|
|
|
|
Vol. 58, Issue 4, 701-708, October 2000
Department of Pharmacology, Emory University School of Medicine (A.M.R., K.X., M.L.E., T.J.M.), and the Program in Molecular and Systems Pharmacology, Graduate Division of Biological and Biomedical Sciences, Emory University (A.M.R., T.J.M.), Atlanta, Georgia
| |
Abstract |
|---|
|
|
|---|
The prostaglandin synthase cyclooxygenase-2 (COX-2) is produced by an
immediate early response gene induced in most cells by a variety of
stimuli. Several studies have shown that the immunosuppressant cyclosporin (CsA) interferes with prostanoid metabolism, but the mechanisms are unclear. Here we examine the effect of CsA on COX-2 mRNA
induction in cultured rat vascular smooth muscle cells (VSMC) that
natively express the nuclear factor of activated T-cells, a known
mediator of CsA-sensitive transcription. CsA significantly suppresses
strong COX-2 mRNA induction caused by the Ca2+-mobilizing
mitogens UTP, angiotensin II, and platelet-derived growth factor-BB,
and the synergistic induction caused by costimulation with ionomycin
and a phorbol ester. Forskolin and interleukin-1
are substantially
weaker COX-2 mRNA inducers, and CsA does not inhibit their effect. CsA
strongly inhibits UTP-, angiotensin II-, and platelet-derived growth
factor-BB-stimulated COX-2 gene transcription as measured by nuclear
run-on or promoter-reporter studies, but has no effect on mRNA
induction caused by post-transcriptional stabilization of a distal
COX-2 mRNA 3'-untranslated region regulatory element. These data show
that CsA selectively inhibits mitogen-induced COX-2 gene expression by
a transcriptional mechanism that may involve the nuclear factor of
activated T-cells.
| |
Introduction |
|---|
|
|
|---|
Conversion
of arachidonic acid to prostaglandin H2 by
cyclooxygenase-2 (COX-2) is the key enzymatic step in prostaglandin synthesis. Prostaglandins are involved in several biological processes including inflammation, immune responses, cell growth, ovulation, and
the regulation of vascular tone (Williams and DuBois, 1996
). The two
COX isoforms, COX-1 and COX-2, are encoded by separate genes (Fletcher
et al., 1992
; Hla and Neilson, 1992
; Kraemer et al., 1992
). Although
their enzymatic function is similar, regulation of their cellular
expression levels differs. COX-1 gene expression is largely
constitutive whereas COX-2 gene expression is negligible under basal
conditions but can increase dramatically in numerous cell types in
response to a wide variety of stimuli (Smith and Dewitt, 1996
).
The immunosuppressive drug cyclosporin A (CsA) has been reported to
interfere with prostaglandin actions in several cell types, but the
mechanisms are unresolved (Fan and Lewis, 1985
; Stahl et al., 1989
;
Edwin et al., 1996
; Iniguez et al., 1999
). CsA forms a stable complex
with cyclophilin, which binds to and inhibits the catalytic subunit of
protein phosphatase 2B, otherwise known as calcineurin (Clipstone et
al., 1994
). Although calcineurin is thought to participate in a wide
variety of cellular processes, relatively few specific substrates are
known (Klee et al., 1998
). The best understood calcineurin substrate is
the nuclear factor of activated T-cells (NFAT), which is involved in
controlling lymphocyte cytokine gene expression (for review, see Rao et
al., 1997
). Calcineurin dephosphorylates cytoplasmic NFAT, leading to
its nuclear translocation, where it assembles on composite enhancers
elements with transactivators stimulated by mitogen-activated protein
kinase signaling. This mode of regulation explains a common characteristic of NFAT-regulated genes, which is synergistic induction by costimulation of Ca2+ and mitogen-activated
protein kinase signaling.
Inhibition of NFAT-mediated transcriptional programs induced strongly
by foreign antigens in lymphocytes is thought to be the principal
therapeutic mechanism of action of CsA (Schreiber and Crabtree, 1992
).
NFAT targets in the immune system are well characterized, including
interleukin (IL)-2, IL-3, IL-4, IL-5, tumor necrosis factor-
,
interferon-
, and granulocyte-macrophage colony-stimulating factor
genes (Rao et al., 1997
). Adverse therapeutic consequences of CsA
treatment seen in almost all subjects include reversible hypertension
and reduced renal function (Sander et al., 1996
). Although NFAT was
thought of initially as lymphoid specific, one or more of the four
known NFAT genes is expressed in virtually all tissues (Hoey et al.,
1995
). Several recent reports have identified NFAT in a variety of cell
types that include vascular smooth muscle cells (VSMC) (Ho et al.,
1994
; Cockerill et al., 1995
; Boss et al., 1996
; Abbott et al., 1998
;
Boss et al., 1998a
,b
). Using a heterologous NFAT-specific
transcriptional reporter, recent studies have established that various
phospholipase C-coupled receptors most likely serve as physiological
NFAT regulators outside of the immune system (Boss et al., 1996
; Boss
et al., 1998a
,b
). The genes regulated by NFAT in VSMC and in most other
nonlymphoid cell types are largely unknown, but their discovery may
provide insights into the mechanisms of CsA-induced cardiovascular toxicity.
To determine whether there is a potential role for NFAT in VSMC COX-2
gene regulation, this study examined the effect of CsA on the ability
of various agonists to induce COX-2 gene expression. We found that
Ca2+-mobilizing mitogens acting through
G
q-coupled P2Y nucleotide and AT1 angiotensin
receptors, or a growth factor receptor, are more efficacious inducers
of the COX-2 mRNA then are non-Ca2+-mobilizing
stimuli, including the cytokine IL-1
and the adenylyl cyclase
activator forskolin. CsA selectively attenuates COX-2 mRNA induction
caused by Ca2+-mobilizing receptors, most likely
by a transcriptional mechanism. These and additional observations
support the hypothesis that NFAT lies within activation pathways
regulating VSMC COX-2 gene expression.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
UTP, forskolin, angiotensin II, and luciferin
were obtained from Sigma Chemical (St. Louis, MO). IL-1
and
platelet-derived growth factor-BB (PDGF-BB) were purchased from Life
Technologies Inc. (Grand Island, NY) and Calbiochem Inc. (San Diego,
CA), respectively. CsA was a gift from Sandoz Pharmaceuticals.
[
-32P]UTP was purchased from NEN Life
Science Products (Boston, MA). Probes used in RNase protection assay
(RPA) were synthesized using MAXIscript In Vitro Transcription Kit from
Ambion, Inc. (Austin, TX), and RPA analysis was performed using the
Ambion RPA II kit. Antibiotics, serum, and cell culture media were from
Life Technologies. Phoenix retroviral producer cells (ATCC SD-3443)
were obtained from the American Type Culture Collection (Rockville,
MD). All retroviral reporter plasmids created for this study were
maintained in Escherichia coli Top 10F' from InVitrogen,
Inc. (Carlsbad, CA) in 100 µg/ml ampicillin and 12.5 µg/ml tetracycline.
Cell Culture.
Rat thoracic aorta VSMC were studied between
~25 to 70 population doublings after inception. They were grown until
confluence in Dulbecco's modified Eagle's medium containing 3.7 mg/ml
NaHCO3, 100 µg/ml streptomycin, 100 U/ml
penicillin, and 10% calf serum in 5% CO2 at
37°C. After an additional 24-h incubation in serum-free media,
confluent cells were treated with agonists. Phoenix Ampho retroviral
producer cells were cultured as above except using 10% fetal bovine
serum. Helper virus-free protocols for generating recombinant
retroviruses and VSMC infection have been described in detail (Boss et
al., 1998a
).
Plasmids.
Retroviral luciferase reporter plasmids for
measuring NFAT-, activator protein 1 (AP1)-, serum response element
(SRE)-, and nuclear factor-
B (NF
B)-mediated transcription are
described elsewhere (Abbott et al., 2000
). pAR2, representing a
full-length COX-2 promoter driving luciferase expression, was created
by cloning 2.7 kilobase pairs (kb) of the COX-2 promoter region (Sirois
et al., 1993
) using the PCR primers G18
(5'AATTTACGCGTACTCCTGAAGCTCTCCG) and G19
(5'ATAGCGTCGACCCTGATAAAATTAGAACCAAA) into the SalI - MluI sites of pCAT/CUL, a retroviral vector wherein chloramphenicol acetyl
transferase is also constitutively expressed from the 5'LTR promoter. A
template for the 549-base COX-2 riboprobe (pAR1) was created by
removing a 1.3 kb KpnI fragment from a
pBluescriptSK+ vector containing the COX-2 cDNA
(DuBois et al., 1994
), and linearizing with BstBI. The template for the
luciferase riboprobe (pKX37) was created by cloning a 540-base
EcoRI-XbaI fragment from pXF40LUC (Wang and
Murphy, 1998
) into pBluescriptKS+. pKX56 contains
a 263-base HpaI-XhoI fragment encoding the most distal COX-2 3'-untranslated region cloned downstream of luciferase in
pXF40LUC (Xu et al., 2000
). The design and synthesis of the retroviral
vectors that express trans-dominant NFAT inhibitor Zeo:eGFP:VIVIT
(pTJ85) and the control retroviral vector expressing Zeo:eGFP (pTJ84)
are described elsewhere (K. L. Abbott, J. R. Loss, A. M. Robida, and T. J. Murphy, submitted).
Luciferase Assay.
Drugs and agonists, or their vehicles,
were added to cells cultured in 24-well plates from 100× concentrated
stock solutions. The forskolin diluent is dimethyl sulfoxide, and that
for CsA is a solution containing 60% EtOH and 2% Tween 80. Cells were pretreated with CsA or its vehicle 30 min before agonist addition. After incubation for 4 h at 37°C in 5%
CO2, luciferase activity was measured as
described previously (Takeuchi et al., 1993
) using a Turner Designs
model 20E Luminometer.
RPA.
The COX-2, luciferase, and cyclophilin riboprobes were
synthesized using either T7 or T3 polymerase following Ambion
Maxiscript Kit directions. The template for the cyclophilin probe,
pTriCyp, was purchased from Ambion, Inc. pAR1 linearization with BstBI and pKX37 with XbaI serve as templates for 549 base-COX-2
and 600-base LUC riboprobes, respectively. RNA was isolated from cells treated in 35-mm dishes using Trizol (GibcoBRL) according to the manufacturer's directions. RPAs were performed using slight
modifications of the Ambion RPA II kit protocols. In brief, aliquots
(10-15 µg) of total RNA were placed in a 1.5-ml centrifuge tube and
lyophilized under vacuum. The samples were then resuspended in 10 µl
of hybridization buffer before adding 2 µl of a mixture of sequence
gel-purified, [
-32P]UTP-labeled riboprobes
(100,000 cpm per probe) also dissolved in hybridization solution. After
heating to 95°C for 5 min, and hybridizing at 42°C for 12 to
18 h, the samples were digested for 30 min with a mixture of
RNAases A and T1 (final concentrations, 2.3 and 90 U/ml, respectively)
at 37°C. Protected fragments were then separated on a 5%
polyacrylamide/urea denaturing gel. After exposure on storage phosphor
screens for up to 24 h, images were acquired using a Molecular
Dynamics PhosphorImager (Sunnyvale, CA). Hybridization signal
quantification was performed using a volume integration protocol in the
ImagineQuant program (ver. 3.3; Molecular Dynamics).
Nuclear Run-On Assay.
Cells grown to confluence on 150-mm
plates were treated for 45 min with either vehicle, UTP, or angiotensin
II in the absence or presence of CsA before harvesting nuclei and
performing nuclear run-on using [
-32P]UTP as
described previouosly (Nickenig and Murphy, 1994
). Denatured plasmids
(5 µg) containing cDNAs for COX-2 (pRDCOX-2), GAPDH (PIBI30; International Biotechnology, New Haven, CT), and negative control vector (pBluescriptSK+) were crosslinked to
neutral nylon membranes (Hybond-N; Amersham Life Science) before
hybridization with radiolabeled run-on RNA. After a 16-h hybridization,
blots were washed in 50 ml of 2× SSC (300 mM sodium chloride, 30 mM
sodium citrate, pH 7.4) for 15 min at room temperature, 2× SSC and
0.1% SDS for 15 min at 50°C, and then with 2× SSC containing 1 µg/ml of RNAase A for 5 min at room temperature. After exposure on
storage phosphor screens for up to 24 h, images were acquired and
quantified as above.
Data Analysis. Statistical significance was determined using one or two-tailed paired t test using Prism v3.0 (GraphPad, Inc., San Diego, CA).
| |
Results |
|---|
|
|
|---|
VSMC COX-2 mRNA expression was measured using a quantitative
duplex RPA in which COX-2 mRNA hybridization signals were normalized by
the cyclophilin mRNA signal in each sample. Two characteristics of
NFAT-mediated transcription are inhibition by CsA and synergistic activation by costimulation with calcium ionophores and phorbol esters
(reviewed in Rao et al., 1997
). As shown in Fig.
1, peak COX-2 mRNA levels are induced on
average 17- and 7-fold over basal maximally after treatment with either
100 nM ionomycin or 100 nM phorbol 12-myristate 13-acetate (PMA),
respectively. The response to combined stimulation with ionomycin and
PMA is both highly synergistic and inhibited markedly by CsA.
|
G
q-coupled receptors and growth factors have been reported to induce
NFAT-mediated transcription in smooth muscle cells, as assessed using
an NFAT specific reporter (Boss et al., 1998a
). We measured COX-2 mRNA
responses in the absence or presence of 1 µM CsA during stimulation
with the P2Y receptor agonist UTP (100 µM), the
AT1 receptor agonist angiotensin II (100 nM), or with PDGF-BB (50 ng/ml) to stimulate a receptor tyrosine kinase. As
shown in Fig. 2, UTP, angiotensin II, and
PDGF-BB each rapidly increases COX-2 mRNA expression with peak
responses at 1 h. As seen in Table
1, UTP and angiotensin II tend to induce
COX-2 mRNA to similar levels. CsA inhibits the responses to both
G
q-coupled receptor agonists but is slightly more efficacious at
inhibiting the effect of angiotensin II (66 ± 2% inhibition)
compared with UTP (46 ± 9% inhibition). COX-2 mRNA induction by
PDGF-BB is less robust than is the response to G
q agonists, but it
is also inhibited by CsA (59 ± 11% inhibition).
|
|
COX-2 mRNA levels were also measured after stimulation with either
forskolin (10 µM) to activate adenylyl cyclase or with IL-1
(10 ng/ml) as a reference inflammatory cytokine, in the absence or presence
of CsA. The maximal induction by forskolin occurs at 1 h, with
recovery to basal expression levels within 3 h (Fig.
3). The response to IL-1
is more
gradual then any other agonist tested, with the highest level of
induction occurring at the latest time-point assayed (Fig. 3). CsA has
no effect on COX-2 mRNA induction by these two agonists, and instead
selectively inhibits responses to those that stimulate phospholipase C
activity. Notably, the maximal induction of COX-2 mRNA by
Ca2+-mobilizing agonists is greater than effects
caused by forskolin or IL-1
(Table 1).
|
To gain insight into whether CsA inhibits NFAT-mediated transcription
selectively in this preparation, we examined luciferase activity in
four different cell lines created to report the function of the
activator protein-1 (AP-1; e.g., c-fos, c-jun), SRE, NF
B, and NFAT
using retroviral luciferase reporters. As expected, CsA treatment
significantly reduces UTP-, angiotensin II-, and PDGF-BB-stimulated NFAT-mediated luciferase reporter activity, which is not stimulated by
forskolin or IL-1
treatment (Fig. 4).
In contrast, CsA treatment has no effect on the differential ability
these various agonists display in stimulating SRE, AP1, or NF
B
reporter activity (Fig. 4). Thus, from this limited survey, CsA
selectively inhibits NFAT-mediated transcription in this preparation.
|
Recently, a specific peptide inhibitor of NFAT, termed VIVIT, has been
described (Aramburu et al., 1999
). This peptide mimics the calcineurin
binding site within NFAT, thereby inhibiting NFAT dephosphorylation and
nuclear translocation. Unlike CsA, this occurs without inhibiting
calcineurin catalytic activity (Aramburu et al., 1999
). VSMC were
infected with a retroviral vector containing the VIVIT-coding sequence
fused to the carboxyl terminus of a fusion protein made between a
zeocin resistance marker and eGFP (Zeo:eGFP). For control, cells
expressing Zeo:eGFP were prepared and examined in parallel.
Fluorescence-activated cell-sorting analysis of the eGFP signals
established that >90% of the cells expressed the recombinant proteins
(data not shown). Figure 5A shows that
Zeo:eGFP:VIVIT expression reduces significantly (P < .001) UTP-stimulated NFAT-mediated luciferase transcription. This
inhibition (60 ± 2% inhibition) was slightly less effective than
that caused by CsA (80 ± 2% inhibition). Because the affinity of
the VIVIT peptide for calcineurin is > 1 µM (Aramburu et al., 1999
), the lower efficacy of VIVIT relative to CsA in our preparation is probably caused by relatively modest expression of the inhibitor from the viral promoter. Nevertheless, expression of Zeo:eGFP:VIVIT also reduces significantly (P < .01) UTP-stimulated
COX-2 mRNA expression (44 ± 7%) compared with the level induced
in control cells (Fig. 5C).
|
Nuclear run-on assays were performed to directly measure the effect of
CsA on UTP- and angiotensin II-stimulated COX-2 gene transcription.
Forty-five-minute treatments with either UTP or angiotensin II induce
COX-2 gene transcription 2- and 4-fold, respectively (Fig.
6), which are inhibited significantly in
cells treated with CsA (46 ± 10% inhibition for UTP and 38 ± 3% inhibition for angiotensin II). To further examine the effects
of CsA on COX-2 gene transcription a 2.7-kb promoter region from the
rat COX-2 gene (Sirois et al., 1993
) was cloned upstream of a
luciferase cDNA in a vector that also expresses CAT constitutively from
a second promoter. In cells infected with a promoterless retrovirus, luciferase activity is not induced by any agonist (Fig.
7). Treatment of VSMC infected with the
full-length COX-2 promoter/luciferase reporter construct using either
UTP, angiotensin II, or PDGF, enhances luciferase expression, which is
inhibited significantly by CsA. In contrast, forskolin and IL1-
do
not stimulate COX-2 promoter driven luciferase activity significantly
over basal.
|
|
A region in the distal COX-2 mRNA 3'-untranslated region has been
identified that stabilizes COX-2 mRNA decay in response to P2Y receptor
stimulation (Xu et al., 2000
). To determine whether CsA inhibits COX-2
mRNA expression by interfering with this regulated stabilization
mechanism, levels of a tetracycline-suppressible chimeric mRNA
containing the COX-2 3'-untranslated region stabilization element fused
downstream of a luciferase open-reading frame were measured after 1-h
agonist treatments. Chimeric mRNA levels are increased over basal
levels by UTP, angiotensin II, PDGF, and IL-1
, most likely because
of mRNA stabilization, but CsA treatment does not block this effect
(Fig. 8). This finding argues, along with
previous data, that CsA inhibits COX-2 mRNA induction predominantly by
a transcriptional rather then a post-transcriptional mechanism.
|
| |
Discussion |
|---|
|
|
|---|
Immunosuppression with CsA is necessary after organ
transplantation and useful in treating some autoimmune disorders, but the therapy is complicated in most subjects by rapidly developing cardiovascular side-effects, including renal toxicity and hypertension (Sander et al., 1996
). Although these are reversible on discontinuation of CsA-therapy, this is rarely an option and their consequences remain
a major barrier to long-term survival after organ transplantation (Faulds et al., 1993
). One implication of this CsA cardiovascular toxicity is it represents a manifestation of interference with essential homeostatic processes, such that understanding the mechanism of action may illuminate important and fundamental cardiovascular control mechanisms. Long-term treatment with nonsteroidal
anti-inflammatory agents that inhibit COX enzymatic activity is also
associated with progressive renal dysfunction (Sturrock et al., 1994
).
Inhibition of NFAT-mediated transcription by CsA is well established,
and evidence shows that expression of NFAT isoforms is not restricted to the immune system (Hoey et al., 1995
; Rao et al., 1997
). Therefore, a plausible mechanism for some aspects of CsA cardiovascular toxicity might include interference with nonlymphoid cell NFAT-mediated gene
expression. We speculate that, taken together, overlap might exist
between the toxic mechanisms of action of CsA and those of nonsteroidal
anti-inflammatory drugs; for this reason, we have begun to examine the
influence of CsA on COX-2 gene expression in VSMC and a potential role
for NFAT.
Several observations reported in this study clearly show that CsA
attenuates COX-2 gene expression, which is consistent with the
hypothesis that certain agonists use NFAT to induce COX-2 gene
expression in VSMC. First, the marked synergistic COX-2 mRNA induction
is caused by ionomycin and PMA, which is strongly inhibited by CsA.
This pharmacological pattern is typical of NFAT-regulated genes. The
synergy presumably involves CsA-sensitive,
Ca2+-directed nuclear import of NFAT and
PMA-mediated activation of essential NFAT transcriptional partners and
are stimuli that mimic the two arms of primary signaling cascades
activated by phospholipase C. Second, CsA selectively inhibits COX-2
mRNA induction caused by mitogens acting through cell surface receptors
that stimulate phospholipase C, with no effect on the weaker induction
caused by agents that do not cause Ca2+
mobilization. Third, the direct evidence from nuclear run-on analysis,
which is supported further by promoter/luciferase reporter activity
studies, shows that CsA inhibits mitogen-induced COX-2 gene
transcription. Fourth, UTP-induced COX-2 mRNA expression is blocked by
an independently acting inhibitor of NFAT-mediated transcription, the
mechanism of action of which does not involve inhibition of calcineurin
activity. Fifth, CsA inhibits only transcription mediated by an
NFAT-selective enhancer and not that of AP-1, SRE, or NF
B enhancers.
Our findings do not imply that NFAT is the sole transcriptional
coactivator linking mitogen signaling to increased COX-2 gene transcription. Clearly, UTP and PDGF are capable of stimulating several
different classes of transcription factors (Abbott et al., 2000
). CsA
seems somewhat selective for inhibiting NFAT-mediated transcription,
relative to a handful of other coactivators, and inhibits ~50% of
mitogen-induced COX-2 mRNA, such that NFAT likely plays a prominent
role in regulating the gene. We cannot exclude the possibility that
unknown CsA-sensitive transcription factors account for this
regulation. Future studies to identify the CsA-sensitive, mitogen-inducible promoter elements will be necessary to resolve this uncertainty.
A notable discrepancy is that although COX-2 mRNA levels are profoundly
induced in this preparation by mitogenic stimuli, the stimuli have
lesser effects on direct measurements of COX-2 gene transcription. We
have recently investigated the possibility that the full mRNA response
to mitogen involves simultaneous activation of transcriptional and
post-transcriptional mechanisms. UTP activation of the p42/44 MAP
kinase causes stabilization of a chimera mRNA composed of a luciferase
coding sequence and the full-length COX-2 mRNA 3'-untranslated region,
which has been delimited to a response element in the most distal
AU-rich segment of the mRNA (Xu et al., 2000
). However, just as
transcriptional induction alone cannot completely explain the magnitude
of UTP-stimulated COX-2 mRNA expression, neither can this
post-transcriptional response, because it also is only on the order of
3-fold. Yet the fact that it occurs forced us to address the
possibility that CsA might block it. However, the data shown in Fig. 8
indicate that CsA does not inhibit this distal 3'-untranslated
region-mediated mRNA stabilization mechanism. This implicates the
proven transcriptional mechanism as most likely responsible for the
effect of CsA on COX-2 mRNA induction. However, at this time we have
not ruled out the possibility that additional regulated stability
determinants exist in other regions of the COX-2 mRNA that may be
sensitive to CsA.
By showing that CsA affects transcriptional activity, and by
establishing potential connections through NFAT, the data provided in
this study establishes, to our knowledge for the first time, a
mechanistic basis for several previous observations showing that CsA
interferes with COX-2 protein expression and/or prostaglandin metabolism. Some studies have suggested CsA-mediated effects reflect post-translational mechanisms (Stahl et al., 1989
), whereas others have
also described inhibition of stimulus-evoked COX-2 mRNA expression (Martin et al., 1994
; Stroebel and Goppelt-Struebe, 1994
). Our finding
that IL-1
-mediated induction is not inhibited by CsA differs from
earlier reports demonstrating that IL-1
-stimulated COX-2 mRNA
expression in mesangial cells is attenuated by CsA (Martin et al.,
1994
). The discrepancies may be caused by cellular differences;
however, effects of CsA on IL-1
-induced mesangial cell COX-2 mRNA
are most prominent several hours beyond the immediate-early time
points measured in the present study. The mesangial cell response may
thus reflect secondary compensatory effects; for example, a delayed
but increasing contribution of putative IL-1
-regulated autocrine/paracrine factors that signal through CsA-sensitive mechanisms.
Our study shows differences between mitogens and IL-1
in terms of
CsA sensitivity, magnitude of expression, and kinetics of induction
that indicate the two classes of agonists use very distinct mechanisms
to induce the COX-2 mRNA in this preparation. The robust but transient
effects of mitogens compared with the slowly activated, longer-duration
response to IL-1
may have several explanations. Our data show that
mitogens are capable of activating several classes of transcription
factors in this preparation on which IL-1
has little effect, which
more robustly and selectively induces NF
B-mediated transcription
(Abbott et al., 2000
). NF
B may function in the nucleus for longer
periods, whereas mitogen-stimulated factors may be inactivated
quickly. Alternately, it is also possible that IL-1
and mitogen
receptors desensitize or their agonists degrade at different rates.
It is likely that the COX-2 gene has capacity for regulation by many
different mechanisms that function in cell-type and stimulus-dependent contexts. The extent to which NFAT contributes to responses elicited by
phospholipase C-coupled receptors in other cell phenotypes is unclear
at present, but CsA has been reported recently also to inhibit COX-2
mRNA induction in T lymphocytes by ionomycin and PMA, which seems to
involve NFAT (Iniguez et al., 1999
, 2000
). The COX-2 mRNA is induced in
our preparation by 80-fold and yet transcriptional induction is
at least an order of magnitude less than this. Yet the relative
magnitude of CsA inhibition of steady-state mRNA (~50%) approximates
its effect on transcriptional induction. This raises the possibility
that other mechanisms, perhaps those raised here that function
coordinately at the post-transcriptional level, work to magnify
responses acting at the level of transcriptional control. In this way,
modest direct transcriptional effects of NFAT and other transcriptional
coactivators might by amplified substantially.
| |
Acknowledgments |
|---|
We thank R. N. Dubois and J. S. Richards for the generous gift of plasmids containing the COX-2 cDNA and 2.7-kb COX-2 promoter region, respectively.
| |
Footnotes |
|---|
Received March 3, 2000; Accepted June 21, 2000
Supported by Grants HL52810 and HL56107 from the National Heart Lung and Blood Institute. T.J.M. is an established investigator of the American Heart Association. A.M.R. is supported by a predoctoral training grant (GM08602-03).
Send reprint requests to: T. J. Murphy, Ph.D., Department of Pharmacology, Emory University School of Medicine, 5031 O.W. Rollins Research Bldg., Atlanta, GA 30322. E-mail: medtjm{at}bimcore.emory.edu
| |
Abbreviations |
|---|
COX-2, cyclooxygenase-2;
CsA, cyclosporin A;
NFAT, nuclear factor of activated T-cells;
VSMC, vascular smooth muscle
cells;
PDGF-BB, platelet-derived growth factor-BB;
RPA, RNase
protection assay;
AP1, activator protein 1;
SRE, serum response
element;
NF
B, nuclear factor-
B;
kb, kilobase pairs;
PMA, phorbol
12-myristate 13-acetate.
| |
References |
|---|
|
|
|---|
q-coupled receptor signaling.
J Biol Chem
275:
23012-23019This article has been cited by other articles:
![]() |
B. Jespersen, H. C. Thiesson, C. Henriksen, K. Therland, C. Falk, T. Poulsen, B. Fogh, K. Madsen, S. Walther, and B. L. Jensen Differential effects of immunosuppressive drugs on COX-2 activity in vitro and in kidney transplant patients in vivo Nephrol. Dial. Transplant., May 1, 2009; 24(5): 1644 - 1655. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-R. Du, W.-H. Zhou, L. Dong, X.-Y. Zhu, Y.-Y. He, J.-Y. Yang, and D.-J. Li Cyclosporin A Promotes Growth and Invasiveness In Vitro of Human First-Trimester Trophoblast Cells Via MAPK3/MAPK1-Mediated AP1 and Ca2+/Calcineurin/NFAT Signaling Pathways Biol Reprod, June 1, 2008; 78(6): 1102 - 1110. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Xu, C. M. Kitchen, H.-K. G. Shu, and T. J. Murphy Platelet-derived Growth Factor-induced Stabilization of Cyclooxygenase 2 mRNA in Rat Smooth Muscle Cells Requires the c-Src Family of Protein-tyrosine Kinases J. Biol. Chem., November 9, 2007; 282(45): 32699 - 32709. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Jackson, Y. M. Usachev, and S. A. Thayer Bradykinin-Induced Nuclear Factor of Activated T-Cells-Dependent Transcription in Rat Dorsal Root Ganglion Neurons Mol. Pharmacol., August 1, 2007; 72(2): 303 - 310. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Zhang, P. Hopwood, C. C. Abrams, A. Downing, F. Murray, R. Talbot, A. Archibald, S. Lowden, and L. K. Dixon Macrophage Transcriptional Responses following In Vitro Infection with a Highly Virulent African Swine Fever Virus Isolate. J. Virol., November 1, 2006; 80(21): 10514 - 10521. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Peavy, K. B. Hubbard, A. Lau, R. B. Fields, K. Xu, C. J. Lee, T. T. Lee, K. Gernert, T. J. Murphy, and J. R. Hepler Differential Effects of Gq{alpha}, G14{alpha}, and G15{alpha} on Vascular Smooth Muscle Cell Survival and Gene Expression Profiles Mol. Pharmacol., June 1, 2005; 67(6): 2102 - 2114. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Damirin, H. Tomura, M. Komachi, M. Tobo, K. Sato, C. Mogi, H. Nochi, K. Tamoto, and F. Okajima Sphingosine 1-Phosphate Receptors Mediate the Lipid-Induced cAMP Accumulation through Cyclooxygenase-2/Prostaglandin I2 Pathway in Human Coronary Artery Smooth Muscle Cells Mol. Pharmacol., April 1, 2005; 67(4): 1177 - 1185. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Duque, M. Fresno, and M. A. Iniguez Expression and Function of the Nuclear Factor of Activated T Cells in Colon Carcinoma Cells: INVOLVEMENT IN THE REGULATION OF CYCLOOXYGENASE-2 J. Biol. Chem., March 11, 2005; 280(10): 8686 - 8693. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Vila-del Sol and M. Fresno Involvement of TNF and NF-{kappa}B in the Transcriptional Control of Cyclooxygenase-2 Expression by IFN-{gamma} in Macrophages J. Immunol., March 1, 2005; 174(5): 2825 - 2833. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-E. Janelle, A. Gravel, J. Gosselin, M. J. Tremblay, and L. Flamand Activation of Monocyte Cyclooxygenase-2 Gene Expression by Human Herpesvirus 6. ROLE FOR CYCLIC AMP-RESPONSIVE ELEMENT-BINDING PROTEIN AND ACTIVATOR PROTEIN-1 J. Biol. Chem., August 16, 2002; 277(34): 30665 - 30674. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Abbott, J. R. Loss II, A. M. Robida, and T. J. Murphy Evidence That Galpha q-Coupled Receptor-Induced Interleukin-6 mRNA in Vascular Smooth Muscle Cells Involves the Nuclear Factor of Activated T Cells Mol. Pharmacol., November 1, 2000; 58(5): 946 - 953. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||