role in the response of CYP3A23 to glucocorticoids (Huss and
Kasper, 1998
). The glucocorticoid-responsive CYP3A genes
from all other species examined contain homologous DexRE-1 elements. In
fact, the DexRE-1 of the rabbit and human CYP3A6 and
CYP3A4, respectively, confers dexamethasone responsiveness
on a heterologous promoter (Barwick et al., 1996
; Lehmann et al.,
1998
). The DexRE-2 and Site A elements, however, are present only in
mouse and rat isoforms (Burger et al., 1992
; Telhada et al., 1992
;
Hashimoto et al., 1993
; Jounaïdi et al., 1994
; Barwick et al.,
1996
; Huss et al., 1996
; Toide et al., 1997
).
Interestingly, gene regulatory studies have ruled out the likelihood of
direct glucocorticoid receptor (GR) involvement via binding to the
CYP3A23 promoter (Quattrochi et al., 1995
; Huss et al.,
1996
). However, whether GR plays an indirect role in the overall
induction pathway is still a focus of debate (Schuetz and Guzelian,
1984
; Schuetz et al., 1984
; Burger et al., 1992
; Huss et al., 1996
).
Early pharmacologic studies revealed an atypical profile for
CYP3A23 induction compared with other
glucocorticoid-responsive genes whose mechanisms are GR-dependent
(Schuetz and Guzelian, 1984
; Schuetz et al., 1984
; Burger et al.,
1992
). These studies demonstrated that the response was specific for
glucocorticoids, with the exception of pregnenolone 16-
carbonitrile
(PCN); the CYP3A23 dexamethasone induction response was
partially inhibited by RU486; a 100-fold higher glucocorticoid
concentration was required to induce CYP3A23 than was
necessary for maximal GR activation; and the potencies of various
glucocorticoids for inducing CYP3A23 did not parallel their
potencies for activating GR. This work provides a feasible model for GR
involvement that is consistent with the pharmacologic characteristics
of the response.
Recently, a novel orphan receptor isolated from mouse, the pregnane X
receptor (PXR), was shown be activated by the CYP3A inducers
PCN and dexamethasone (Kliewer et al., 1998
). The PXR/RXR
heterodimer binds the dexamethasone-responsive region at DexRE-2 and
mediates ligand-dependent activation of a thymidine kinase reporter
construct containing multiple upstream copies of this element (Kliewer
et al., 1998
). This study investigates the role of PXR in activating
CYP3A23 promoter constructs in both CV-1 and H4IIE cells and
examines the role of these response elements within the context of the
wild-type promoter, rather than a heterologous system. These findings
demonstrate, that although PXR plays a key role in mediating the
CYP3A23 response to glucocorticoids, DexRE-1 and Site A,
which bind other nuclear receptors, including COUP-TF and HNF-4,
respectively, are also required for full induction. Although GR does
not directly transactivate the CYP3A23 promoter (Quattrochi
et al., 1995
; Huss et al., 1996
), GR is involved in the regulation of
PXR and RXR
gene expression. Finally, the
capacity of the DexRE-1 and -2 elements from various species to bind
PXR/RXR
is examined, and the nucleotide requirements for strong
PXR/RXR
binding are precisely defined.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
Oligonucleotides were synthesized by Integrated
DNA Technologies, Inc. (Coralville, IA). Polymerase chain
reactions were performed with a GeneAmp kit and Taq
polymerase (PE Applied Biosystems, Foster City, CA). Restriction
enzymes, T4 ligase, and T4 polynucleotide kinase were from New England
Biolabs (Beverly, MA). Radioactive isotopes,
[
-32P]UTP (800 Ci/mmol) and
[
-32P]dATP (3000 Ci/mmol), were from NEN
Life Science Products (Boston, MA). Luciferase reagents were from
Promega (Madison, WI). Dexamethasone was purchased from Sigma (St.
Louis, MO), and dexamethasone t-butylacetate from Research
Plus, Inc. (Bayonne, NJ). RU486 and pregnenolone 16
-carbonitrile were from Biomol (Plymouth Meeting, PA).
Construction of Reporter Constructs.
Construction of
CYP3A23 deletion constructs has been described previously
(Huss et al., 1996
). The nucleotide numbering for CYP3A23
constructs is based on a submitted CYP3A23 promoter sequence (Genbank accession number S82239). The mutant construct P3-175/TTG was
generated by using the polymerase chain reaction overlap extension technique to make substitutions at positions
167 and
165 of the
P3-175 deletion construct (Huss et al., 1996
; Huss and Kasper, 1998
).
Construction of the heterologous promoter constructs has been described
previously (Huss et al., 1996
). To define the region of the
CYP3A23 promoter cloned upstream of the thymidine kinase (TK) promoter (
110 to +50), the
170TK construct is identified by
its 5' base and has nucleotide
60 as its 3' terminus. The other
constructs are identified by their 5'/3' termini. Constructs with
multiple element copies were made using oligonucleotides designed such
that the annealed oligonucleotides had overhanging BamHI and
KpnI sites; these were ligated with the
BamHI/KpnI-digested TK-Luc vector. All constructs
were sequenced by the dideoxy chain termination method with a T7
Sequenase V2.0 DNA-sequencing kit or with BigDye sequencing reagents
according to the manufacturer's protocol (PE Applied Biosystems).
Cell Culture, Transfection, and Luciferase Assays.
H4IIE
cells were maintained, transfected, and treated as described previously
(Huss et al., 1996
; Huss and Kasper, 1998
). In cotransfection
experiments, 2 µg/ml of expression vector was used. CV-1 cells were
generously provided by S. A. Kliewer (Glaxo-Wellcome); overnight
(14 h) transfections of 2 µg/ml reporter and 0.1 µg/ml expression
vector were performed using Lipofectin (Life Technologies, Grand
Island, NY). Transfected CV-1 cells were treated for 24 h with
inducers. Luciferase assays were carried out as described previously
(Huss and Kasper, 1998
). Activities from CV-1 experiments were
normalized to
-galactosidase activity (0.4 µg/ml transfected plasmid).
Electrophoretic Mobility Shift Assays.
Probes were
generated by annealing complementary oligonucleotides. Sequences for
CYP3A23 DexRE-1 and DexRE-2 have been described (Huss and
Kasper, 1998
). Other probes included
3A2DexRE-1:5'AGAATGTTAGCTCAAGAAGGTCAAAGAAGCTGT3'; 3A2DexRE-2:5'TGTAGATGAACTTTATGA- ACTGTTTAGG3',
5'TAAACAGTTCATAAAGTTCATCTACAGC3'; 3A6DexRE-1:5'CAGCACATGAACTCAGAGGAGGTCACCACGGAT- T3';
3A4DexRE-1:5'GAATATGAACTCAAAGGAGGTCAGTGAGT3'; 3a11DexRE-1:5'CAGAATGTTAGCTCAAAGTAGGTCAAGTTGGG- CT3';
3a11DexRE-2:5'CTGTGGATGAACTATACGAACTGCCTAG3'; and
TTGDexRE-1:5'CCCAGAATTTGAACTCAAAGGAGGTCAAAA- TAG3' (exact complementary oligonucleotides were used for opposite strands unless
otherwise indicated). Nuclear extracts from H4IIE cells were prepared
using a protocol described by Dignam, with modifications (Dignam et
al., 1983
; Ausubel et al., 1987
). Briefly, cells are incubated in
hypotonic buffer (10 mM HEPES, pH 7.6, 1.5 mM
MgCl2, 0.5 mM dithiothreitol, 0.2 mM
phenylmethylsulfonyl fluoride) and disrupted with a glass homogenizer.
The nuclei are collected by centrifugation (3300g, 15 min),
and proteins are extracted stepwise using low-salt buffer (20 mM HEPES,
pH 7.6, 25% glycerol, 1.5 mM MgCl2, 20 mM
KCl, 0.2 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 0.5 mM
dithiothreitol) and high-salt buffer (substitute 1.2 M KCl in low-salt
buffer). Recombinant PXR was synthesized from the pSG5-PXR cDNA clone
(kindly provided by S. A. Kliewer) in rabbit reticulocyte lysate,
using TNT in vitro coupled transcription/translation system (Promega).
The GST-RXR
fusion protein (provided by J. E. Mertz, McArdle
Laboratory, Madison, Wisconsin) was purified from 1 liter JM109
bacterial cultures, using glutathione-Sepharose 4B (Amersham Pharmacia
Biotech), according to the manufacturer's protocol.
RNase Protection Assays.
Antisense probes were synthesized
using T7 RNA polymerase and corresponded to the 151 to 1101 region of
mouse PXR, the 850 to 1740 region of human COUP-TFII (cDNA clone
provided by M. J. Tsai, Baylor College of Medicine, Houston, TX),
the 1340 to 1764 region of rat HNF-4 (cDNA clone provided by F. M. Sladek, University of California-Riverside), and a 334-nucleotide mouse
-actin probe (provided in a MAXIscript kit; Ambion, Austin, TX) in
the presence of [32P]UTP (
-actin probe was
labeled at 50-fold lower specific activity). Full-length probes were
purified by denaturing polyacrylamide gel electrophoresis. Isolated
probes were incubated with 10 µg total RNA from 5 × 107 H4IIE cells isolated with a Qiagen RNeasy
Midi kit. Overnight hybridization of probe and RNA at 42°C and RNase
(A/T1) digestion (30 min) were performed according to the
manufacturer's protocol (RPAII kit; Ambion). RNA digestion products
were resolved on 5% denaturing polyacrylamide electrophoresis gels and
visualized by phosphorimage analysis. Band intensities were measured by
Imagequant software and normalized to the
-actin reaction included
in each analysis.
| |
Results |
|---|
|
|
|---|
PXR/RXR
Binds to Distinct Elements in CYP3A Genes
from Various Species.
Previous work has established that the
dexamethasone response elements DexRE-1 and DexRE-2 are required for
glucocorticoid activation of CYP3A23 (Huss and Kasper,
1998
). DexRE-2 binds several nuclear receptors, including COUP-TFI and
II, and the recently described pregnane X receptor (PXR) (Huss and
Kasper, 1998
; Kliewer et al., 1998
; Quattrochi et al., 1998
). PXR (also
known as steroid and xenobiotic receptor (SXR) in humans) binds as a
PXR/RXR
heterodimer to AGTTCA hexamers arranged as direct, inverted,
or everted repeats (Bertilsson et al., 1998
; Blumberg et al., 1998
;
Lehmann et al., 1998
). Homologous elements are present in rodent,
human, and rabbit CYP3A genes (Fig.
1A) (Hashimoto et al., 1993
; Tukey, 1995
;
Toide et al., 1997
). A direct repeat of AGTTCA hexamers (DR3) comprises the DexRE-2 of the rodent isoforms, although the mouse
Cyp3a11 element differs by one mismatch. In contrast, the
human CYP3A4 and rabbit CYP3A6 lack a DexRE-2
homology region. Their DexRE-1 elements, however, contain an AGTTCA
everted repeat separated by six nucleotides (IR6) and have been shown
to confer activation by glucocorticoids on a heterologous promoter
(Barwick et al., 1996
). The IR6 components of the rodent DexRE-1
elements are disrupted within their upstream hexamers, but their
ability to support glucocorticoid activation or interact with
PXR/RXR
has not been tested.
|
to these elements was analyzed by gel shifts (Fig. 1B). The DexRE-2 elements of
rat CYP3A2 and CYP3A23 and mouse
Cyp3a11 bind the PXR/RXR
heterodimer, whereas
CYP3A4 and CYP3A6 bind PXR/RXR
at DexRE-1. The
mouse DexRE-2 (Fig. 1B, lane 12) displayed a much weaker binding for
PXR/RXR
compared with the rat DexRE-2 probes under identical conditions (Fig. 1B, lanes 4 and 8), presumably because of the single
DR3 mismatch. The functional effects of this relatively weak PXR/RXR
binding on the Cyp3a11 induction response are not known.
Although the upstream hexamer of the IR6 within CYP3A23 DexRE-1 (AGTTAA) differs by only one mismatch from the
CYP3A4 and CYP3A6 elements, PXR/RXR
binds less
strongly to the CYP3A23 DexRE-1 (Fig. 1B, lane 2) than to
the CYP3A4 and CYP3A6 DexRE-1 elements (Fig. 1B,
lanes 14 and 16). The CYP3A23 DexRE-1 element also binds
PXR/RXR
less strongly than CYP3A23 DexRE-2 (Fig. 1B, lane
4). As might be expected, the CYP3A2 DexRE-1, with two
mismatches in the IR-6 upstream hexamer, has virtually no affinity for
PXR/RXR
(Fig. 1B, lane 6).
A Single Nucleotide Mismatch Confers Differential Binding and
Function on Human and Rat DexRE-1 Elements.
Mutagenesis
experiments were performed to determine whether the single nucleotide
mismatch within DexRE-1 that gave rise to the differences in PXR/RXR
binding between CYP3A4 and CYP3A23 also affected
the glucocorticoid response. A mutant, designated mP3-175/TTG, was
made that substituted a G for T at position
165 of the P3-175
construct, making the CYP3A23 IR6 sequence identical with
that of CYP3A4 (Fig. 2). In
the cloning process, the G at position
167 of CYP3A23,
which is outside the IR6 consensus, was changed to T and therefore does
not correspond to either CYP3A4 or CYP3A23 in
that position. The mP3-175/TTG mutant displayed an enhanced
dexamethasone induction response 2.5 times that of the 15-fold
induction exhibited by wild-type constructs P3-175 and P3-210 and 15 times that of P3-144, which lacks the DexRE-1 (Fig. 2A). When binding
was assessed, the mutant DexRE-1 oligonucleotide displayed a strong
affinity for PXR/RXR
compared with the wild-type CYP3A23
element (Fig. 2B, lanes 2 and 6). These results suggest that the single
nucleotide difference between the DexRE-1 IR6 of CYP3A23 and
that of CYP3A4 does account for the observed difference in
PXR/RXR
binding affinity. Hence, in the case of wild-type CYP3A23 DexRE-1, the imperfect IR6 renders the element
unable to interact strongly with the ligand-receptor complex and,
therefore, to directly mediate ligand activation (see below).
|
Multimerized CYP3A23 DexRE-2 Can Support Ligand Activation through
PXR.
To determine whether PXR/RXR
binding to DexRE-2 correlated
with PXR-dependent transcriptional activation, the CYP3A23
elements were examined individually for their ability to confer
glucocorticoid responsiveness on the thymidine kinase promoter. Figure
3A shows the results of PXR
cotransfection experiments in CV-1 monkey kidney cells, using
constructs in which each of the three elements within the
CYP3A23 dexamethasone-responsive region was multimerized. Consistent with previous observations (Kliewer et al., 1998
), a 6-fold,
PXR-dependent induction by 10 µM dexamethasone
t-butylacetate (DtBu) was shown for the DexRE-2-containing
construct. In contrast, neither the CYP3A23 DexRE-1 nor Site
A constructs displayed responsiveness to DtBu in the presence of PXR.
Site A supports basal and dexamethasone-induced activity through the
binding of HNF-4 and has been shown to also bind the upstream
stimulatory factor, a bHLH/leucine zipper transcription factor (Huss et
al., 2000
). Notably, the DexRE-1, despite the fact that it shows
measurable binding affinity for PXR/RXR
, did not support
PXR-dependent induction by DtBu in CV-1 cells.
|
. The DexRE-1,
which is necessary for full glucocorticoid induction of
CYP3A23, may contribute to the response as an accessory
factor binding site.
Factors in Addition to PXR Are Required for Full
CYP3A23 Induction in CV-1 Cells.
Thus far, the
ability of PXR to directly mediate ligand-dependent activation has been
studied using multimerized constructs (Kliewer et al., 1998
) (Fig. 3A).
These conditions do not reflect the natural organization of elements in
the wild-type CYP3A genes, because CYP3A23 as
well as the human (CYP3A4), rabbit (CYP3A6), and
mouse (Cyp3a11) isoforms contain only single copies of their PXR/RXR
binding elements. Indeed, the high-magnitude induction response observed in hepatic cells was not obtained in CV-1 cells cotransfected with PXR and constructs containing single copies of the
essential elements (Fig. 4). Compared
with the multimerized DexRE-2 construct that is activated 6-fold by
DtBu, a single-copy construct, 144/110TK, is activated by only 2-fold
under the same conditions (Fig. 4). Similarly,
170TK, which contains
the entire CYP3A23 glucocorticoid-responsive region (
60 to
170), mediates only a 2- to 3-fold PXR-dependent induction by DtBu.
Hence, PXR/RXR
cannot mediate a full glucocorticoid induction
response in the absence of additional transcription factors that bind
at DexRE-1 and Site A, factors that are presumably absent from CV-1
cells. We predict that a higher magnitude response would be observed if
the additional trans-acting proteins binding at Site A and DexRE-1 were present in the system.
|
PXR/RXR
Do Not Enhance the CYP3A23 Induction
Response to Dexamethasone in H4IIE Cells.
To determine whether
increased expression of PXR could enhance the level of glucocorticoid
activation observed in a cell line replete with all necessary
trans-acting factors, cotransfection experiments were
performed in H4IIE cells (Fig. 5).
Cotransfection of PXR/RXR
activated CYP3A23 promoter
constructs in the absence of added ligand. This so-called
ligand-independent increase in activity required the presence of both
the DexRE-1 and DexRE-2 elements (Fig. 5A) and, furthermore, required
cotransfection of both PXR and RXR
(data not shown). The addition of
10 µM dexamethasone elicited a much lower fold induction over
untreated PXR/RXR
cotransfected controls (3-fold) than the 15-fold
induction typically observed in the absence of cotransfected PXR/RXR
(Fig. 5B). This graph, in which data are reported relative to P3-210
activity without PXR/RXR
or dexamethasone treatment, clearly shows a
biphasic response, in which P3-210 is activated 6-fold by PXR/RXR
,
then further induced 2.5-fold by the addition of 10 µM dexamethasone. The resulting activity level is equivalent to that observed on treatment of non-cotransfected cells with 10 µM dexamethasone. No
activation by PXR/RXR
or dexamethasone is observed with the P3-110
construct, which lacks DexRE-1 and DexRE-2.
|
Expression of PXR and RXR
Is Increased by Dexamethasone
Treatment in H4IIE Cells.
Because an increase in PXR/RXR
alone
can mediate CYP3A23 activation, presumably by mediating the
response to an endogenous ligand, the effect of glucocorticoids on PXR
expression was evaluated. RNase protection assays were performed to
measure PXR message levels in untreated and dexamethasone-treated H4IIE
cells. For comparison, the effect of dexamethasone treatment on the
expression of COUP-TFII, which binds to DexRE-1 and DexRE-2, and on
HNF-4, which binds to Site A, was determined as well. Increased PXR
expression was observed with 10 µM dexamethasone, which was
attenuated by cotreatment with RU486, a GR antagonist (Fig.
6A).
Dose-response experiments revealed that peak PXR mRNA induction was
achieved at 0.1 to 1.0 µM concentrations of dexamethasone (Fig. 6B).
In addition, a time course experiment revealed that PXR message reached maximum levels after 7 h and remained high through 24-h
dexamethasone treatment (Fig. 6B). None of the treatment levels caused
a large change in COUP-TFII or HNF-4 message levels, although at the
highest dexamethasone concentration, a 25% drop in COUP-TFII and HNF-4 message was observed (data not shown). Finally, PXR expression was
unaffected by 10 µM pregnenolone16
-carbonitrile (PCN), a PXR
agonist and CYP3A23 inducer, excluding the possibility of autoregulation through the activation of PXR (data not shown).
|
|
expression were also
determined. Immunoblotting was performed with antibody specific for
RXR
, using nuclear extracts from either control or
dexamethasone-treated H4IIE cells. An obvious increase in RXR
protein was observed in cells treated with 10 µM dexamethasone (data
not shown). These results are in agreement with the reported induction
of RXR
(but not RXR
or RXR
) message levels in H4IIE cells
treated with 0.5 µM dexamethasone (Wan et al., 1994Differential Dose Response of CYP3A23 and Mouse Mammary Tumor
Virus-LTR to Dexamethasone.
A well-characterized feature of
the CYP3A23 response to glucocorticoids that distinguishes
it from typical GR-mediated responses is the high concentration of
dexamethasone required for maximal induction (Schuetz et al., 1984
;
Schuetz and Guzelian, 1984
). The dose curves shown in Fig.
7 demonstrate this point by
displaying the CYP3A23 dose response relative to that of
mouse mammary tumor virus-LTR (MMTV-LTR). At submicromolar
dexamethasone concentrations, CYP3A23 was induced by less
than 50% of the maximum, which is achieved at 10 µM dexamethasone.
The CYP3A23 dose-response curve is clearly shifted to higher
ligand concentrations when compared not only to that of MMTV-LTR (Fig.
7), which is a GR-regulated promoter, but also to the dose curve
reported for PXR message induction (Fig. 6B). At submicromolar
dexamethasone concentrations, PXR message and MMTV-LTR transcriptional
activity are maximally induced, suggesting a common mode of regulation.
Hence these data support GR involvement in PXR induction and,
therefore, an indirect role for GR in the CYP3A23
transcriptional response to glucocorticoids.
|
Submicromolar Dexamethasone Concentrations Are Synergistic with 10 µM PCN.
The results implicating GR in the CYP3A23
response directly address a key observation concerning the synergistic
CYP3A23 response to combined PCN and dexamethasone treatment
(Burger et al., 1992
; Quattrochi et al., 1995
). Cotreatment with 10 µM PCN and submicromolar dexamethasone (0.1 µM) resulted in
transcriptional activity exceeding that reached with either individual
treatment. This effect was demonstrated for the P3-210 construct in
H4IIE cells (Fig. 8). When
administered individually, 10 µM PCN and 0.1 µM dexamethasone each
elicited an approximate 3-fold induction response, whereas when cells
were cotreated with both inducers a synergistic activation (18-fold)
was observed. The resulting level of activation by cotreatment is
equivalent to that normally seen with 10 µM dexamethasone alone. One
possible explanation for these results is that low concentrations of
dexamethasone induce expression of PXR and RXR
, and, in turn, PXR is
activated directly by PCN, at a high concentration. In CV-1
cotransfection experiments, DexRE-2 multimer constructs were strongly
activated by PCN in the presence of PXR, verifying that PCN is a potent
PXR ligand (Kliewer et al., 1998
, and data not shown).
|
| |
Discussion |
|---|
|
|
|---|
This study advances our understanding of the multisite regulatory
unit that mediates CYP3A23 glucocorticoid inducibility (Huss and Kasper, 1998
) by defining precisely the roles of individual elements within the glucocorticoid-responsive region. DexRE-2, through
its ability to bind PXR/RXR
, imparts ligand sensitivity to the
CYP3A23 glucocorticoid-responsive region. This is supported by CV-1 experiments in which PXR-dependent activation by
glucocorticoids was mediated solely through the DexRE-2. Neither
DexRE-1 nor Site A supported or enhanced the response in this
experimental system, presumably because CV-1 cells do not express the
factors binding at these sites. We propose that DexRE-1 and Site A act
with DexRE-2 as accessory factors to maximize the induction response.
DexRE-1 and Site A bind, respectively, the nuclear receptors COUP-TF
and HNF-4 but do not bind PXR/RXR
and cannot directly support the induction response. However, they are essential for the full response observed in H4IIE cells (Huss et al., 1996
; Huss and Kasper, 1998
). By
acting together, the elements optimize interactions with general transcription factors, thereby conferring full activation in response to glucocorticoids. Additional support for these conclusions would be
gained by showing that the full response can be reconstituted in CV-1
cells on the expression of transcription factors that bind at DexRE-1
and Site A (i.e., COUP-TF, complex B protein, HNF-4, etc.).
These findings, when considered with the GR-dependent regulation of PXR
and RXR
, form the basis for the mechanistic model presented in Fig.
9. According to this hypothesis, the response to glucocorticoids
is divided into two steps: one mediated by submicromolar glucocorticoid
concentrations and the other triggered at high concentrations of PXR
ligands. At low dexamethasone levels, activation of GR causes an
increase in cellular PXR and RXR
levels. This is predicted to
increase the occupancy of DexRE-2 by the PXR/RXR
heterodimer to the
exclusion of COUP-TF binding. The increased occupancy of DexRE-2 by the
PXR/RXR
complex is predicted to elicit a moderate transcriptional
activation, based on experimental results showing that PXR/RXR
cotransfection directly activated CYP3A23 promoter
constructs in H4IIE cells. This activation in the absence of added
ligand may, in fact, be due to the presence of endogenous PXR ligand in
H4IIE cells. Previous work has established that the most likely
endogenous candidates are pregnanes (Kliewer et al., 1998
).
Based on several observations, we propose that the first stage is
GR-dependent. First, the dose response for PXR message induction by
dexamethasone paralleled that of an MMTV-LTR-driven reporter but was
distinct from the CYP3A23 dose response. Second, cotreatment with 10 µM dexamethasone and 10 µM RU486 blocked the expected increase in PXR expression observed with dexamethasone alone. Finally,
cellular levels of RXR
protein increased in response to dexamethasone.
The second stage of the mechanism involves direct activation of PXR by
high concentrations (10 µM) of PXR-specific ligands, such as
dexamethasone or PCN. The activated receptor, in cooperation with
DexRE-1 and Site A bound factors, transactivates the downstream promoter. Previous characterization of the induction response in H4IIE
cells, utilizing 10 µM dexamethasone, simultaneously activated both
pathways and did not permit differentiation of the two stages (Huss and
Kasper, 1998
). To separate the GR-mediated stage of the pathway from
the PXR-mediated stage, PCN, which is a ligand for PXR but not for GR,
was used. Cotreatment of H4IIE cells with 0.1 µM dexamethasone
activated GR, whereas 10 µM PCN directly activated PXR. Activation of
both stages of the pathway resulted in a synergistic transcriptional
response for CYP3A23 constructs containing the
glucocorticoid-responsive region. Consistent with our hypothesis, the
response to cotreatment was of the same magnitude as observed with high
concentrations of dexamethasone alone. Interestingly, this synergistic
response to low-dose glucocorticoids and high-dose PCN is a well-known
characteristic of CYP3A23 regulation, and, until now, it was
thought to serve as evidence that the two inducers acted through
different mechanisms (Heuman et al., 1982
; Schuetz and Guzelian, 1984
;
Quattrochi et al., 1995
). Our model provides a feasible and testable
hypothesis for how this synergy occurs.
Because multiple proteins bind to DexRE-1 and DexRE-2, competition for
binding among trans-acting factors will likely occur, creating a potential for functional antagonism. This proposal is
particularly relevant with respect to COUP-TF, because it binds at
DexRE-1 along with another protein(s) in complex B, and at DexRE-2,
which is also the PXR/RXR
binding site (Huss and Kasper, 1998
).
COUP-TF frequently represses transcription via several mechanisms,
including direct competition with other nuclear receptors for their
binding sites (Liu et al., 1993
; Miyata et al., 1993
; Galson et al.,
1995
; Leng et al., 1996
; Tsai and Tsai, 1997
). Because PXR/RXR
and
COUP-TF bind at DexRE-2, the ability of PXR/RXR
to occupy the site
and to activate CYP3A23 will be influenced by cellular
levels of COUP-TF, PXR, and RXR
and the relative binding affinities
of the complexes. COUP-TF binding would also be predicted to influence
DexRE-1 function, because competition gel-shift experiments using
recombinant COUP-TF showed that COUP-TF binding and complex B binding
are mutually exclusive (data not shown). Although the relative
importance of COUP-TF binding versus complex B binding at DexRE-1 has
yet to be determined, binding of both complexes correlates with
function (Huss and Kasper, 1998
).
Considering that GR is indirectly involved in the CYP3A23
response through PXR/RXR
induction and that PXR directly mediates ligand-dependent transcriptional responsiveness, results from early
pharmacologic studies on the CYP3A induction response might be understood in light of this new model (Schuetz et al., 1984
; Schuetz
and Guzelian, 1984
; Burger et al., 1992
). For instance, the high
concentration of dexamethasone or PCN typically required for
transcriptional activation of CYP3A23 reflects the
relatively low potency of these ligands for activating PXR (Kliewer et
al., 1998
). The rank order potencies of various glucocorticoids for inducing CYP3A23 do not parallel their potency for
activating GR, but instead may parallel their relative abilities to
activate PXR. With respect to the observation that RU486 partially
inhibits dexamethasone induction of CYP3A23 (Burger et al.,
1992
), a GR antagonist would block the GR-dependent increase in PXR and
RXR
expression; however, because RU486 does not antagonize stage
two, a total inhibition would not be expected. Hence moderate
activation would still occur through PXR/RXR
. Finally, the mechanism
predicts that GR activation should cause moderate CYP3A23
induction of the same magnitude as that caused by PXR and RXR
cotransfection in H4IIE cells. To bypass the use of glucocorticoids
that might also act as PXR ligands, a GR mutant, rendered
constitutively active by truncation at the ligand binding domain, was
able to specifically activate a glucocorticoid-responsive
CYP3A23 reporter construct but not a noninducible construct
in H4IIE cells (data not shown).
With respect to PXR regulation of other CYP3A family
members, there are interesting species differences among genetic
elements through which PXR acts. The abilities of homologous DexRE-1 or DexRE-2 elements from rabbit, human, mouse, and rat CYP3A
genes to interact with the PXR/RXR
complex were compared. A
dichotomy exists between the rabbit (CYP3A6) and human
(CYP3A4) isoforms, which bind PXR/RXR
at DexRE-1, and the
rodent isoforms, CYP3A23, CYP3A2, and
Cyp3a11, which bind PXR/RXR
at their DexRE-2 elements. This differential binding reflects functional differences between the
elements. The CYP3A23 DexRE-2 was required for
ligand-dependent activation in PXR-expressing CV-1 cells, whereas the
DexRE-1 could not support an induction response. In contrast, DexRE-1
of CYP3A4 and CYP3A6 directly mediates
ligand-dependent induction (Barwick et al., 1996
). In the human and
rabbit genes, DexRE-1 contains the same imperfect DR4 as
CYP3A23 (AACTCA(n)4AGGTCA), but more important is the IR6 (TGAACT(n)6AGGTCA), because
the CYP3A23 DexRE-1 could be converted to a PXR/RXR
binding site by changing the upstream hexamer of the IR6 to match that
of CYP3A4. The CYP3A23 reporter construct
containing this mutation displayed enhanced responsiveness to
glucocorticoids because of the creation of a PXR/RXR
binding site in
addition to the native DexRE-2 site. Our results are consistent with
the findings that PXR/RXR
binds to hexamers of AGTTCA rather than to
typical AGGTCA elements but displays no strong preference for a
specific hexamer arrangement (Blumberg et al., 1998
; Lehmann et al.,
1998
). Therefore, evidence supports the hypothesis that PXR/RXR
is
mediating ligand-dependent activation through DexRE-2 in the rodent
CYP3A genes, but through DexRE-1 in the human and rabbit
genes, but that in the rat CYP3A23 gene additional accessory
sites are essential for full induction.
| |
Acknowledgments |
|---|
We thank Dr. Steven A. Kliewer for making the original PXR.1
mouse cDNA available and for his helpful comments, as well as Dr. Cary
Weinberger (National Institutes of Health) for the pCMV-RXR
encoding
mouse RXR
. In addition, we thank Dr. Nancy Thompson (McArdle
Laboratory) for the gift of Tata-binding protein monoclonal antibody,
and Dr. Janet Mertz (McArdle Laboratory) for providing the GST-RXR
construct. We thank Dr. Anna Shen, Dr. Kathleen O'Leary, and John
Sheehan for critical evaluation of the manuscript. We are grateful to
Kristen Adler and Mary Jo Markham for preparing the manuscript.
| |
Footnotes |
|---|
Received December 20, 1999; Accepted March 20, 2000
1 Present address: Center for Cardiovascular Research, Department of Internal Medicine, Washington University School of Medicine, Box 8086, 660 S. Euclid, St. Louis, MO 63110.
This work was supported by National Institutes of Health Grants CA22484 and CA0920. J.M.H. was supported by National Institutes of Health Grant T32-CA-09135.
Send reprint requests to: Dr. Charles B. Kasper, Department of Oncology, McArdle Laboratory for Cancer Research, 1400 University Ave., Madison, WI 53706. E-mail: kasper{at}oncology.wisc.edu
| |
Abbreviations |
|---|
CYP, cytochrome P450;
CMV, cytomegalovirus;
COUP-TF, chicken ovalbumin upstream promoter-transcription factor;
CYP3A, cytochrome P450 3A subfamily;
ds, double-stranded;
DexRE-1, dexamethasone response element 1;
DexRE-2, dexamethasone response
element 2;
FCS, fetal calf serum;
GR, glucocorticoid receptor;
HNF-4, hepatocyte nuclear factor 4;
Me2SO, dimethyl sulfoxide;
MMTV, mouse mammary tumor virus;
PCN, pregnenolone 16
-carbonitrile;
PXR, pregnane X receptor;
RLU, relative light units;
SV, simian virus;
TK, thymidine kinase;
RXR, retinoid X receptor.
| |
References |
|---|
|
|
|---|
-carbonitrile regulate de novo a common form of cytochrome P-450 in cultures of adult rat hepatocytes and in the liver in vivo.
J Biol Chem
259:
1999-2006
) gene expression is regulated by fatty acids and dexamethasone in hepatic cells.
Biochimie
79:
107-110[Medline].This article has been cited by other articles:
![]() |
E. Audet-Walsh and A. Anderson Dexamethasone Induction of Murine CYP2B Genes Requires the Glucocorticoid Receptor Drug Metab. Dispos., March 1, 2009; 37(3): 580 - 588. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. W. Cooper, T. M. Cho, P. M. Thompson, and A. D. Wallace Phthalate Induction of CYP3A4 is Dependent on Glucocorticoid Regulation of PXR Expression Toxicol. Sci., June 1, 2008; 103(2): 268 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Bhadhprasit, T. Sakuma, N. Hatakeyama, M. Fuwa, K. Kitajima, and N. Nemoto Involvement of Glucocorticoid Receptor and Pregnane X Receptor in the Regulation of Mouse CYP3A44 Female-Predominant Expression by Glucocorticoid Hormone Drug Metab. Dispos., October 1, 2007; 35(10): 1880 - 1885. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Swales, S. Kakizaki, Y. Yamamoto, K. Inoue, K. Kobayashi, and M. Negishi Novel CAR-mediated Mechanism for Synergistic Activation of Two Distinct Elements within the Human Cytochrome P450 2B6 Gene in HepG2 Cells J. Biol. Chem., February 4, 2005; 280(5): 3458 - 3466. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Phillips, S. R. Hood, G. G. Gibson, and N. J. Plant IMPACT OF TRANSCRIPTION FACTOR PROFILE AND CHROMATIN CONFORMATION ON HUMAN HEPATOCYTE CYP3A GENE EXPRESSION Drug Metab. Dispos., February 1, 2005; 33(2): 233 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Song, Y. Li, J. Liu, M. Mukundan, and B. Yan Simultaneous Substitution of Phenylalanine-305 and Aspartate-318 of Rat Pregnane X Receptor with the Corresponding Human Residues Abolishes the Ability to Transactivate the CYP3A23 Promoter J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 571 - 582. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Z. Turncliff, P. J. Meier, and K. L. R. Brouwer EFFECT OF DEXAMETHASONE TREATMENT ON THE EXPRESSION AND FUNCTION OF TRANSPORT PROTEINS IN SANDWICH-CULTURED RAT HEPATOCYTES Drug Metab. Dispos., August 1, 2004; 32(8): 834 - 839. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Song, M. Xie, H. Zhang, Y. Li, K. Sachdeva, and B. Yan THE PREGNANE X RECEPTOR BINDS TO RESPONSE ELEMENTS IN A GENOMIC CONTEXT-DEPENDENT MANNER, AND PXR ACTIVATOR RIFAMPICIN SELECTIVELY ALTERS THE BINDING AMONG TARGET GENES Drug Metab. Dispos., January 1, 2004; 32(1): 35 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Kliewer, B. Goodwin, and T. M. Willson The Nuclear Pregnane X Receptor: A Key Regulator of Xenobiotic Metabolism Endocr. Rev., October 1, 2002; 23(5): 687 - 702. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Ripp, J. L. Fitzpatrick, J. M. Peters, and R. A. Prough Induction of CYP3A Expression by Dehydroepiandrosterone: Involvement of the Pregnane X Receptor Drug Metab. Dispos., May 1, 2002; 30(5): 570 - 575. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Zangar, A. L. Kimzey, J. R. Okita, D. S. Wunschel, R. J. Edwards, H. Kim, and R. T. Okita Cytochrome P450 3A Conjugation to Ubiquitin in a Process Distinct from Classical Ubiquitination Pathway Mol. Pharmacol., April 1, 2002; 61(4): 892 - 904. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Falkner, J. A. Pinaire, G.-H. Xiao, T. E. Geoghegan, and R. A. Prough Regulation of the Rat Glutathione S-Transferase A2 Gene by Glucocorticoids: Involvement of Both the Glucocorticoid and Pregnane X Receptors Mol. Pharmacol., September 1, 2001; 60(3): 611 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Quattrochi and P. S. Guzelian CYP3A Regulation: From Pharmacology to Nuclear Receptors Drug Metab. Dispos., April 13, 2001; 29(5): 615 - 622. [Abstract] [Full Text] |
||||
![]() |
A. Geick, M. Eichelbaum, and O. Burk Nuclear Receptor Response Elements Mediate Induction of Intestinal MDR1 by Rifampin J. Biol. Chem., April 27, 2001; 276(18): 14581 - 14587. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||