|
|
|
|
Vol. 58, Issue 6, 1357-1367, December 2000
Laboratory of Pharmacology and Chemistry (D.S.M.), National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, North Carolina; Institut fur Pharmazeutische Technologie und Biopharmazie (S.N.N., G.F.), Heidelberg, Germany; Divisions of Gastroenterology and Clinical Pharmacology, Department of Internal Medicine, and Department of Research (H.G., M.T., J.D.), University Clinic (Kantonsspital and Childrens Hospital) Basel, Switzerland
| |
Abstract |
|---|
|
|
|---|
To identify specific transporters that drive xenobiotics from central nervous system to blood, the accumulation of fluorescent drugs was studied in isolated capillaries from rat and pig brain using confocal microscopy and quantitative image analysis. Luminal accumulation of daunomycin and of fluorescent derivatives of cyclosporine A (CSA) and ivermectin was concentrative, specific, and energy-dependent (inhibition by NaCN). Transport was reduced by PSC 833, ivermectin, verapamil, CSA, and vanadate, but not by leukotriene C4 (LTC4), indicating the involvement of P-glycoprotein. Luminal accumulation of the fluorescent organic anions sulforhodamine 101 and fluorescein methotrexate was also concentrative, specific, and energy-dependent. LTC4, chlorodinitrobenzene, and vanadate reduced transport of these compounds, but PSC 833 and verapamil did not, indicating the involvement of a multidrug resistance-associated protein (Mrp). Immunostaining localized P-glycoprotein and Mrp2 to the luminal surface of the capillary endothelium and quantitative polymerase chain reaction showed Mrp1 and Mrp2 expression. Finally, the HIV protease inhibitors saquinavir and ritonavir were potent inhibitors of transport mediated by both P-glycoprotein and Mrp. These results validate a new method for studying drug transport in isolated brain capillaries and implicate both P-glycoprotein and one or more members of the Mrp family in drug transport from central nervous system to blood.
| |
Introduction |
|---|
|
|
|---|
The
brain capillary endothelium is a formidable barrier to the entry of
drugs into the central nervous system. Traditionally, two elements have
been considered primarily responsible for the barrier function of this
nonfenestrated endothelium: tight junctions, which form an effective
seal against intercellular diffusion, and the cells themselves, which
exhibit a low rate of endocytosis. More recently, a role in blood-brain
barrier function has been proposed for specific drug export pumps
(e.g., P-glycoprotein). This proposal is based on three types of
evidence. First, Western blots from isolated microvessels and cultured
endothelial cell monolayers show a strong signal for P-glycoprotein
(Hegmann et al., 1992
; Jette et al., 1993
; Begley et al., 1996
; Huwyler
et al., 1996
). Immunostaining studies suggest that P-glycoprotein is
localized to the luminal surface of the endothelium (Seetharaman et
al., 1998
), although there is some controversy over this point (see
under Discussion). Second, cell physiological studies show specific, net basal-to-apical transport of drugs in monolayers of
cultured endothelial cells. The transported compounds and the effective
inhibitors implicate P-glycoprotein (Tatsuta et al., 1992
; Shirai et
al., 1994
; Huwyler et al., 1996
). Third, animals that have reduced
P-glycoprotein function as a result of knockout technology or treatment
with drugs that saturate or block P-glycoprotein transport activity
show increased accumulation of P-glycoprotein substrates in brain as
well as a markedly increased sensitivity to neurotoxic P-glycoprotein
substrates (e.g., ivermectin) (Schinkel et al., 1994
; 1996
; Mayer et
al., 1997
).
Although these findings suggest an important role for the transporter
in brain capillary barrier function, there has been no direct
demonstration of P-glycoprotein-mediated transport in isolated
capillaries. Moreover, it is not clear whether other members of the ABC
transporter superfamily also participate. For example, the evidence for
Mrp participation comes from experiments with brain capillary
endothelial cells in culture (Huai Yun et al., 1998
; Regina et al.,
1998
) and plasma membranes from a brain endothelial cell line (Kusuhara
et al., 1998a
). However, when brain capillary endothelial cells are put
into culture, Mrp1 expression increases (Seetharaman et al., 1998
), so
the physiological significance of the transport experiments with
cultured cells is in question. A role for Mrps in barrier function in
situ has yet to be established.
A critical impediment to understanding transport function in intact
brain capillaries is the lack of suitable in vitro techniques that both
retain viability and allow the investigator to measure luminal
accumulation of diffusible solutes. For example, although isolated
capillaries had been used to study the uptake of radiolabeled glucose
and amino acids (Pardridge, 1998
), it was not clear from those
experiments whether the label accumulated in the cells or in the
vascular space. In the present study, we used the optical sectioning
capabilities of confocal microscopy to visualize and measure the
accumulation of fluorescent drugs within the lumens of freshly isolated
capillaries from rat and pig brain. We show that such transport is
concentrative, specific, and energy-dependent. Based on substrate and
inhibitor profiles and immunostaining experiments, both P-glycoprotein
and one or more Mrps seem to be involved. These are the first data to
show that transport function of these transporters can be detected in
isolated brain capillaries and the first to directly demonstrate a role
for an Mrp in the blood-brain barrier.
| |
Materials and Methods |
|---|
|
|
|---|
Chemicals. The HIV protease inhibitors saquinavir mesylate and ritonavir were a kind gift from Dr. H. Wiltshire, Roche Ltd., UK. The fluorescent-labeled cyclosporin analog NBDL-CSA was obtained from Novartis LTD, Basel, CH; FL-MTX and BO-IVER were obtained from Molecular Probes (Eugene, OR), and sulforhodamine 101 and daunomycin were obtained from Sigma Chemical (St. Louis, MO). All other chemicals were of analytical grade and were obtained from commercial sources.
Capillary Isolation.
Capillaries from pig (2-3 animals per
preparation) and rat (3-6 animals per preparation) brain were isolated
using a modification of the procedure of Pardridge et al. (1985)
. All
steps in the isolation procedure were carried out at 4°C in pregassed
(95% O2/5% CO2)
solutions. Keeping the tissue on ice and in well-gassed buffers was
essential for preservation of transport function. Briefly, pieces of
gray matter were gently homogenized in three volumes (v/w) of buffer A
(103 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl2, 1.2 mM
KH2PO4, 1.2 mM
MgSO4, 15 mM HEPES) and, after addition of
dextran (final concentration 30%), the homogenate was centrifuged at
low speed. The resulting pellet was resuspended in buffer B [buffer A
supplemented with 25 mM NaHCO3, 10 mM glucose, 1 mM Na-pyruvate, 0.5% (w/v) BSA and then filtered through a 200 µm nylon mesh]. The filtrate was passed over a glass bead column and,
after washing with 500-ml buffer, the capillaries adhering to the beads
were collected by gentle agitation. Capillaries were centrifuged, the
pellet resuspended in ice-cold, gassed, BSA-free Krebs-Henseleit buffer
and immediately used for transport experiments.
Confocal Microscopy.
To measure transport, 50 µl of
capillary suspension was transferred to a covered, Teflon incubation
chamber containing 1.5 ml of pregassed Krebs-Henseleit buffer with
fluorescent compound and added effectors. The chamber floor was a 4- × 4-cm glass cover slip to which the capillaries adhered and through
which capillaries could be viewed by means of an inverted confocal
laser microscope. Fluorescent compounds and inhibitors were added to
the incubation medium as stock solutions in dimethyl sulfoxide.
Preliminary experiments showed that the concentrations of dimethyl
sulfoxide used (
0.5%) had no significant effects on the uptake and
distribution of the fluorescent labeled test compounds in brain
capillaries as measured by confocal microscopy (D.S. Miller,
unpublished data). All transport experiments were conducted at
room temperature (18-20°C).
Immunostaining. Freshly isolated pig and rat brain capillaries adhering to glass cover slips were were washed in PBS and fixed for 10 min at room temperature in 2% (v/v) formaldehyde/0.1% (v/v) glutaraldehyde. After washing in PBS, capillaries were permeabilized in 1% (v/v) Triton X-100 in PBS, washed and incubated for 90 min at 37°C in PBS with primary antibody. After washing, antibody binding was detected using a fluorescein isothiocyanate-labeled secondary antibody for 60 min at 37°C. Capillaries were viewed with a confocal microscope as described above. The primary antibody for P-glycoprotein detection was Ab-1 (Oncogene Science, Uniondale, NY), an antibody to human mdr-1 raised in rabbits. The primary antibody for Mrp detection was a monoclonal antibody to rat cMOAT (Mrp2; kindly provided by Dr. Peter Meier). This antibody does not cross-react with Mrp1 or Mrp6, but its reactivity to Mrp3-5 has not been tested (P. Meier, personal communication).
Real-Time Quantitative PCR.
Total RNA was extracted
using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the
manufacturer's protocol. After DNaseI digestion, RNA was quantified
using a GeneQuant photometer (Pharmacia, Uppsala, Sweden). Its
integrity was checked by ethidium bromide agarose gel electrophoresis.
The purity of the RNA preparations was high, as demonstrated by the 260 nm/280 nm ratio (range 1.8 to 2.0). One microgram of total RNA was
reverse transcribed by Superscript II (Life Technologies, Basel,
Switzerland) according to the manufacturer's protocol using random
hexamers as primers. Real-time quantitative PCR analysis was performed
with the TaqMan assay using an ABI PRISM 7700 Sequence Detector (PE
Biosystems, Rotkreuz, Switzerland), a combined thermocycler and
fluorescence detector. A dual-labeled fluorogenic probe complementary
to a sequence within each PCR product was added to the PCR reaction. The fluorescent dye at the 5' end of the probe (6-carboxy-fluorescein) serves as reporter, and its emission is quenched by the second fluorescent dye at the 3' end of the probe
(6-carboxy-tetramethyl-rhodamine). During elongation, the 5'-to-3'
exonuclease activity of the Taq DNA polymerase cleaves the
probe, thus releasing the reporter from the quencher. Fluorescence is
monitored during the whole reaction directly in the reaction tubes.
Primers were custom synthesized by Life Technologies (Paisley,
Scotland) and probes by Eurogentec (Seraing, Belgium). Primers and
probes used were: GAPDH, GGTGAAGGTCGGAGTGAACG and CGACAATGTCCACTTTGCCA
with the probe CGCCTGGTCACCAGGGCTGC; MRP1, GACCCTTGATTGCCACGTG and
TGGGCTGTGGGAAGTCGT with the probe CCTCCACTTTGTCCATCTCAGCCAAGAG; MRP2,
TGTGGGCTTTGTTCTGTCCA and CAGCCACAATGTTGGTCTCG with the probe
CTCAATATCACACAAACCCTGAACTGGCTG. Complementary DNA (25 ng total RNA) was
amplified in a 25-µl volume containing 12.5 µl of the 2× TaqMan
universal PCR master mix (PE Biosystems, Foster City, CA), 225 nM
probe, and 900 nM each primer. Cycling conditions were 10 min at 95°C
for initial denaturation and activation of AmpliTaq Gold DNA
polymerase, followed by 40 cycles at 15 s and 95°C denaturation,
and 1-min, 60°C combined annealing and primer elongation.
Mathematical analysis was performed as follows: amplification efficiency (E) of individual amplicons were calculated in the exponential phase of the reaction by following equation:
|
|
| |
Results |
|---|
|
|
|---|
Figure 1 shows high-magnification
bright field and confocal images of a rat brain capillary exposed to 5 µM daunomycin. The bright field image (Fig. 1A) demonstrates the
morphological complexities of the preparation. Capillary segments are 5 to 8 µm in diameter and up to several hundred micrometers in length.
They can be straight or branched, but their ends appear open. Pericytes
are embedded within the capillary endothelium; these are evident as
large, oval-shaped cells on the surface. In addition, capillary lumens contain both a fluid-filled space and blood cells, which can be recognized by their regular, ovoid shape and limiting membranes. Preliminary experiments with fluorescein-labeled dextrans
(molecular mass, 10-40 kDa) indicated at best slow penetration
of the dye into the luminal space. After 60 to 120 min, levels of
fluorescence in the lumen and the endothelium were well below those in
the medium (not shown), demonstrating in the isolated capillary that the endothelium presents a significant barrier to the diffusional entry
of large molecules, a finding consistent with the known properties of
the capillaries in vivo.
|
Figure 1B is a single confocal slice showing a cross-section of the capillary. Daunomycin fluorescence is not evenly distributed over the vessel. The structures with the highest fluorescence intensity are the pericytes. Our initial estimate from measurements of confocal stacks is that these make up 20% of capillary volume and account for nearly 50% of total fluorescence in vessels exposed to daunomycin. The structures with the lowest fluorescence intensity are the blood cells trapped within the lumen. This can be seen from the single optical slice (Fig. 1B), the reconstructed capillary, and the reconstructed capillary cross sections (Fig. 1C and inset 2), which show that cell-filled areas of the capillaries exhibit little luminal fluorescence. Both the single slice and the reconstructed capillary show that the capillary space not associated with pericytes or blood cells is cylindrical and of intermediate fluorescence (Fig. 1, B and C, and insets 1 and 3). The fluorescence intensity of this space is well above that of the medium. In some parts of the vessel, cellular fluorescence appears somewhat higher than luminal fluorescence.
Figure 2 shows the time course of 5 µM
daunomycin accumulation in rat brain capillary lumens. Luminal
fluorescence rose rapidly and reached a steady state value within 20 min. At that time, luminal fluorescence was 8 times higher than medium
fluorescence, suggesting uphill transport from bath to lumen. Addition
of the P-glycoprotein inhibitor PSC-833, to the medium at time 0 reduced steady-state luminal fluorescence by about 70% (Fig. 2); with PSC-833, luminal fluorescence was not significantly different from
medium fluorescence. Figure 3 shows
micrographs of some of the capillaries from the time course experiment.
Note that the PSC 833-treated capillaries exhibited reduced
fluorescence within the luminal space along their entire length. In
addition, pericyte fluorescence appears somewhat reduced. Initial
measurements of cellular fluorescence indicate at most a small
reduction by PSC-833 (mean cellular fluorescence intensities averaged
83 ± 8 and 67 ± 4 in control specimens and PSC-833-exposed
capillaries, P > .05).
|
|
Steady-state daunomycin accumulation in capillary lumens was also
significantly reduced by verapamil and CSA, both P-glycoprotein substrates, by NaCN, a metabolic inhibitor, and by vanadate, an inhibitor of p-type ATPases. LTC4, a Mrp
substrate that does not affect P-glycoprotein-mediated transport
(Kusuhara et al., 1998b
), was without effect (Fig.
4). Using brain capillaries from rat and
pig, a similar pattern of luminal accumulation and inhibition of that
accumulation by P-glycoprotein inhibitors and NaCN was also found for
two additional P-glycoprotein substrates: NBDL-CSA, a fluorescent CSA
derivative (rat only, Fig. 4), and BO-IVER, a fluorescent ivermectin
derivative (rat and pig, Fig. 5).
|
|
In initial experiments directed at determining whether isolated brain
capillaries could also transport organic anions, we found evidence for
specific luminal accumulation of three dyes, FL-MTX, FLUO-3, and
sulforhodamine 101. Because of its resistance to photobleaching and the
insensitivity of fluorescence to changes in pH, sulforhodamine 101, a
disulfonic acid, was chosen as primary test substrate. Figure
6 shows confocal images of a rat brain capillary incubated in medium containing 1 µM sulforhodamine 101. As
with the P-glycoprotein substrates, this organic anion accumulated in
the pericytes and the luminal space, but not within blood cells. The
fluorescence intensity of the luminal compartment was substantially higher than that of the medium.
|
Endothelial cells seemed to concentrate the compound within a punctate compartment, near the luminal membrane (Fig. 6). Consequently, the luminal spaces in capillaries loaded with sulforhodamine 101 are better defined than in capillaries loaded with daunomycin (compare Figs. 1 and 6). Experiments with renal cells in culture have shown that sulforhodamine 101 accumulates in mitochondria (D.S. Miller, unpublished data) and our preliminary experiments with rhodamine 123-loaded brain capillaries show a pattern of punctate, cellular fluorescence similar to that seen with sulforhodamine 101, suggesting mitochondrial accumulation.
When isolated brain capillaries from rat and pig were exposed to media
with 1 to 5 µM sulforhodamine 101, luminal fluorescence intensity
rose rapidly with time and, within 10 to 15 min, reached a steady-state
value 3 to 5 times that of the medium (not shown). Steady-state luminal
fluorescence in rat and pig brain capillaries was greatly reduced when
metabolism was inhibited by 1 mM NaCN (Fig.
7). Compounds that affect transport on
Mrps also reduced luminal accumulation of sulforhodamine 101. These
included 300 to 500 nM LTC4, 5 µM CSA, and 50 µM vanadate. In contrast to experiments with P-glycoprotein
substrates, verapamil, and PSC 833 (at 10 µM) were without
significant effect (Figs. 7 and 8). In
limited experiments with FL-MTX (Fig. 8) and FLUO-3 (data not shown)
similar inhibitory effects of NaCN and LTC4 were
found, suggesting that all three fluorescent organic anions shared a
common transport pathway.
|
|
We used two methods to detect expression of ATP-driven drug export
pumps in brain capillaries. First, capillaries from control and TR
rats (a strain that does not express Mrp2; Konig et al., 1999
) were
fixed, permeabilized, and incubated with nonfluorescent antibodies to
P-glycoprotein and to Mrp2 (antibody may also recognize Mrp3 and Mrp5).
Antibody-antigen association was detected with fluorescent secondary
antibodies. Figure 9 shows representative confocal images of immunostained capillaries. In capillaries from control rats, both antibodies labeled structures that line the capillary lumens, indicating localization to the luminal surface of the
endothelial cells. In addition, Fig. 9B shows that P-glycoprotein is
localized to punctate sites at or near the basal surface of the
endothelial cells. In capillaries from TR
rats, P-glycoprotein labeling was similar to that seen with controls (not shown); however, specific labeling of Mrp2 was absent (Fig. 9E).
|
Second, we used real time quantitative PCR (see under Materials and Methods) to detect and measure levels of Mrp1 and Mrp2 mRNA in gray cortex of rat brain and in isolated rat brain capillaries. Mrp1 and Mrp2 mRNA levels normalized to GADPH were 0.003 ± 0.005 and 0.149 ± 0.021, respectively, for gray cortex and 0.054 ± 0.004 and 0.378 ± 0.046, respectively, for isolated capillaries (data from three to four preparations). Clearly, expression of Mrp1 and Mrp2 could be detected in isolated capillaries and levels in that preparation were higher than in overall brain tissue.
One limitation in the use of HIV-1 protease inhibitors is their
inability to cross the blood-brain barrier and act at sites of
infection within the central nervous system. P-glycoprotein-mediated transport at the blood-brain barrier has been implicated in the near-exclusion of saquinavir and other HIV-1 protease inhibitors from
the central nervous system (Glynn and Yazdanian, 1998
; Kim et al.,
1998
; Drewe et al., 2000
) and recent experiments indicate that Mrp2
might also participate (Gutmann et al., 1999a
). To determine whether
the HIV protease inhibitors saquinavir and ritonavir interacted with
drug transporters in brain capillaries, we incubated isolated capillaries from pig in media without (control) or with saquinavir and
ritonavir. Figure 10 shows that these
HIV-1 protease inhibitors were potent inhibitors of the transport of
both BO-IVER and sulforhodamine 101 from bath to capillary lumen. With
BO-IVER as substrate, 0.1 µM ritonavir reduced luminal accumulation
by about 35% (Fig. 10A). With sulforhodamine 101 as substrate, both
ritonavir and saquinavir reduced luminal accumulation in a
concentration-dependent manner (Fig. 10B). Of the two drugs, ritonavir
was clearly the more potent inhibitor, causing significant reduction of
sulforhodamine 101 transport into the lumen at concentrations as low as
10 nM and 50% inhibition at 50 nM (Fig. 10B). Preliminary measurements
showed that ritonavir altered transport at the luminal membrane of the endothelium, because cellular fluorescence intensity did not decrease (mean values for 7-10 capillaries were: controls, 106 ± 6; 10 nM
ritonavir, 99 ± 12; 50 nM ritonavir, 105 ± 6; 500 nM
ritonavir, 100 ± 15).
|
| |
Discussion |
|---|
|
|
|---|
The present report introduces a new approach to studying excretory
(central nervous system to blood) transport in freshly isolated, intact
brain capillaries: the use of fluorescent substrates, confocal
microscopy and quantitative image analysis. The advantage of this
approach is one of spatial resolution. Using the optical sectioning
capabilities of confocal optics, substrate fluorescence in the
capillary lumen can be distinguished from that in the endothelium and
associated cells and the fluorescence intensities of the luminal compartment and the medium can be measured and compared. Micrographs of
these capillaries show them to be several hundred micrometers long with
an open luminal space (best seen in tubules incubated in medium with
sulforhodamine 101; Fig. 6). Although the ends of the segments appear
to be open to the medium and are thus potential sites of diffusional
leakage, we expect that this leakage is minimized by the long diffusion
distances involved and the fact that the luminal compartment is both
narrow and unstirred. Our experiments showing long-term exclusion of
fluorescent dextrans from the lumen support this supposition. At
present, a major limitation of the system is limited viability, a
problem that was noted previously (Sussman et al., 1988
). Nevertheless,
for a period of 2 to 4 h after isolation, the capillaries both
excluded fluorescent dextrans and supported xenobiotic transport from
bath to lumen that was concentrative, specific, and
metabolism-dependent (reduced by NaCN). Thus, both the barrier and
specific transport functions of the endothelium were at least partially
preserved. Experiments are currently under way to define conditions
that will optimize the metabolic viability of the capillaries.
Here we used isolated capillaries from rat and pig to investigate
directly the mechanisms by which selected fluorescent xenobiotics are
transported from bath to lumen. Fluorescent compounds were chosen based
on previous transport and immunolocalization studies, primarily in
isolated renal proximal tubules, that showed uphill cell to tubular
lumen transport mediated by either P-glycoprotein (daunomycin, NBDL-CSA
and BO-IVER) (Miller, 1995
; Schramm et al., 1995
; Fricker et al., 1999
)
or Mrp2 (sulforhodamine 101 and FL-MTX; Masereeuw et al., 1996
, 2000
)
and specific labeling of the luminal membranes of the tubular
epithelial cells with antibodies to mammalian P-glycoprotein and Mrp2
(Masereeuw et al., 2000
; D.S. Miller, unpublished data). Also,
Fl-MTX has been shown to be a potent inhibitor of Mrp2-mediated
transport in vesicles from insect cells expressing rabbit Mrp2 (Van
Aubel et al., 1998
). In the present study, luminal accumulation of all
fluorescent substrates was found to be rapid, metabolism-dependent, and
specific. Vanadate reduced the transport of both daunomycin and
sulforhodamine 101, suggesting the involvement of p-type ATPases. Note
that with all substrates, the reduction of luminal accumulation was not
total. Even with the most potent inhibitors of transport, 30 to 40%
remained. It is not clear at present whether this is a reflection of
the experimental protocol (i.e., transport of lipophilic substrates from an infinite bath), the reduced metabolic competence of the capillaries, or reduced temperature (18-20°C versus 37°C in vivo).
Luminal accumulation of daunomycin, NBDL-CSA, and BO-IVER was reduced
by several P-glycoprotein substrates and modifiers, including PSC 833, CSA, verapamil and ivermectin, but not LTC4, an
inhibitor of transport mediated by Mrps but not P-glycoprotein. These
data for transport of daunomycin, NBDL-CSA, and BO-IVER and their
inhibition by drugs known to interact with P-glycoprotein indicate that
this transporter participates in xenobiotic transport across the
capillary endothelium. Based on these results, the simplest transport
model would place P-glycoprotein on the luminal membrane of the
endothelial cells, in the correct location to use ATP to both pump
xenobiotics from cell to blood and prevent entry into the central
nervous system. The present immunostaining experiments support this
luminal placement. There has been some controversy regarding the
immunolocalization of P-glycoprotein in human brain capillaries. Work
from the Pardridge laboratory indicates localization of the transporter
to pericytes (Pardridge et al., 1997
; Golden and Pardridge, 1999
),
whereas other laboratories show localization to the endothelial cells
(Jette et al., 1993
; Seetharaman et al., 1998
). The present
results for rat and pig are consistent with the latter, but they also
suggest a secondary localization of P-glycoprotein to sites on the
basal surface of the capillary. At present, it is unclear whether these
sites are on the basal membrane of the endothelial cells or are
remnants of associated cells removed during capillary isolation.
In contrast to the P-glycoprotein substrates, luminal accumulation of
the fluorescent organic anions sulforhodamine 101 and FL-MTX was not
reduced by verapamil or PSC 833. At the 10 µM concentration used, one
would expect that these compounds would block transport mediated by
P-glycoprotein. Luminal accumulation of sulforhodamine 101 and FL-MTX
was reduced by low concentrations of LTC4 and
CDNB. This is similar to the transport and inhibition pattern for these substrates seen in teleost renal proximal tubule. In that tissue, based
on transport inhibitor studies and immunostaining with antibodies to
mammalian transporters, cell to lumen transport of FL-MTX was attributed to Mrp2 (Masereeuw et al., 1996
, 2000
), an Mrp isoform that
is known to be highly expressed in proximal tubule (Schaub et al.,
1997
). So far, however, six Mrp isoforms have been cloned. They exhibit
isoform-specific tissue expression patterns, but it is not clear from
the limited data available whether individual isoforms can be
distinguished based on substrate or inhibitor specificity patterns
(Konig et al., 1999
). The present transport data for brain capillaries
suggest the involvement of one or more of these Mrps in the luminal
accumulation of organic anions. However, two additional observations
are consistent with participation of Mrp2. First, immunostaining with
an antibody raised to Mrp2 (but that may also react with Mrp3-5)
showed exclusive localization at the luminal membrane of the
endothelial cells in capillaries from control rats, but no staining in
capillaries from TR
rats; the latter strain does not express Mrp2
(Konig et al., 1999
). Second, quantitative PCR detected Mrp1 and Mrp2
mRNA in rat brain cortex and isolated capillaries. Together, these
findings implicate Mrp2 (and possibly other Mrps) in the cell-to-lumen
transport of anionic xenobiotics in brain capillaries.
Finally, we have used the new experimental system to examine briefly in
pig brain capillaries the sensitivity of P-glycoprotein and Mrp to
inhibition by the HIV-1 protease inhibitors saquinavir and ritonavir.
Both drugs have been shown to be secreted in monolayers of CACO-2
cells, which express both P-glycoprotein and Mrp2 (Gutmann et al.,
1999b
). In these cells, saquinavir and ritonavir secretion was
partially blocked by P-glycoprotein inhibitors, but the effects of Mrp2
inhibitors were not tested. We recently examined the interactions of
these protease inhibitors with drug transporters in renal proximal tubule and found that they were potent inhibitors of transport mediated
by both P-glycoprotein and Mrp2 (Gutmann et al., 1999a
). The present
results show that ritonavir, at submicromolar concentrations, substantially reduced the transport of both BO-IVER and sulforhodamine 101. Saquinavir was used only in experiments in which sulforhodamine 101 transport was assayed; it also inhibited transport, but at much
higher concentrations than ritonavir. In two important respects, these
results agree with those obtained from renal proximal tubules: 1) the
protease inhibitors interacted with both P-glycoprotein and one or more
Mrps, and 2) ritonavir was by far the most potent inhibitor of the two,
being as effective as the best of the known P-glycoprotein and Mrp
inhibitors. These preliminary results suggest that transport by
P-glycoprotein and an Mrp underlies in part the poor penetration of the
blood-brain barrier by HIV protease inhibitors. As in the renal tubule
(Gutmann et al., 1999a
), the inhibitory potency of ritonavir suggests
uses for this drug outside of HIV therapy (e.g., in reversing drug
resistance caused by ABC transporters).
| |
Acknowledgments |
|---|
We thank Destiny Sykes for excellent technical assistance.
| |
Footnotes |
|---|
Received June 10, 1999; Accepted September 29, 2000
Supported by Grant CRG 960281 from the North Atlantic Treaty Organization and DFG FR1211.
Send reprint requests to: Dr. David S. Miller, LPC, NIH/NIEHS, P.O. Box 12233, Research Triangle Park, NC 27709. E-mail: miller{at}niehs.nih.gov
| |
Abbreviations |
|---|
ABC, ATP-binding cassette;
Mrp, multidrug-resistance protein;
CSA, cyclosporin A;
NBDL, N-
-(4-nitrobenzofurazan-7-yl)-D-Lys8;
FL-MTX, fluorescein methotrexate;
BO-IVER, bodipy-ivermectin;
PCR, polymerase chain reaction;
LTC4, leukotriene
C4;
GAPDH, glyceraldehyde-3-phosphate
dehydrogenase.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. Virgintino, D. Robertson, M. Errede, V. Benagiano, F. Girolamo, E. Maiorano, L. Roncali, and M. Bertossi Expression of P-Glycoprotein in Human Cerebral Cortex Microvessels J. Histochem. Cytochem., December 1, 2002; 50(12): 1671 - 1676. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Williams, A. Liu, G. Knipp, and P. J. Sinko Direct Evidence that Saquinavir Is Transported by Multidrug Resistance-Associated Protein (MRP1) and Canalicular Multispecific Organic Anion Transporter (MRP2) Antimicrob. Agents Chemother., November 1, 2002; 46(11): 3456 - 3462. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Witt, J. D. Huber, R. D. Egleton, and T. P. Davis Pluronic P85 Block Copolymer Enhances Opioid Peptide Analgesia J. Pharmacol. Exp. Ther., November 1, 2002; 303(2): 760 - 767. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yan and E. M. Taylor Neotrofin Is Transported Out of Brain by a Saturable Mechanism: Possible Involvement of Multidrug Resistance and Monocarboxylic Acid Transporters Drug Metab. Dispos., May 1, 2002; 30(5): 513 - 518. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Breen, D. B. Sykes, G. Fricker, and D. S. Miller Confocal imaging of organic anion transport in intact rat choroid plexus Am J Physiol Renal Physiol, May 1, 2002; 282(5): F877 - F885. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Loscher and H. Potschka Role of Multidrug Transporters in Pharmacoresistance to Antiepileptic Drugs J. Pharmacol. Exp. Ther., April 1, 2002; 301(1): 7 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Miller, C. Graeff, L. Droulle, S. Fricker, and G. Fricker Xenobiotic efflux pumps in isolated fish brain capillaries Am J Physiol Regulatory Integrative Comp Physiol, January 1, 2002; 282(1): R191 - R198. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lee, S. Dallas, M. Hong, and R. Bendayan Drug Transporters in the Central Nervous System: Brain Barriers and Brain Parenchyma Considerations Pharmacol. Rev., December 1, 2001; 53(4): 569 - 596. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Asawakarn, J. Cladera, and P. O'Shea Effects of the Membrane Dipole Potential on the Interaction of Saquinavir with Phospholipid Membranes and Plasma Membrane Receptors of Caco-2 Cells J. Biol. Chem., October 12, 2001; 276(42): 38457 - 38463. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Dussault, M. Lin, K. Hollister, E. H. Wang, T. W. Synold, and B. M. Forman Peptide Mimetic HIV Protease Inhibitors Are Ligands for the Orphan Receptor SXR J. Biol. Chem., August 31, 2001; 276(36): 33309 - 33312. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||