|
|
|
|
Vol. 58, Issue 6, 1441-1450, December 2000
Institut National de la Santé et de la Recherche Médicale U128-IFR24, Centre National de la Recherche Scientifique, Montpellier, France (J.-M.P., S.G.-C., P.M., M.-J.V.) and Service de Chirurgie, Hopital Saint Eloi, Montpellier, France (J.-M.F.)
| |
Abstract |
|---|
|
|
|---|
The barbiturate phenobarbital induces the transcription of cytochromes P450 (CYPs) 2B through the constitutive androstane receptor (CAR; NR1I3). CAR is a member of the nuclear receptor family (NR1) mostly expressed in the liver, which heterodimerizes with retinoid X receptor (RXR) and was shown to transactivate both the phenobarbital responsive element module of the human CYP2B6 gene and the CYP3A4 xenobiotic response element. Because previous studies in rodent hepatocyte cultures have shown that the phenobarbital-mediated induction of CYP2B genes is potentiated by glucocorticoids, we examined the role of activated glucocorticoid receptor in this process. We show that submicromolar concentrations of dexamethasone enhance phenobarbital-mediated induction of CYP3A4, CYP2B6, and CYP2C8 mRNA in cultured human hepatocytes. In parallel, we observed that glucocorticoid agonists, such as dexamethasone, prednisolone, or hydrocortisone, specifically increase human car (hCAR) mRNA expression. Accumulation of hCAR mRNA parallels that of tyrosine aminotransferase: both mRNAs reach a maximum at a concentration of 100 nM dexamethasone and are down-regulated by concomitant treatment with the glucocorticoid antagonist RU486. Moreover, the effect of dexamethasone on hCAR mRNA accumulation appears to be of transcriptional origin because the addition of protein synthesis inhibitor cycloheximide has no effect, and dexamethasone does not affect the degradation of hCAR mRNA. Furthermore, dexamethasone increases both basal and phenobarbital-mediated nuclear translocation of CAR immunoreactive protein in human hepatocytes. The up-regulation of CAR mRNA and protein in response to dexamethasone explains the synergistic effect of this glucocorticoid on phenobarbital-mediated induction of CYP2B genes and the controversial role of the glucocorticoid receptor on phenobarbital-mediated CYP gene inductions.
| |
Introduction |
|---|
|
|
|---|
Induction
of drug- and carcinogen-metabolizing cytochrome P450s (CYP) by
xenobiotic chemicals is a common cellular defense mechanism, usually
leading to increased detoxification of xenobiotics but sometimes,
paradoxically, to formation of more toxic and carcinogenic metabolites
(Conney, 1982
). The expression of the genes encoding these enzymes is
known to be regulated by a number of factors, including physiological,
pathological, genetic, and environmental factors. Xenobiotics
themselves play an important role as CYP inducers (Savas et al., 1999
;
Waxman, 1999
). Phenobarbital is a prototypic representative for
chemicals, including industrial solvents, pesticides, plant products,
and clinically used drugs that induce several genes within CYP
subfamilies 2B, 2A, 2C, and 3A in rodents and humans (Waxman and
Azaroff, 1992
). Recently, two "orphan" nuclear receptors designated
pregnane X receptor (PXR; NR1I2) and constitutive androstane receptor
or constitutively activated receptor (CAR; NR1I3) have been implicated
in the phenobarbital-mediated induction of hepatic CYP3A and CYP2B
genes, respectively (Honkakoski et al., 1998
; Kliewer et al., 1998
;
Lehmann et al., 1998
).
PXR, also termed steroid and xenobiotics receptor and
pregnane-activated receptor, has been proposed to mediate the induction of expression of CYP3A genes by a number of different steroids, steroid
antagonists, and xenobiotics such as rifampicin, clotrimazole, and
phenobarbital. This is based on both the activation of PXR by such
compounds and the identification of PXR response elements in CYP3A
promoters (Bertilsson et al., 1998
; Blumberg et al., 1998
; Kliewer et
al., 1998
; Lehmann et al., 1998
; Goodwin et al., 1999
; Pascussi et
al., 1999
).
CAR is most abundantly expressed in the liver and has a strong
constitutive activity in cell-based reporter assays in the absence of
any added ligand (Baes et al., 1994
; Choi et al., 1997
). In HepG2 cells
or other cell lines, transfected CAR enters the nucleus and regulates
the expression of target genes. This constitutive activity can be
inhibited by superphysiological concentrations of the testosterone
metabolites androstanol and androstenol (Forman et al., 1998
). These
androstanes inhibit the interaction of CAR with the steroid receptor
coactivator 1 (SRC-1), suggesting that "deactivation" is mediated
by direct binding to the orphan receptor. In contrast to transfected
cell lines, CAR is not present in the nucleus of primary hepatocytes
but instead is sequestered in the cytoplasm. Treatment of primary mouse
hepatocytes with either phenobarbital or the planar hydrocarbon TCPOBOP
results in the translocation of mCAR into the nucleus, where it
binds to its cognate DNA response elements as a heterodimer with RXR
and eventually activates the transcription of target genes, including
CYP2B (Honkakoski and Negishi, 1998b
; Honkakoski et al., 1998
; Kawamoto
et al., 1999
; Sueyoshi et al., 1999
). CAR/RXR binding sites have been identified in the phenobarbital-responsive regions of the mouse, rat,
and human CYP2B genes (Honkakoski and Negishi, 1998b
; Honkakoski et
al., 1998
; Kawamoto et al., 1999
; Sueyoshi et al., 1999
) and in the
distal xenobiotic response element of CYP3A4 (Moore et al., 2000
). The
effects of phenobarbital on CYP2B expression are blocked by the
phosphatase inhibitor okadaic acid (Honkakoski and Negishi, 1998a
;
Kawamoto et al., 1999
), suggesting that dephosphorylation of CAR,
rather than direct ligand binding, is involved in its translocation
into the nucleus.
CAR and PXR belong to the same nuclear receptor gene family (family
NR1), share a common heterodimerization partner, retinoid X receptor
(RXR), and may be subject to cross-talk interactions with other nuclear
receptors and with a broad range of other intracellular signaling
pathways, including those activated by certain hormones. Notably, it
has long been known that dexamethasone, or glucocorticoids, are
required for both efficient phenobarbital responsiveness of CYP2B10 in
mice and CYP2B2 in rats (Shaw et al., 1993
) and CYP3A23 induction in
response to PXR activators in cultured rat hepatocytes (Burger et al.,
1992
; Quattrochi et al., 1995
). Indeed, we recently reported the
importance of culturing primary human hepatocytes with submicromolar
concentrations of dexamethasone to efficiently maintain both hPXR and
hRXR
expression and in vivo-like responsiveness of hPXR activators
on CYP3A4 induction in vitro (Pascussi et al., 2000
).
In this work, we investigated the role of glucocorticoids and glucocorticoid receptor on both the phenobarbital-mediated CYP induction and on the expression of hCAR in primary cultures of human hepatocytes. We report that CYP2B6, CYP2C8, and CYP3A4 mRNA inductions in response to phenobarbital are markedly enhanced by submicromolar concentrations of dexamethasone and that this effect is accompanied by an increased expression of human CAR gene at both the mRNA and nuclear protein levels.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials
Ham's F-12 and William's E culture media, vitamins and
hormones, collagenase (type IV), dimethyl sulfoxide (DMSO), actinomycin D, cycloheximide, and dexamethasone were purchased from Sigma (St.
Quentin Fallavier, France). Phenobarbital was purchased from Specia
(Paris, France). Collagen-coated culture dishes were obtained from
Corning (Iwaki, Japan).
-[32P]dCTP,
-[32P]UTP, and enhanced chemiluminescence
(ECL) developing reagent were purchased from Amersham-Pharmacia
(Buckinghamshire, England).
Tissue Source and Hepatocyte Cultures
Hepatocytes were prepared from lobectomy segments resected from
adult patients for medically required purposes unrelated to our
research program (Table 1). The use of
these human hepatic specimens for scientific purposes has been approved
by the French National Ethics Committee. Hepatocytes were prepared and
cultured according to the previously published procedure (Pichard et
al., 1995
). The cells were plated into 100-mm plastic dishes precoated with collagen at 10 × 106 cells per plate
in a total volume of 6 ml of a hormonally and chemically defined medium
consisting of a mixture of Williams' E and Ham's F-12 (1:1 in
volume). Forty-eight hours after plating, dexamethasone was withdrawn
from the culture medium for 16 h. Cells were then cultured in the
presence or absence of the indicated inducers for 6 to 48 h. Total
RNA and protein were isolated, using Trizol reagent (Life Technologies,
Cergy-Pontoise, France), from 107 cultured
hepatocytes according to the manufacturer's instructions. For quality
control, 30 µg of total RNA were analyzed by Northern blot using a
rat glyceraldehyde phosphate dehydrogenase cDNA probe (J. M. Blanchard, Institut de Genetique Moleculaire de Montpellier, Montpellier, France).
|
Preparation of Probe Plasmids
Plasmids for CYP3A4 (Pichard et al., 1995
), hPXR and hGR
(Pascussi et al., 2000
) RNase protection assays were previously described.
pBS-IIK-CYP2B6. A 263-bp fragment of the CYP2B6 (nucleotides 25-288) was amplified by PCR with oligonucleotides sense 5'-AGCCTCCCACCAGGGCCCCGCCC and reverse 5'TGGCAAAGATCACACCATATCCCC, digested by PstI and SalI, and cloned in PstI/SalI-digested pBluescript II-KS+ vector (Stratagene, La Jolla, CA). The ribonuclease protection assay probe was synthesized with T3 RNA polymerase after linearization of plasmid with SmaI. The native CYP2B6 probe contains 192 bp, and the digested probe is 180 bp long.
pGEMT-2C8. A 311-bp fragment (nucleotides 982-1293) was amplified by PCR with oligonucleotides sense 5'-GATCATGTAATTGGCAGACACA and reverse 5'-CCTGCTGAGAAAGGCATGAAG and cloned in pGEMT vector (Promega, Charbonnières, France). The ribonuclease protection assay probe was synthesized with SP6 RNA polymerase after linearization of plasmid with ApaI. The native probe contains 365 bp, and the digested probe is 239 bp long.
pcDNA3-5'DBDhCAR.
After PCR amplification, cDNA encoding
amino acids +1/341 hCAR from CDM8-hCAR (Baes et al., 1994
), using
oligonucleotides 5'-CGGAATTCATGGCCAGTAGGGAAG (sense) and
5'-AAAAAAGCGGCCGCCTCAGCTGCAGATCTCCTGG (antisense), were digested by
EcoRI and NcoI and inserted in
EcoRI/NcoI sites of pcDNA3.0 (Invitrogen BV,
Groningen, The Netherlands). After deletion of the ApaI
fragment and religation of the truncated pcDNA-hCAR, the
pcDNA3-
ApaIhCAR containing only the NT-DBD region (+1/355
nucleotides) of hCAR was linearized using BamHI, and the antisense 5'hCAR probe was synthesized using SP6 polymerase. The native
probe was 372 nucleotides long, and the protected band was 355 nucleotides long.
pGEMT-3'LBDhCAR. The 0.284-kb PstI fragment of pcDNA3-hCAR, corresponding to the hCAR (+754/1038 nucleotides) LBD-CT, was cloned in the PstI site of pGEMT. To prepare the 3'hCAR RNase protection probe, the pGEMT-3'hCAR plasmid was digested with XhoI, and the antisense probe was synthesized using T7 polymerase. The native probe was 314 nucleotides, and the protected probe was 284 nucleotides.
Ribonuclease Protection Assays and Northern Blot
Total RNA (30 µg) was analyzed by the RNase protection assay
using specific probes as previously described (Greuet et al., 1997
).
Total RNA was hybridized with radiolabeled antisense RNA probe
(100,000-150,000 cpm) overnight at 37°C after incubation for 10 min
at 95°C. For Northern blot experiments, 30 µg of total RNA were
analyzed using
-[32P]dCTP-labeled mouse
tyrosine aminotransferase (TAT) (T. Grange, Institut J. Monod, Paris,
France) cDNA probe, autoradiography was carried out by exposing the
dried gel to X-AR film (Kodak, Rochester, NY), and the signals were
quantified by analyzing the radioactivity with PhosphorImager and
ImageQuant software (both from Molecular Dynamics, Sunnyvale, CA).
Extraction of Nuclear Proteins
Nuclear extracts were prepared as previously reported (Pascussi
et al., 2000
). Hepatocytes (107) were washed,
harvested in ice-cold PBS and pelleted by centrifugation at
1500g for 5 min. The pellet was resuspended in 400 µl of
cold buffer A (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride), and
cells were allowed to swell on ice for 15 min, after which 25 µl of
10% Nonidet P-40 were added and the tube was vortexed for 30 s.
After centrifugation, the nuclear pellet was resuspended in 75 µl of
ice-cold buffer C (20 mM HEPES, pH 7.9, 0.2 M NaCl, 1 mM EDTA, 1 mM
EGTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride), and
the tube was vigorously rocked at 4°C for 30 min. Finally, the
nuclear extract was centrifuged for 5 min, and the supernatant was
frozen at
80°C.
Immunoblot Analysis
Thirty micrograms of nuclear extracts from
107 hepatocytes were separated by
SDS-polyacrylamide gel electrophoresis (10%) and then electroblotted
onto Imobilon P (Millipore, Bedford, MA). Membranes were incubated with
specific antibodies against hCAR (M. Negishi, National Institute on
Environmental Health Sciences, Triangle Park, NC), RXR
(TEBU, Le
Perray en Yvelines, France), or p130 retinoblastoma protein (TEBU) and
developed with the enhanced chemiluminescence detection system
(Amersham-Pharmacia).
| |
Results |
|---|
|
|
|---|
Effect of Dexamethasone on Phenobarbital-Mediated CYP2B6, CYP2C8,
and CYP3A4 mRNA Induction in Cultured Human Hepatocytes.
Induction
of CYP mRNA by phenobarbital has been shown to be enhanced by nanomolar
concentrations of dexamethasone in primary cultures of animal
hepatocytes (Waxman and Azaroff, 1992
; Sidhu and Omiecinski, 1995b
;
Honkakoski and Negishi, 1998a
). The ability of CYP genes to respond to
low concentrations of glucocorticoids in synergy with phenobarbital
indicates the possibility for a glucocorticoid receptor-dependent
mechanism. Therefore, we have decided to study the effect of
dexamethasone on phenobarbital-mediated CYP induction in primary
cultures of human hepatocytes. Hepatocytes cultured in a
dexamethasone-free medium for 16 h were exposed for 48 h to
50 µM phenobarbital either in the absence or presence of increasing
concentrations of dexamethasone (1 nM to 1 µM). Then, the levels of
CYP2B6, CYP2C8, and CYP3A4 mRNA were measured by RNase protection
assays. As shown in Fig. 1, phenobarbital alone only slightly induced CYP3A4 and CYP2C8 mRNAs (1.6-fold induction), while it failed to induce CYP2B6 mRNA accumulation. Dexamethasone alone at submicromolar concentrations produced a dose-dependent increase in both CYP2C8 and CYP3A4 mRNA accumulation but
did not affect CYP2B6 mRNA expression. However, concomitant addition of
dexamethasone and phenobarbital produced a strong increase in the
expression of CYP2B6, CYP2C8, and CYP3A4 mRNAs in a
concentration-dependent manner. This enhancement reached a maximum at
100 nM dexamethasone, a concentration that fully activates the
glucocorticoid receptor without activating the hPXR (Bertilsson et al.,
1998
; Lehmann et al., 1998
). However, and notably for CYP2B6, we
exclude a strict effect of cis-cooperation between the
glucocorticoid receptor and the phenobarbital signaling pathway because
this cytochrome appeared to be dexamethasone insensitive. We postulate
that dexamethasone can up-regulate the expression of factor(s)
necessary for the phenobarbital response. In this respect, we recently
reported that dexamethasone (ligand)-activated glucocorticoid receptor
increases both hPXR and hRXR
mRNA expression and enhances PXR
activator-mediated induction of CYP3A4 in human hepatocytes (Pascussi
et al., 2000
). Because phenobarbital activates PXR in transient
transfection assays (Lehmann et al., 1998
; Moore et al., 2000
), the
potentiation observed between dexamethasone and phenobarbital on CYP3A4
mRNA accumulation could be explained by the increase of the PXR:RXR
heterodimer level in the nucleus upon dexamethasone treatment. However,
no data are available on the role of PXR on CYP2C8 gene regulation, and
CYP2B6 is believed to be regulated by another nuclear receptor
activated by phenobarbital, i.e., CAR (Sueyoshi et al., 1999
). We then
focused our attention on the effect of dexamethasone on hCAR
expression.
|
Effect of Glucocorticoids on CAR mRNA Expression in Primary Culture
of Human Hepatocytes.
We investigated the effect of
glucocorticoids on CAR mRNA expression. For this purpose, we first
designed a ribonuclease probe directed against the 3'LBD
(ligand-binding domain) of CAR, because this region represents the most
divergent domain between nuclear receptors. Using this probe in an
RNase protection assay on total RNAs from liver tissues (Fig.
2A), we observed two protected bands, one
corresponding to the expected size (LBD-FL) and a smaller unidentified
band (LBD-Tr, truncated domain). This smaller band was not present in
human hepatoma cell line (HuH7) stably transfected with hCAR,
suggesting that this protected band may represent the human homolog of
the LBD spliced mouse CAR mRNA species, mCAR2 (Choi et al., 1997
) (Fig.
2A, bottom). Effectively, using the same RNAs and a probe directed
against the 5'DBD (DNA-binding domain) of CAR, only one protected band
was observed (Fig. 2B). Note that, because the native probe contains a
portion of the multiple cloning site of the pcDNA3.0, the protected
band observed in HuH7 stably transfected with the pcDNA3.0-hCAR
appeared longer than the one observed in hepatocytes (Fig. 2B, bottom).
|
-carbonitrile, nor phenobarbital affected CAR mRNA expression at micromolar concentrations, irrespective of the presence of 100 nM dexamethasone (Fig. 3 and data not shown). CAR mRNAs were induced by 3.8- to 8-fold in response to 100 nM dexamethasone, depending on the culture (mean = 6.3, P < .05, n = 6).
|
|
Glucocorticoid Receptor Controls CAR Gene Transcriptional
Activation in Human Hepatocytes.
Glucocorticoids are able to
induce both primary and secondary responses in target tissues. A
primary response is characterized by a direct association of the
hormone-receptor complex with a specific DNA sequence in the target
gene, resulting in modification of transcription. The effect is
independent of protein synthesis, as previously reported in particular
for the TAT gene (Cole et al., 1995
). Conversely, a secondary response
requires protein synthesis for transcription of the induced RNA and a
time lag between administration of the hormone and initiation of the
response (Nebes and Morris, 1987
; Fan et al., 1992
). The nature of the response of the hCAR gene to dexamethasone in cultured human
hepatocytes was further investigated by analyzing: i) the concentration
and time dependence of CAR mRNA induction in comparison to the TAT gene, ii) the effect of cycloheximide, an inhibitor of protein synthesis, and iii) the effect of a glucocorticoid antagonist, RU486.
|
|
Dexamethasone Increases Both Basal Level and Phenobarbital-Mediated
Nuclear Translocation of CAR Protein in Human Hepatocytes.
Next,
we examined the effects of dexamethasone on CAR protein steady-state
levels in nuclear extracts from cultured human hepatocytes. For this
purpose, human hepatocytes cultured in a dexamethasone-free medium for
16 h were exposed for 48 h to 100 nM dexamethasone or vehicle
alone. Cells were then treated or not with 100 µM phenobarbital for 8 or 16 h and nuclear extracts were prepared. The immunoblot
analysis presented in Fig. 7A shows that
hCAR protein was present in hepatocyte nuclear extracts as a 38-kDa
band, identical to that observed in nuclear extracts from
hCAR-transfected COS cells but migrating slightly ahead of the mouse
protein expressed in COS cells. The hCAR protein level was increased in
the nuclear extracts of cultured hepatocytes exposed to 100 nM
dexamethasone. Interestingly, phenobarbital treatment produced a marked
and time-dependent accumulation of hCAR protein only in the nucleus of
dexamethasone-pretreated hepatocytes. Because phenobarbital failed to
induce hCAR mRNA induction, even in presence of dexamethasone (Fig.
7B), this accumulation may represent the effects of dexamethasone and
phenobarbital on hCAR subcellular localization, i.e., nuclear
translocation. We previously reported that RXR
protein was
significantly expressed in nuclear extracts from cultured hepatocytes
and induced by dexamethasone (Pascussi et al., 2000
). In contrast, the
level of p130, a member of the pocket protein family (retinoblastoma),
was not affected by dexamethasone and/or phenobarbital treatments.
Thus, these results show that phenobarbital-mediated nuclear
translocation of the CAR protein is significant only in hepatocytes
exposed to submicromolar concentrations of glucocorticoids. The finding that the nuclear translocation of CAR in dexamethasone-treated cells is
not accompanied by an increased expression of CYP2B6 (see Fig. 1)
indicates that nuclear translocation of CAR per se is not sufficient
for CYP2B6 induction, suggesting that a further step of activation of
this receptor in the nucleus is necessary for full activity (M. Negishi, personal communication).
|
Expression of CAR mRNA in Human Liver Tissue Compared with Cultured
Hepatocytes.
To evaluate the relevance of the present observations
to the in vivo situation, we compared the levels of CAR mRNA in our cultures with those measured in the corresponding tissue and in freshly
isolated hepatocytes. For this purpose, hepatocytes were plated and
cultured in the presence of 100 nM dexamethasone for 2 days. The
culture was then continued, either in the absence or presence of
dexamethasone for 2 more days (between days 3 and 4 after plating).
Total RNA was extracted from the liver tissue (before collagenase
perfusion), from freshly isolated hepatocytes (before plating), and
from cultured hepatocytes (at days 1, 2, 3 and 4 after plating) and
analyzed by RNase protection. The results are reported in Fig.
8 for patient and culture FT167. CAR
mRNAs were expressed significantly in the tissue, and their levels
exhibited no major change when measured in freshly isolated
hepatocytes. In the standard culture conditions (i.e., in the presence
of 100 nM dexamethasone), CAR mRNA exhibited a transient decrease at days 1 and 2 after plating but returned to a level close to that observed in the tissue at day 3, and this level was maintained up to
day 4. The transient decrease observed at days 1 and 2 is believed to
result from the stress due to cell isolation and plating, because this
is routinely observed with other phenotype markers such as
1-antitrypsin production, for example (J. B. Ferrini, personal
communication), RXR
, or PXR (Pascussi et al., 2000
). As expected,
when cells were cultured in the absence of dexamethasone (between days
2 and 4), the levels of CAR mRNA exhibited a dramatic decrease.
|
| |
Discussion |
|---|
|
|
|---|
We have previously reported that the classical glucocorticoid
pathway is involved in rifampicin-mediated CYP3A4 inducibility through
the regulation of the expression of two nuclear receptors (PXR and
RXR
) (Pascussi et al., 2000
). In the present work we have
investigated the mechanism by which dexamethasone potentiates the
phenobarbital-mediated induction of CYP2B6, CYP2C8, and CYP3A4 mRNAs in
primary culture of human hepatocytes. Our results show that this
potentiation is accompanied by a concomitant increase of hCAR mRNA
levels and of nuclear translocation of the protein. Although run-on
experiments have not been performed in this study, the data suggest
that this control occurs at the transcriptional level because i)
dexamethasone does not affect the degradation of CAR mRNA, ii) this
induction is partially blocked by the glucocorticoid antagonist RU-486,
and iii) cycloheximide does not affect the accumulation of CAR mRNA in
dexamethasone-treated hepatocytes. Because the expression of CAR mRNA
in response to dexamethasone parallels that of TAT mRNA, in terms of
time course and concentration dependence, it is suggested that
dexamethasone (ligand)-activated glucocorticoid receptor positively
regulates hCAR gene expression. Our finding that dexamethasone
positively controls CAR mRNA and protein translocation into the nucleus
clearly accounts for the synergistic effect of this glucocorticoid on
the phenobarbital-mediated induction of CYP2B genes.
Several authors have reported the inhibition of phenobarbital-mediated
transcriptional activation of the rat CYP2B by the antiglucocorticoid
RU486 in cultured hepatocytes (Wright et al., 1996
; Pereira et al.,
1998
). In addition, others have previously reported that submicromolar
concentrations of dexamethasone enhanced CYP gene induction in response
to phenobarbital, in cultured mice or rat hepatocytes (Waxman and
Azaroff, 1992
; Sidhu and Omiecinski, 1995b
; Honkakoski and Negishi,
1998a
). Taken together, these data indicate that the potentiation
observed between submicromolar concentrations of dexamethasone and
phenobarbital is not restricted to human hepatocytes. Effectively in
contrast to species specificity for dexamethasone-mediated PXR
activation (Kliewer et al., 1998
; Lehmann et al., 1998
), GR
activation is well conserved among these species. Moreover, PXR is not
involved in this process because i) the dexamethasone-mediated CAR
expression is observable with nanomolar concentrations [which are not
expected to activate either human or rodent PXR (Kliewer et al., 1998
;
Lehmann et al., 1998
)], ii) these effects are inhibited by the
antiglucocorticoid RU486 [which is also a potent PXR activator
(Lehmann et al., 1998
)], and iii) CAR expression is not affected by
micromolar concentration of rifampicin (Fig. 3).
In addition, using knock-out mice, Schuetz et al. (2000)
reported that
the glucocorticoid receptor is essential for dexamethasone CYP2B
expression. Because the presence of glucocorticoid responsive elements
(GREs) in the regulatory region of CYP2B genes, the possible implication of GR acting as a direct transactivation factor in this
process has been addressed by some authors. For instance, it has been
reported that mouse and rat CYP2B genes contain several GREs, some of
which can be functionally activated by glucocorticoids (Jaiswal et al.,
1990
). Moreover, the mouse cyp2b10 and the rat CYP2B1/2 genes exhibit a
xenochemical response element module (Park et al., 1996
; Liu et al.,
1998
; Stoltz et al., 1998
), which contains nuclear hormone response
elements, including DR4 and a potential GRE (Stoltz et al., 1998
).
Mutation experiments on this GRE in rat CYP2B2 suggested that a protein
binding to/or close to this region might be required for phenobarbital
induction. However, it has been reported that CYP2B1/2 genes are not
induced by treatment with submicromolar concentrations of dexamethasone alone, either in vitro or in vivo (Sidhu and Omiecinski, 1995a
,b
). In
addition, the presence of a functional GRE has not been reported in
human CYP2B6, and in fact, we observed that, in human hepatocyte cultures, dexamethasone alone is not an inducer of this gene. Therefore, a direct action of GR on CYP gene transactivation does not
explain the synergistic effect of dexamethasone and phenobarbital on
the CYP2B6 gene expression.
Alternatively, the potentiation by dexamethasone of
phenobarbital-mediated induction of CYP2B genes has been suspected to result from a modification of the hepatocyte phenotype in response to
the glucocorticoid, leading to increased CYP gene expression. Effectively, dexamethasone and related glucocorticoids are known to
exert effects on the maintenance of hepatocytes in a differentiated phenotype (Williams et al., 1978
). The results reported here strongly support this alternative hypothesis, and our data provide additional arguments in favor of a critical role of glucocorticoids in the maintenance of a differentiated phenotype in cultured hepatocytes. As
other transcription factors involved in both the specific expression [as C/EBP (MacDougald et al., 1995
)] or xenobiotic-mediated induction [as PPAR (Lemberger et al., 1994
), PXR, and RXR (Yamaguchi et al.,
1999
; Pascussi et al., 2000
)] of differentiated hepatic enzymes (as
cytochromes), CAR seems to be directly controlled by the glucocorticoid receptor.
We have shown here that three gene subfamilies, including CYP2B6,
CYP2C8-9, and CYP3A4, are coinduced by phenobarbital in primary human
hepatocytes. Although CAR and PXR have been primarily implicated as
regulators of CYP2B and CYP3A gene expression, it is currently unknown
whether CYP2C8 gene expression is controlled by one or both of these
receptors. Nevertheless, the finding that CYP2C8 strongly responds to
phenobarbital and rifampicin in our cultures suggests that this could
be the case. Interestingly, there is significant experimental evidence
for a cross-talk between these two nuclear signaling pathways. First,
the CYP2B and CYP3A genes are coinduced in rodent and human hepatocytes
by several xenobiotics, including phenobarbital, rifampicin, and
clotrimazole (Kocarek et al., 1993
; Strom et al., 1996
). Second, CAR is
able to transactivate CYP3A4 xenobiotic response element (ER6), which serves as a PXR/RXR binding site (Sueyoshi et al., 1999
; Moore et al.,
2000
). Third, it has been reported recently that both PXR and CAR
transactivate a CYP3A4 reporter construct containing a distal
xenobiotic response element (
7836 to
7208) fused to the proximal
promoter of CYP3A4 (
362 to +53). Finally, CAR and PXR share
xenobiotic and steroid ligands in vitro (Moore et al., 2000
). In
addition, we have shown recently that dexamethasone up-regulates the
PXR/RXR heterodimer (Pascussi et al., 2000
). Therefore, whether the
potentiation by dexamethasone observed on CYP2B6, CYP2C8/9, and CYP3A4
phenobarbital-mediated induction in human primary hepatocytes results
from the up-regulation of CAR, PXR, or both is currently unknown.
However, CAR may represent the major phenobarbital transductional
pathway, because S. Kliewer (13th International Symposium on Microsomes
and Drug Oxidations, July, 2000, Strese, Italy) recently reported that
phenobarbital was still a CYP3A inducer, in contrast to dexamethasone
or PCN, in PXR null mice.
Finally, our finding that GR might control the expression of nuclear receptor transcription factors, i.e., PXR, RXR, and CAR, involved in the regulation of CYP gene expression perhaps reveals the existence of a regulatory network that governs endocrine hormone homeostasis. Indeed, PXR and CAR regulate CYPs, which are involved in the oxidative metabolism of natural steroid hormones, including glucocorticoids.
| |
Acknowledgments |
|---|
We are grateful to Dr. S. Kliewer (GlaxoWellcome, Research Triangle Park, NC) and Dr. M. Negishi (National Institute on Environmental Health Sciences, Research Triangle Park, NC) for providing expression vectors for h- and mPXR, and hCAR and CAR polyclonal antibody, respectively.
| |
Footnotes |
|---|
Received June 29, 2000; Accepted August 31, 2000
1 These two authors have equally contributed to this work.
This work was supported by grants from the Institut National de la Santé et de la Recherche Médicale, the Ligue Nationale contre le Cancer (J.M.P.), and Laboratoires Fournier (S.G.-C.).
Send reprint requests to: Dr. Marie-Jose Vilarem, INSERM U128-IFR24, Centre National de la Recherche Scientifique, 1919 Route de Mende, 34293 Montpellier Cedex 05, France.
| |
Abbreviations |
|---|
CYP, cytochrome P450s; PXR, pregnane X receptor; CAR, constitutive androstane receptor or constitutively activated receptor; hCAR, human CAR; mCAR, mouse CAR; DMSO, dimethyl sulfoxide; PCR, polymerase chain reaction; LBD, ligand-binding domain; DBD, DNA-binding domain; TAT, tyrosine aminotransferase; GR, glucocorticoid receptor; GRE, glucocorticoid responsive element; bp, base pairs.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Jia, G. L. Guo, S. Surapureddi, J. Sarkar, C. Qi, D. Guo, J. Xia, P. Kashireddi, S. Yu, Y.-W. Cho, et al. Transcription coactivator peroxisome proliferator-activated receptor-binding protein/mediator 1 deficiency abrogates acetaminophen hepatotoxicity PNAS, August 30, 2005; 102(35): 12531 - 12536. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Rencurel, A. Stenhouse, S. A. Hawley, T. Friedberg, D. G. Hardie, C. Sutherland, and C. R. Wolf AMP-activated Protein Kinase Mediates Phenobarbital Induction of CYP2B Gene Expression in Hepatocytes and a Newly Derived Human Hepatoma Cell Line J. Biol. Chem., February 11, 2005; 280(6): 4367 - 4373. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, S. Faucette, R. Moore, T. Sueyoshi, M. Negishi, and E. LeCluyse Human Constitutive Androstane Receptor Mediates Induction of CYP2B6 Gene Expression by Phenytoin J. Biol. Chem., July 9, 2004; 279(28): 29295 - 29301. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-S. Yuan, G. Wei, L. Dey, T. Karrison, L. Nahlik, S. Maleckar, K. Kasza, M. Ang-Lee, and J. Moss Brief Communication: American Ginseng Reduces Warfarin's Effect in Healthy Patients: A Randomized, Controlled Trial Ann Intern Med, July 6, 2004; 141(1): 23 - 27. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, S. Faucette, T. Sueyoshi, R. Moore, S. Ferguson, M. Negishi, and E. L. LeCluyse A Novel Distal Enhancer Module Regulated by Pregnane X Receptor/Constitutive Androstane Receptor Is Essential for the Maximal Induction of CYP2B6 Gene Expression J. Biol. Chem., April 11, 2003; 278(16): 14146 - 14152. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. H. Chang, S. M. Bandiera, and J. Chen Constitutive Androstane Receptor and Pregnane X Receptor Gene Expression in Human Liver: Interindividual Variability and Correlation with CYP2B6 mRNA Levels Drug Metab. Dispos., January 1, 2003; 31(1): 7 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Pascussi, M. Busson-Le Coniat, P. Maurel, and M.-J. Vilarem Transcriptional Analysis of the Orphan Nuclear Receptor Constitutive Androstane Receptor (NR1I3) Gene Promoter: Identification of a Distal Glucocorticoid Response Element Mol. Endocrinol., January 1, 2003; 17(1): 42 - 55. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Kocarek, M. S. Dahn, H. Cai, S. C. Strom, and N. A. Mercer-Haines Regulation of CYP2B6 and CYP3A Expression by Hydroxymethylglutaryl Coenzyme A Inhibitors in Primary Cultured Human Hepatocytes Drug Metab. Dispos., December 1, 2002; 30(12): 1400 - 1405. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. THUM and J. BORLAK Testosterone, cytochrome P450, and cardiac hypertrophy FASEB J, October 1, 2002; 16(12): 1537 - 1549. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. El-Sankary, V. Bombail, G. G. Gibson, and N. Plant Glucocorticoid-Mediated Induction of CYP3A4 is Decreased by Disruption of a Protein: DNA Interaction Distinct from the Pregnane X Receptor Response Element Drug Metab. Dispos., September 1, 2002; 30(9): 1029 - 1034. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Maglich, C. M. Stoltz, B. Goodwin, D. Hawkins-Brown, J. T. Moore, and S. A. Kliewer Nuclear Pregnane X Receptor and Constitutive Androstane Receptor Regulate Overlapping but Distinct Sets of Genes Involved in Xenobiotic Detoxification Mol. Pharmacol., September 1, 2002; 62(3): 638 - 646. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Raucy, L. Mueller, K. Duan, S. W. Allen, S. Strom, and J. M. Lasker Expression and Induction of CYP2C P450 Enzymes in Primary Cultures of Human Hepatocytes J. Pharmacol. Exp. Ther., August 1, 2002; 302(2): 475 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Drocourt, J.-C. Ourlin, J.-M. Pascussi, P. Maurel, and M.-J. Vilarem Expression of CYP3A4, CYP2B6, and CYP2C9 Is Regulated by the Vitamin D Receptor Pathway in Primary Human Hepatocytes J. Biol. Chem., July 5, 2002; 277(28): 25125 - 25132. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lindley, G. Hamilton, J. S. McCune, S. Faucette, S. S. Shord, R. L. Hawke, H. Wang, D. Gilbert, S. Jolley, B. Yan, et al. The Effect of Cyclophosphamide with and without Dexamethasone on Cytochrome P450 3A4 and 2B6 in Human Hepatocytes Drug Metab. Dispos., July 1, 2002; 30(7): 814 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Stankova, S. Turcotte, J. Harris, and M. Rola-Pleszczynski Modulation of Leukotriene B4 Receptor-1 Expression by Dexamethasone: Potential Mechanism for Enhanced Neutrophil Survival J. Immunol., April 1, 2002; 168(7): 3570 - 3576. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gerbal-Chaloin, M. Daujat, J.-M. Pascussi, L. Pichard-Garcia, M.-J. Vilarem, and P. Maurel Transcriptional Regulation of CYP2C9 Gene. ROLE OF GLUCOCORTICOID RECEPTOR AND CONSTITUTIVE ANDROSTANE RECEPTOR J. Biol. Chem., January 4, 2002; 277(1): 209 - 217. [Abstract] [Full Text] |
||||
![]() |
K. Bodin, L. Bretillon, Y. Aden, L. Bertilsson, U. Broome, C. Einarsson, and U. Diczfalusy Antiepileptic Drugs Increase Plasma Levels of 4beta -Hydroxycholesterolin Humans. EVIDENCE FOR INVOLVEMENT OF CYTOCHROME P450 3A4 J. Biol. Chem., October 12, 2001; 276(42): 38685 - 38689. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Drocourt, J.-M. Pascussi, E. Assenat, J.-M. Fabre, P. Maurel, and M.-J. Vilarem Calcium Channel Modulators of the Dihydropyridine Family Are Human Pregnane X Receptor Activators and Inducers of CYP3A, CYP2B, and CYP2C in Human Hepatocytes Drug Metab. Dispos., October 1, 2001; 29(10): 1325 - 1331. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gerbal-Chaloin, J.-M. Pascussi, L. Pichard-Garcia, M. Daujat, F. Waechter, J.-M. Fabre, N. Carrère, and P. Maurel Induction of CYP2C Genes in Human Hepatocytes in Primary Culture Drug Metab. Dispos., March 1, 2001; 29(3): 242 - 251. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||