|
|
|
|
Vol. 58, Issue 5, 946-953, November 2000
q-Coupled Receptor-Induced
Interleukin-6 mRNA in Vascular Smooth Muscle Cells Involves the Nuclear
Factor of Activated T Cells
Department of Pharmacology and Graduate Program in Molecular and Systems Pharmacology, Emory University School of Medicine, Atlanta, Georgia
| |
Abstract |
|---|
|
|
|---|
The immunosuppressant cyclosporin A inhibits transcription mediated by
the nuclear factor of activated T-cells (NFAT), a key regulator
of cytokine gene expression in lymphocytes that integrates phospholipase C signaling. NFAT is also expressed in vascular smooth
muscle cells, but the genes it regulates there are unknown. Here we
show that G
q-coupled P2Y nucleotide receptor
signaling in rat vascular smooth muscle cells increases NFAT-mediated
luciferase reporter expression. It also induces interleukin (IL)-6 gene
expression but not other cytokine mRNAs including IL-1, IL-2, IL-3,
IL-4, IL-10,
-interferon, tumor necrosis factor-
, or tumor
necrosis factor-
. IL-6 mRNA induction by UTP is more rapid and
transient then that caused by IL-1
stimulation and is partially
blocked by cyclosporin A or by expression of a
trans-dominant NFAT inhibitor. Expression of recombinant
NFATc1 markedly augments IL-6 mRNA induction by these and other
agonists, which is partially attributable to NFAT-regulated paracrine
mediators. However, trans-dominant NF
B inhibitors
strongly interfere with IL-6 mRNA induction both by IL-1
and by UTP,
which synergistically evoke IL-6 mRNA expression. These findings
suggest that NFAT is among the cofactors involved in NF
B-dependent
IL-6 gene induction by Ca2+-mobilizing receptors in
vascular smooth muscle cells.
| |
Introduction |
|---|
|
|
|---|
Cardiovascular
toxicity is a prominent side effect of cyclosporin A (CsA) or FK506
immunosuppressive therapy. The mechanisms underlying these drug side
effects are unknown, but they occur at doses that are necessary for
effective immunosuppression (Sander and Victor, 1995
). This is
consistent with the hypothesis that both immunosuppression and toxicity
are due to a common mechanism of drug action. Inhibition of
transcription mediated by the nuclear factor (NF) of activated T-cells
(NFAT) is widely thought to account for immunosuppression caused by CsA
and FK506 (Ho et al., 1996
). The Rel-related NFAT family of
transcription factors are produced from five known
genes1 and are best
understood as regulators of immune cell cytokine gene expression (Rao
et al., 1997
). CsA and FK506 inhibit the phosphatase calcineurin, which
mediates Ca2+-dependent cytoplasmic to nuclear
NFAT translocation after activation of phospholipase C (PLC) (Flanagan
et al., 1991
; Clipstone and Crabtree, 1992
). In nuclei, NFAT assembles
with other transcription factors on composite gene enhancer sites, the
best known of which are the activator protein-1 (AP-1) basic leucine
zipper proteins (e.g., c-fos and c-jun). Such NFAT partners are
activated through parallel stimulation of protein kinase C and/or the
mitogen-activated protein kinase cascades (Jain et al., 1992
; Northrop
et al., 1993
). Thus, NFAT transcription reflects integration of
multiple signaling pathways downstream of PLC-coupled receptors, such
as those regulating responsiveness to foreign antigens.
Although initially considered a lymphocyte-specific transcription
factor, the five NFAT genes are expressed differentially within most
tissues, and no single NFAT isoform is restricted to thymus, spleen, or
peripheral blood lymphocytes (Hoey et al., 1995
). Conceivably, the
cardiovascular toxicity associated with immunosuppressive drug therapy
might be related to disruption of NFAT-mediated transcription in
nonlymphoid cells. Recent work has established that NFAT-mediated
transcription can be induced by signaling from
Ca2+-mobilizing G
q
protein-coupled and growth factor receptors (Boss et al., 1996
,
1998a
,b
). NFAT is thus positioned as an effector target for signaling
directed by diverse families of mitogenic hormones, autacoids, and
growth factors in growing numbers of cell types. These include vascular
endothelial cells and vascular smooth muscle cells (VSMCs) and also
cardiac myocytes (Cockerill et al., 1995
; Boss et al., 1996
, 1998a
,b
;
Molkentin et al., 1998
; Armesilla et al., 1999
). The endogenous genes
that NFAT regulates within VSMCs are currently unknown. The following
data provide several lines of evidence that implicate NFAT in the
pathways regulating immediate-early interleukin (IL)-6 gene expression in rat aortic VSMCs after stimulation with mitogenic factors.
| |
Materials and Methods |
|---|
|
|
|---|
Cell Culture.
A continuous line of rat thoracic VSMCs
(Gunther et al., 1982
) obtained from R. W. Alexander (Emory
University) were maintained in Dulbecco's modified Eagle's medium
with 3.7 mg/ml NaHCO3, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% heat-inactivated calf serum in a 37°C
CO2 incubator with 5% CO2.
After reaching confluence, cells were cultured in serum-free media for
16 to 24 h before experimental treatments and used between eight
and 25 passages after primary explant. During this period, the cells maintain uniform growth and response characteristics. Phoenix retroviral producer cells (no. SD3443, American Type Culture
Collection, Rockville, MD) were grown like VSMCs, except that 10%
fetal bovine serum was used instead of calf serum. Stock solutions of
CsA, a gift from Sandoz Pharmaceutical Co. (East Hanover, NJ),
were prepared in 0.025% ethanol, 0.001% Tween-80 in
phosphate-buffered saline. Nucleotide agonists were purchased from
Sigma (St. Louis, MO), and platelet-derived growth factor (PDGF)-BB and
IL-1
were purchased from Calbiochem, Inc. (San Diego, CA).
Plasmid Constructions.
The retroviral expression
vector pTJ66 is a multistep derivative of the retroviral vector pTJM9
(Boss et al., 1998a
), constructed as follows. The neomycin resistance
cassette was excised from pTJM9 by digestion with BclI and
BstB I and replaced with a multicloning site
(SfiI, XhoI, SfiI) formed by the
oligonucleotides
5'GATCAGGCCTTGTAGGCCTAGGCTCGAGGCCTACAAGGCCTT and 5'CGAAGGCCTTGTAGGCCTCGAGCCTAGGCCTACAAGGCCT. The resulting vector,
pTJM11, was treated with BamHI, HindIII, and the
Klenow polymerase, to discard an internal cytomegalovirus
promoter, and recircularized to create pCL2. pCL2 thus has two
adapter-dependent universal cloning sites downstream of the single
5'-long terminal repeat (LTR) promoter (5'
SfiI/SfiI; 3' BstXI/BstXI),
which received NFATc1 (in the SfiI sites) and an internal
ribosome entry site (IRES):Zeo:eGFP cassette (in the
BstXI sites) by the following strategy. A shuttle expression
vector termed pTJM2 was first constructed, which is derived from the
pCDM8 expression vector (Invitrogen, Inc., San Diego, CA) by replacing
the supF gene with a
-lactamase cassette. A zeocin
resistance/eGFP fusion protein, in which the eGFP-coding sequence is at
the carboxyl end, was cloned into
HindIII/NotI-digested pTJM2 using a three-piece
ligation strategy to create pKA11. This was accomplished by preparing
1) an EcoRI/NotI restriction fragment from
pEGFP-N1 (Clontech, Inc., Palo Alto, CA), a zeocin resistance cDNA
coding HindIII/EcoRI fragment created by
polymerase chain reaction using the primers 5'
GCGAAGCTTCCATGGCCAAGTTGACCAGTG and 5' CGCGAATTCGAAGGTCCTGCTCCTCGGC and
the template pCMV- ShBle::ADH (a kind gift from T. Jaffredo, Centre National de la Recherche Scientifique, Toulouse,
France; Gautier et al., 1996
), and 3) HindIII/NotI-digested pTJM2. Subsequently,
pIRES-ZGFP was created by fusing an MscI/NotI
fragment from pKA11 into the MscI/NotI sites in
pCITE4a+ (Novagen, Inc., Madison, WI), placing Zeo:eGFP downstream of
an IRES sequence. Finally, pTJ66 was created by removing a
PvuII/NotI fragment from pIRES-ZGFP, blunting
with Klenow, ligating with BstXI adapters, and cloning into
BstXI-digested pCL2. The NFATc1 expression vector, termed
pTJ67, was created by removing the human NFATc1 coding sequence from
pSH107c (a gift from S. Ho and G. Crabtree, Stanford University, Palo
Alto, CA; Ho et al., 1995
), using AvrII and
HindIII, blunting with Klenow, ligation with SfiI
adapters (formed with the oligonucleotides 5'CTAGGCCTACA and
5'AGGCCTAG), and inserting into SfiI-digested pTJ66. Zeocin
treatment (100 µg/ml; over 4-5 days) of cells infected with
retrovirus prepared from this vector ensures expression in >99% of
the cells in culture. To create the Zeo:eGFP:VIVIT expression shuttle
plasmid pTJ80, a synthetic linker was cloned into the BsrGI
and NotI sites in the 3' end of Zeo:eGFP in pKA11 using the
oligonucleotides
5'GTACATGGCCGGCCCCCACCCCGTGATCGTGATCACCGGCCCCCACGAGGAGTAAGC and 5'GGCCGCTTACTCCTCGTGGGGGCCGGTGATCACGATCACGGGGTGGGGGCCGGCCAT, which create a coding sequence for the terminal peptide
(MAGPHPVIVITGPHEE) in-frame with the eGFP-coding sequence. A
HindIII-NotI fragment from pTJ80 was then
subcloned into the retroviral vector pCL2 for expression from the 5'LTR
promoter, creating pTJ85. The control for this vector is pTJ84, which
involved subcloning the HindIII-NotI Zeo:eGFP
cassette from pKA11 into pCL2. Trans-dominant NF
B
inhibitors used here are in the LZRS retroviral vector and were
received as a gift from P. Khavari (Stanford University; Seitz et al., 1998
).
Retroviral Production and VSMC Infection.
The protocols
describing transient, helper-virus free production of nonreplicating
recombinant retroviruses and VSMC infection have been described in
detail (Boss et al., 1998a
), except that the Phoenix-Ampho producer
cell line, rather than the Bing-CAK8 cells, were used here. The
retroviral NFAT-specific luciferase reporter vector pKA7, which encodes
a luciferase gene driven by a minimal promoter and a triple repeat of
the upstream NFAT enhancer, both derived from the human IL-2 gene, has
been described (Boss et al., 1998a
). Luciferase expression from this
vector is strictly dependent on NFAT (Boss et al., 1998a
).
Luciferase Reporter Assays.
Confluent VSMCs in serum-free
medium grown on 24 multiwell tissue culture plates were stimulated with
agonists for 5 h unless shown otherwise at 37°C in a 5%
CO2 incubator. The medium was aspirated, and
luciferase activity was measured using a Turner Designs 20e
luminometer (Sunnyvale, CA) as described previously (Takeuchi et al.,
1993
).
Western Blot Analysis.
Whole cell extracts of VSMCs were
collected and resolved by SDS-polyacrylamide gel electrophoresis using
7.5% polyacrylamide minigels (Bio-Rad, Inc. Richmond, CA) and then
probed with an anti-NFATc1 monoclonal antibody purchased from ABR, Inc.
(Boulder, CO) as described previously (Boss et al., 1998a
).
RNase Protection Assays (RPA).
VSMCs were grown to
confluence in 35-mm-diameter wells on tissue culture plates. The Trizol
reagent (Life Technologies/BRL, Inc., Gaithersburg, MD) was added after
stimulation, and the samples were frozen at
20°C until processed to
extract total RNA. RNA aliquots (2.5-10 µg) were lyophilized and
resuspended in hybridization buffer supplied with the RiboQuant
RPA kit (Pharmingen, Inc., San Diego, CA). A mixture of
[32P]UTP-labeled riboprobes was synthesized
using the rCK-1 multiprobe template set (Pharmingen), according to the
manufacturer's directions. These riboprobes detect mRNAs encoding the
cytokines IL-1
, IL-1
, tumor necrosis factor (TNF)-
,
IL-3, IL-4, IL-5, IL-6, IL-10, TNF
, IL-2,
-interferon, and the
constitutively expressed L32 and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) genes. After hybridization and RNase
digestion as recommended by the manufacturer, the samples were resolved
by electrophoresis through 5% polyacrylamide/5 M urea gels, which were
exposed to storage phosphor screens (Molecular Dynamics, Inc.,
Sunnyvale, CA). A volume integration protocol was used to quantify
hybridization signals using the ImageQuant software (Molecular
Dynamics). To control for variation in sample processing, IL-6 mRNA
hybridization signals (measured as volumes) were divided by the
hybridization volume of the ribosomal L32 mRNA within each sample.
Data Analysis. Statistical significance was calculated using a two-tailed paired t test, using routines in Prism v3.0 (GraphPad Software, Inc., San Diego, CA).
| |
Results |
|---|
|
|
|---|
P2Y Receptors Induce NFAT-Mediated Transcription in VSMCs.
To
determine whether G
q-coupled P2Y receptors
induce NFAT-mediated transcription in VSMCs, cultured rat VSMCs with a
stable NFAT-specific luciferase reporter transgene were stimulated with various extracellular nucleotides. Previous studies have established that this reporter provides reliable measure for NFAT activation (Boss
et al., 1998a
). As shown in Fig. 1, the
nucleotides UDP and UTP evoke luciferase responses that are ~10-fold
over basal levels, wherein UDP (EC50 = 1.2 ± 0.2 µM, mean ± S.E.M., n = 6) is slightly
more potent than UTP (EC50 = 4.7 ± 0.1 µM). The response to ATP is weak by comparison and occurs only at the
highest tested concentrations, whereas ADP has no significant effect on
this NFAT-mediated transcriptional response. This agonist potency
series is identical with that for nucleotide-stimulated NF
B
transcription in these cells (Abbott et al., 2000
). Given this, and
also measures of extracellular UTP catabolism, and reverse
transcriptase-polymerase chain reaction studies (Abbott et al., 2000
),
the simplest explanation is that gene expression responses to UTP in
this preparation most likely reflect activation of the UDP-preferring
G
q-coupled P2Y6 nucleotide receptor subtype (Abbott et al., 2000
).
|
Differential Induction of IL-6 mRNA Expression by UTP and
IL-1
.
A multiplex ribonuclease protection assay was used to
screen for cytokine mRNAs that are induced in VSMCs stimulated with 100 µM UTP. Responses were compared with those of maximally effective concentrations of the cytokine IL-1
, which does not activate PLC and
was chosen initially as a positive control for a known IL-6 mRNA
inducer. Of the 11 cytokine mRNAs surveyed, NFAT is involved in immune
cell induction of IL-2, IL-3, IL-4,
-interferon, and TNF
(Rao et
al., 1997
). However, as shown in Fig. 2,
both agonists stimulate only IL-6 gene expression in VSMCs but
by different magnitudes and kinetics. The response to a bolus of UTP is
robust but transient, with a peak effect in this series of experiments of 24 ± 5-fold over basal levels after 1 h of treatment
(n = 3), which returns to basal levels within 4 h.
In contrast, IL-6 mRNA induction by IL-1
is weaker but sustained,
with a maximal effect of 8 ± 2-fold over basal levels
(n = 3) occurring 2 h after treatment.
|
Ectopic NFATc1 Expression Augments NFAT-Mediated
Transcription.
Responses were measured in NFAT-luciferase reporter
VSMCs to determine whether overexpression of the NFATc1 isoform
enhances NFAT-mediated transcription. Using retroviral vectors, NFATc1 is expressed from a bicistronic mRNA coexpressing the visible selection
marker Zeo:eGFP, providing a strategy to ensure that all cells express
the recombinant NFATc1 mRNA (Fig. 3A),
which was confirmed by microscopic inspection and
fluorescence-activated cell sorting (data not shown). Control cells
were infected and treated in parallel with retrovirus prepared from the
parental vector, pTJ66, which only expresses Zeo:eGFP. Western blot
analysis using an NFATc1-specific antibody shows substantially higher
expression of recombinant NFATc1 over levels of endogenous NFATc1 (Fig.
3B). This results in enhanced basal NFAT-specific luciferase
transcription, which is ~10-fold greater in cells expressing NFATc1
[1.69 ± 0.12 arbitrary light units (ALU)] compared with control
cells (0.12 ±.0.01 ALU). Agonist-stimulated NFAT-specific luciferase
transcription is also enhanced in cells expressing recombinant NFATc1,
although the responses are not strictly proportional to its effect on
basal transcription. For example, compared with responses in control cells, maximal activation by phorbolmyristyl acetate plus ionomycin is
enhanced only 2-fold in NFATc1 cells, whereas those to PDGF and
angiotensin II are 10-fold greater in NFATc1 cells.
|
Effects of CsA and Ectopic NFAT Expression on IL-6 Induction.
Using both the NFATc1 overexpression cell line and its control cell
line, we tested how inhibiting calcineurin using CsA (1 µM) affects
IL-6 mRNA induction after a 1-h treatment with various classes of
agonists (Fig. 4). This series of
experiments was performed in parallel, and responses in both cell lines
are normalized to the maximal effect of UTP in control cells observed
within each experiment. By normalizing the data in this way, we
illustrate both the differential efficacy of the various agonists and
how ectopic NFATc1 expression dramatically augments IL-6 mRNA responses to these agonists. In control cells, CsA significantly inhibits basal,
UTP-, and PDGF-BB-stimulated IL-6 mRNA expression (Fig. 4A). For
unclear reasons, unlike the effects of other agonists, we found
substantial interassay variability in the maximal effect associated
with angiotensin II treatment relative to that for UTP, thus explaining
the error bars in those data. However, within each individual
experiment, CsA also significantly attenuates the angiotensin II
response. In contrast to the effects of these mitogens, the response to
IL-1
in control cells is CsA insensitive.
|
(Fig. 4B). For example, UTP is consistently the strongest
inducer of the IL-6 mRNA in both control and NFATc1 cells. Recombinant
NFATc1 expression enhances the UTP response an additional 10-fold over
that seen in control cells, and the degree of CsA inhibition increases
from 45% in control cells to 88% in NFATc1 cells. Similarly, the
relative response to IL-1
is enhanced by NFATc1 expression, and
unlike in control cells, CsA inhibits a significant component of the
IL-1
response in cells expressing NFATc1. Interestingly, the
response to angiotensin II is only slightly enhanced by NFATc1
expression, but this also remains CsA sensitive.
Effects of a Trans-Dominant NFAT Inhibitor.
A
recently described peptide inhibitor of NFAT, termed VIVIT, was fused
to the carboxyl terminus of the Zeo:eGFP module and expressed in VSMCs
from a retroviral vector. Zeo:eGFP without this epitope was expressed
in parallel cells as a control. The VIVIT peptide mimics a purported
calcineurin-docking site on the NFAT surface. Thus, unlike CsA, VIVIT
inhibits NFAT dephosphorylation and nuclear translocation without
affecting calcineurin catalytic activity (Aramburu et al., 1999
).
Fluorescence-activated cell sorting analysis of the eGFP signal
confirmed that between 90 and 95% of the cells in culture express the
fusion protein after infection with the retrovirus (data not shown).
Zeo:eGFP:VIVIT expression inhibited NFAT-specific luciferase activity
by ~67% (Fig. 5A), which approaches
the 80% level of inhibition routinely caused by CsA (Boss et al.,
1998a
). UTP-stimulated IL-6 mRNA induction in VSMCs expressing
Zeo:eGFP:VIVIT is 55 ± 15% (mean ± S.E., n = 4) of the level induced in parallel treated control cells expressing Zeo:eGFP (Fig. 5, B and C). This inhibitory effect is similar to that
caused by CsA (see Fig. 4A).
|
NFATc1 Expression Enhances IL-1
and IL-1
mRNA Expression in
VSMCs.
In control VSMCs, IL-1
and IL-1
mRNAs are
undetectable under basal conditions and are not induced by either
IL-1
or UTP. In contrast, we noticed that the IL-1
and IL-1
mRNAs are slightly detectable over background hybridization in VSMCs
that overexpress recombinant NFATc1. Treatment for 1 h with UTP,
IL-1
, and PDGF-BB enhances the expression of each mRNA (Fig.
6). Furthermore, CsA treatment attenuates
induction of the IL-1
mRNA to a greater degree than it affects the
IL-1
mRNA.
|
NFATc1-Mediated Paracrine Effect on IL-6 mRNA Induction.
To
test the possibility that profound IL-6 mRNA induction in NFATc1
overexpression cells might involve paracrine effects, cells
expressing recombinant NFATc1 were cocultured over monolayers of normal
VSMCs using permeable culture chamber inserts. Cells were infected in
parallel with the empty vector (pTJ66) for a control overlay. After the
cells reached confluence over 4 to 5 days in culture, the inserts were
discarded and IL-6 mRNA induction was then measured in the bottom
monolayers 1 h after UTP was added. As shown in Fig.
7, NFATc1 overlay cells have no effect on
the IL-6 mRNA response to vehicle but sensitize UTP-stimulated IL-6 mRNA expression compared with control. We observed no contamination of
the bottom monolayers by Zeo:eGFP-positive overlay cells. These results
suggest that NFATc1-regulated paracrine factors may sensitize subsequent G
q-coupled receptor-stimulated IL-6
mRNA expression in VSMCs.
|
NF
B Is Necessary for IL-6 mRNA Induction in VSMCs.
A recent
study has shown that basal and angiotensin II-stimulated IL-6 mRNA
induction in rat VSMCs is attenuated by a pharmacological inhibitor of
I
B degradation, suggesting a crucial role for NF
B in the
response to mitogens (Han et al., 1999
). Furthermore, we recently
reported that P2Y receptors stimulate transcription from a
NF
B-specific retrovirus-based luciferase reporter but only to a
level that is ~10% of that caused by IL-1
(Abbott et al., 2000
).
Expression in VSMCs of two independently acting
trans-dominant NF
B inhibitors,
-SP-p50 (Logeat
et al., 1991
) or I
B
-M protein (Van Antwerp et al., 1996
), can
block up to 90% of the effect of either agonist on NF
B reporter
gene activity (Abbott et al., 2000
). IL-6 mRNA levels were measured
after a 1-h treatment with either UTP or IL-1
in two cell lines
expressing either of these inhibitors and compared with that in VSMCs
infected with a negative control retrovirus. As shown in Fig.
8A, IL-6 mRNA induction by both agonists
is almost completely abrogated in cells expressing the NF
B
inhibitors, suggesting that NF
B is a necessary factor in each
response.
|
B-dependent and
NF
B-independent mechanisms might operate synergistically to control
IL-6 mRNA expression in response to the mitogen. To test this, IL-6 mRNA was measured at different times up to 4 h in VSMCs
costimulated with UTP and IL-1
and compared with responses to each
agonist alone, treated in parallel. Costimulation results in a markedly synergistic induction of the IL-6 mRNA during the period between 1 and
3 h after cotreatment with UTP and IL-1
(Fig. 8B). The earliest
times after costimulation are insensitive to CsA treatment, but CsA
suppresses responses between 2 and 4 h after costimulation (Fig.
8C).
| |
Discussion |
|---|
|
|
|---|
The growing awareness that NFAT proteins are more widely
distributed than originally thought has important implications. In lymphocytes, NFAT utilization is better coupled to more profound and
sustained, rather than weaker, Ca2+ signals
(Timmerman et al., 1996
). In this way, NFAT is refractory to weaker
cell activation because of ancillary physiological signals and more
efficiently engaged in response to powerful stimuli such as a foreign
antigen. Whether this discriminative capacity holds true in nonlymphoid
cells is uncertain, and few conceivable physiological factors alone
would seem capable of triggering VSMC activation to the degree that
antigens can activate lymphocytes. Outside of immune cells, we
speculate that NFAT may couple more subtle forms of signaling to gene
regulation. The likelihood that differences might exist in modes of
NFAT regulation between various cell phenotypes is evident in part by
our finding that none of the known NFAT-regulated genes in other cells
is induced by P2Y receptor activation in VSMCs. Obviously, higher
orders of cellular controls must work along with NFAT to restrict
expression of these several cytokines to different cellular contexts.
Nevertheless, the finding begs the question of whether regulation of
the heterologous NFAT enhancer used in our luciferase reporter, which
is derived from the human IL-2 gene, fully represents VSMC-restricted
properties of NFAT-mediated regulation. For this reason, and as a
beginning to understand its physiological role, finding NFAT-regulated
genes endogenous in VSMCs is important.
The present data provide several observations indicating a role for
NFAT in immediate-early IL-6 gene expression in VSMCs in response to
P2Y receptor signaling. They indicate that NFAT likely does not
function as the sole transcription factor regulating IL-6 gene
expression and are, instead, consistent with the hypothesis that NFAT
coregulates IL-6 expression in a manner that is strictly dependent on
coactivation by NF
B. Three experimental findings suggest a role for
NFAT. The first two are inhibition by CsA and expression of the
Zeo:eGFP:VIVIT protein, as two independently acting inhibitors of
NFAT-mediated transcription. One acts by inhibition of calcineurin
catalytic activity, whereas the latter purportedly interferes by
preventing calcineurin from interacting with NFAT (Aramburu et al.,
1999
). Each reduces IL-6 mRNA expression by ~50%, and the degree of
IL-6 mRNA responsiveness unaffected by these inhibitors could reflect
NFAT-independent mechanisms of mRNA induction. In the case of the VIVIT
inhibitor, it is also possible that residual responses occur in a
proportion of cells that express lower levels of fusion protein.
However, quite possibly CsA- and VIVIT-resistant responsiveness could
reflect NFAT-mediated transcription that occurs independently of
calcineurin activation. For example, significant amounts of
nuclear NFATc2 are present in these cells under basal,
nonstimulated conditions and would be positioned to coactivate gene
expression in an apparently Ca2+-independent
manner (Boss et al., 1998a
). Given this, as a complementary approach to
using inhibitors, we also show that overexpression of NFATc1 markedly
sensitizes the IL-6 gene to subsequent agonist stimulation. Although
this approach could have indirect effects on IL-6 mRNA, for example,
through regulation of paracrine-sensitizing factors, it is notable that
a substantially greater inhibition of agonist response in these cells
is achieved by CsA treatment. Because the CsA was added just briefly
before the agonist, and because the IL-6 mRNA levels were measured only
after a 60-min treatment, this suggests a significant direct role for
NFATc1 in the immediate-early phase of the response. Thus, the most
likely site for this effect would be at the level of promoter activation.
Previously, only a few plausible connections have linked NFAT to the
regulation of IL-6 gene expression. In mast cells, IL-6 protein
expression is attenuated by CsA or FK506 and is also correlated with an
increased NFATc1 protein expression that follows manipulation with a
Vav transgene (Fruman et al., 1995
; Williams and Coleman, 1995
; Song et
al., 1999
). Reduced IL-6 production is also reported in chimera mice
with a targeted thymocyte NFATc1 deletion (Yoshida et al., 1998
). One
contrary study has shown, through purported NF
B induction, that
FK506 treatment actually increases murine IL-6 gene expression in
nonlymphoid tissues (Muraoka et al., 1996
). Whether this is related to
nonoverlapping cellular activities of the two immunosuppressants is
uncertain. Unlike CsA, FK506 promotes Ca2+
release from ryanodine-sensitive endoplasmic reticulum, presumably by
inhibiting the interaction between FK-binding proteins
and the ryanodine receptor (Bers et al., 1998
).
Previous evidence that NF
B and other coactivators participate in
IL-6 gene expression is considerably more substantial than that of a
role for NFAT. Various stimuli, including cytokines, G-protein-coupled
receptor agonists, growth factors, phorbol esters, and
lipopolysaccharide can stimulate IL-6 mRNA expression in VSMCs and
other cells. Several recent studies have implicated CREB, AP-1,
and NF
B in the responses to mitogens (Kranzhofer et al., 1996
;
Beasley, 1997
; Gaumond et al., 1997
; Kozawa et al., 1997
; Leung et al.,
1998
; Funakoshi et al., 1999
; Han et al., 1999
). In addition to
expanding an understanding of how CsA affects IL-6 mRNA induction, the
most notable surprise in our data compared with these studies is the
relatively weaker immediate-early effect of IL-1
compared with UTP.
The more robust response to UTP, synergistic effects during
costimulation with a cytokine, and the finding that a
trans-dominant NF
B inhibitor blocks induction together argue for complex mechanisms of IL-6 gene regulation by
G
q-coupled receptor signaling. NF
B
activation is an apparently common mechanism shared by both
physiological stimuli, and yet P2Y receptors appear to evoke the IL-6
mRNA by using additional mechanisms. In this preparation, UTP is
reported as a broadly effective inducer of transcription mediated by
several coactivators including AP-1, CREB, serum
response/ternary complex factors, and the NFAT protein (Abbott et al.,
2000
). IL-1
has little discernible effect on transcription mediated
by these factors and, instead, rather selectively stimulates
NF
B-mediated transcription, which it does substantially more
effectively than P2Y receptor signaling and by apparently distinct
mechanisms (Abbott et al., 2000
). Notably, exploiting the retroviral
luciferase reporter strategy, we have shown that CsA has no effect on
transcription mediated by any of these other factors and, instead,
selectively inhibits NFAT-mediated transcription in this preparation
(Robida et al., 2000
).
Reconciling this apparent complexity associated with
G
q-coupled receptor-induced IL-6 gene
expression will be important, but it is notable that neither NFAT nor
any other coactivator alone accounts for the regulation of a leading
prototype for an NFAT-responsive locus, which is the IL-2 gene in human
T-cells. IL-2 gene expression depends on full occupancy of all of its
enhancers by diverse groups of transcription factors, including NF
B,
that are coactivated by a strong antigenic stimulus (Garrity et al., 1994
). Numerous other examples of promoter function dependent on
synergistic and coordinate assembly of multiple transcription factors
have been described (Tjian and Maniatis, 1994
). The present results
predict that NFAT participates as a cofactor in NF
B-dependent activation of the IL-6 gene by mitogenic,
Ca2+-mobilizing stimuli and will prove an
important frame of reference when this hypothesis is tested using other
approaches. Other transcriptional coactivators are likely involved in
addition to NFAT and NFkB, and studies are under way to dissect out
this regulation using approaches that will build on the findings
established in this report.
| |
Acknowledgments |
|---|
We thank Brian Adams for technical assistance in early phases of this study, Michelle Ellington for technical support, and John T. Turner for helpful discussion regarding P2Y receptor pharmacology.
| |
Footnotes |
|---|
Received February 17, 1999; Accepted August 9, 2000
Supported by Grants HL52810 and HL56107 from the National Heart, Lung, and Blood Institute. T.J.M. is an Established Investigator of the American Heart Association. A.M.R. is supported by a National Institutes of Health predoctoral training grant (GM08602).
1 NFAT nomenclature is unsettled. Synonyms of the five known genes are: 1) NFATc1, NFAT2, NFATc; 2) NFATc2, NFAT1, NFATp; 3) NFATc3, NFAT4, NFATx; 4) NFATc4, NFAT3; and 5) NFAT5.
Send reprint requests to: T. J. Murphy Ph.D., Department of Pharmacology, Emory University School of Medicine, 5031 O.W. Rollins Research Building, Atlanta, GA 30322. E-mail: medtjm{at}emory.edu
| |
Abbreviations |
|---|
CsA, cyclosporin A; NFAT, nuclear factor of activated T-cells; PLC, phospholipase C; PDGF, platelet derived growth factor; IL, interleukin; VSMC, vascular smooth muscle cell; AP-1, activator protein-1; LTR, long terminal repeat; IRES, internal ribosome entry site; TNF, tumor necrosis factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ALU, arbitrary light units; CREB, cAMP response element binding protein; AP-1, activation protein-1; RPA, ribonuclease protection assay.
| |
References |
|---|
|
|
|---|
q-coupled and cytokine receptors.
J Mol Cell Cardiol
32:
391-403[Medline].This article has been cited by other articles:
![]() |
S. Taurin, N. Sandbo, D. M. Yau, N. Sethakorn, and N. O. Dulin Phosphorylation of {beta}-catenin by PKA promotes ATP-induced proliferation of vascular smooth muscle cells Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1169 - C1174. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. de Frutos, L. Duling, D. Alo, T. Berry, O. Jackson-Weaver, M. Walker, N. Kanagy, and L. Gonzalez Bosc NFATc3 is required for intermittent hypoxia-induced hypertension Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H2382 - H2390. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Xu and H.-K. G. Shu EGFR Activation Results in Enhanced Cyclooxygenase-2 Expression through p38 Mitogen-Activated Protein Kinase-Dependent Activation of the Sp1/Sp3 Transcription Factors in Human Gliomas Cancer Res., July 1, 2007; 67(13): 6121 - 6129. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. de Frutos, R. Spangler, D. Alo, and L. V. G. Bosc NFATc3 Mediates Chronic Hypoxia-induced Pulmonary Arterial Remodeling with {alpha}-Actin Up-regulation J. Biol. Chem., May 18, 2007; 282(20): 15081 - 15089. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Nilsson, Z.-W. Sun, J. Nilsson, I. Nordstrom, Y.-W. Chen, J. D. Molkentin, D. Wide-Swensson, P. Hellstrand, M.-L. Lydrup, and M. F. Gomez Novel blocker of NFAT activation inhibits IL-6 production in human myometrial arteries and reduces vascular smooth muscle cell proliferation Am J Physiol Cell Physiol, March 1, 2007; 292(3): C1167 - C1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. O'Connor, S. T. Mills, K. A. Jones, S. N. Ho, and G. K. Pavlath A combinatorial role for NFAT5 in both myoblast migration and differentiation during skeletal muscle myogenesis J. Cell Sci., January 1, 2007; 120(1): 149 - 159. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Douillet, W. P. Robinson III, P. M. Milano, R. C. Boucher, and P. B. Rich Nucleotides induce IL-6 release from human airway epithelia via P2Y2 and p38 MAPK-dependent pathways Am J Physiol Lung Cell Mol Physiol, October 1, 2006; 291(4): L734 - L746. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-A. Renault, S. Jalvy, M. Potier, I. Belloc, E. Genot, L. V. Dekker, C. Desgranges, and A.-P. Gadeau UTP Induces Osteopontin Expression through a Coordinate Action of NF{kappa}B, Activator Protein-1, and Upstream Stimulatory Factor in Arterial Smooth Muscle Cells J. Biol. Chem., January 28, 2005; 280(4): 2708 - 2713. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, N. Dronadula, and G. N. Rao A Novel Role for Nuclear Factor of Activated T Cells in Receptor Tyrosine Kinase and G Protein-coupled Receptor Agonist-induced Vascular Smooth Muscle Cell Motility J. Biol. Chem., September 24, 2004; 279(39): 41218 - 41226. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Schafer, F. Sedehizade, T. Welte, and G. Reiser ATP- and UTP-activated P2Y receptors differently regulate proliferation of human lung epithelial tumor cells Am J Physiol Lung Cell Mol Physiol, August 1, 2003; 285(2): L376 - L385. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Gomez, A. S. Stevenson, A. D. Bonev, D. C. Hill-Eubanks, and M. T. Nelson Opposing Actions of Inositol 1,4,5-Trisphosphate and Ryanodine Receptors on Nuclear Factor of Activated T-cells Regulation in Smooth Muscle J. Biol. Chem., September 27, 2002; 277(40): 37756 - 37764. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||