|
|
|
|
Vol. 58, Issue 6, 1525-1535, December 2000
Centre de Biophysique Moléculaire, Centre National de la Recherche Scientifique, Orléans, France (M.L., D.L., M.G.P., A.S.); Department of Pharmaceutical Chemistry, Bari, Italy (F.P.I., G.N.); Department of Oncology, Sigma-tau, Pomezia, Italy (C.P.); and Department of Biomedical Sciences and Human Oncology, Bari, Italy (A.B., D.G., M.C.)
| |
Abstract |
|---|
|
|
|---|
To investigate the modifications of antitumor activity and DNA binding mode of transplatin after replacement of one nonleaving group NH3 by an iminoether group, trans-[PtCl2{Z-HN=C(OMe)Me}(NH3)] and trans-[PtCl2{E-HN=C(OMe)Me}(NH3)] complexes (differing in the Z or E configuration of iminoether, and abbreviated mixed Z and mixed E, respectively), have been synthesized. In a panel of human tumor cell lines, both mixed Z and mixed E show a cytotoxic potency higher than that of transplatin, the mean IC50 values being 103, 37, and 215 µM, respectively. In vivo mixed Z is more active and less toxic than mixed E in murine P388 leukemia and retains its efficacy against SK-OV-3 human cancer cell xenograft in nude mice. In the reaction with naked DNA, mixed Z forms monofunctional adducts that do not evolve into intrastrand cross-links but close slowly into interstrand cross-links between complementary guanine and cytosine residues. The monofunctional mixed Z adducts are removed by thiourea and glutathione. The interstrand cross-links behave as hinge joints, increasing the flexibility of DNA double helix. The mixed Z, transplatin, and cisplatin interstrand cross-links, as well as mixed Z monofunctional adducts are not specifically recognized by HMG1 protein, which was confirmed to be able to specifically recognize cisplatin d(GpG) intrastrand cross-links. These data demonstrate that the DNA interaction properties of the antitumor-active mixed Z are very similar to those of transplatin, thus suggesting that clinical inactivity of transplatin could not depend upon its peculiar DNA binding mode.
| |
Introduction |
|---|
|
|
|---|
Cisplatin,
cis-diamminedichloroplatinum(II), is one of the most largely
used drugs in cancer chemotherapy. It displays significant activity
against several types of cancers with an exceptional efficacy against
testicular cancers. Despite this success, all the patients treated with
cisplatin suffer from severe side effects, and quite often tumors
become resistant to cisplatin (O'Dwyer et al.,1999
). In order to
overcome these drawbacks and to get more efficient drugs, many
platinum(II) complexes have been synthesized. Most of them have the
cis geometry because transplatin,
trans-diamminedichloroplatinum(II), the stereoisomer of
cisplatin, is clinically inefficient. A mechanistic explanation of
transplatin inactivity has been based on the type of DNA adducts formed
by this isomer, as well as on its chemical reactivity that could render
the complex susceptible to deactivation before its delivery to the
tumor site (Jamieson and Lippard, 1999
, and references therein).
However, several recent exceptions to the empiric rule that the
presence of two leaving groups in cis position of platinum
complexes is a necessary condition for their antitumor activity, have
been reported. trans-Platinum(II) complexes with planar
ligands (Farrell, 1996
, and references therein), with iminoether
(Coluccia et al., 1993
; Natile and Coluccia, 1999
) or asymmetric
aliphatic amine ligands (Montero et al., 1999
), and
trans-ammine(amine)platinum(IV) complexes (Kelland et al., 1995
), gave promising results in in vitro and in vivo assays.
Several
trans-[PtCl2(iminoether)2]
complexes differing by the nature of the iminoether groups have been
studied, and an overview of their main properties has been recently
reported (Natile and Coluccia, 1999
). Briefly, they show in vivo
antitumor activity toward both lymphoproliferative and solid
metastasizing murine tumors. Their cytotoxicity toward several human
tumor cell lines is comparable to that of cisplatin. The cytotoxic
effect of
trans-[PtCl2(iminoether)2] complexes appears to be a consequence of DNA adduct formation, as
suggested by the greater sensitivity of cells deficient in nucleotide
excision repair system. In the reaction with DNA, they form
monofunctional adducts that are very slowly converted into bifunctional adducts.
To go further in the study of iminoether complexes with trans geometry, we have investigated some properties of complexes that contain only one iminoether group. These complexes are trans-[PtCl2(NH3){Z-HN=C(OMe)Me}] and trans-[PtCl2(NH3){E-HN=C(OMe)Me}] (mixed Z and mixed E, respectively). They differ in the configuration of the iminoether ligands (Z or E, depending upon the cis- or trans-position of the alkoxy group and the metal atom with respect to the C=N double bond). In this paper we show that both mixed Z and mixed E present a cytotoxic potency toward human tumor cells higher than that of transplatin and, in particular mixed Z, a promising in vivo antitumor activity. We show that the DNA interaction properties of mixed Z are very similar to those of transplatin. This similarity, which contrasts with the markedly different in vivo activity, is discussed in relation to the antitumor properties of mixed Z.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials
The oligodeoxyribonucleotides from Eurogentec (Seraing, Belgium)
were purified by strong anion exchange chromatography on a Mono Q HR5/5
column from Amersham Pharmacia Biotech (Orsay, France) as previously
described (Boudvillain et al., 1995
). The sequences of the
oligonucleotides are given in Fig. 1.
Plasmid pSPKB (Lemaire et al., 1991
) was a derivative of plasmid pSP73 from Promega (Charbonnieres, France). The enzymes were from Promega or
Biolabs (Hitchin, England). The radioactive products were from Amersham
Pharmacia Biotech, and the chemicals were from Merck (Nogent-sur-Marne,
France).
|
Synthesis of Mixed E and Mixed Z
The synthesis of the trans-[PtCl2(NH3){HN=C(OMe)Me}] complex was accomplished starting from cis-[PtI2(NH3)2], which was first converted to cis-[Pt(NH3)2(NCMe)2](NO3)2, then to trans-[PtI2(NH3)(NCMe)], and finally to trans-[PtCl2(NH3)(NCMe)]. Addition of methanol to the coordinated nitrile in the last complex afforded the desired iminoether species.
Synthesis of trans-[PtCl2(NH3)(NCMe)]
cis-[PtI2(NH3)2] (1.4 g, 3 mmol) was suspended in H2O (30 ml), and the temperature was increased to 70°C. Ten minutes after addition of AgNO3 (1.0 g, 6 mmol), the solution was filtered through celite to remove AgI and then was treated with MeCN (25 ml); the solvent was evaporated under reduced pressure while keeping the reaction vessel at 70°C. The solid residue was dissolved in 50 ml of H2O/CH3CN (1:1, v/v), and the solvent was evaporated again. The solid residue of cis-[Pt(NH3)2(NCMe)2](NO3)2 was dissolved in 100 ml of H2O and treated with KI (1.66 g, 10 mmol), the solution was warmed to 70°C, and the solvent was evaporated under reduced pressure. A second volume of water (100 ml) was added to the solid residue, and the solvent was evaporated again under reduced pressure, always keeping the reaction flask at 70°C. The solid residue, suspended in a small volume of cold water, was transferred on a sintered glass filter, washed carefully with a small portion of cold water, and dried in a stream of dry air. The yield of trans-[PtI2(NH3)(NCMe)] was ca. 65% based on platinum. The iodo species (1 g, ca. 2 mmol) was suspended in acetone (50 ml), and the slurry was warmed to 60°C and treated with AgNO3 (0.65 g, 3.8 mmol) dissolved in a minimum volume of water (ca. 1 ml). After 10 min the solution was filtered, the solvent was evaporated, and the residue was dissolved in water (100 ml). The water solution was treated with KCl (1.2 g, 16 mmol), and the solvent was evaporated under reduced pressure, keeping the reaction vessel in a water bath at 70°C. The solid residue was suspended in cold water, transferred on a glass filter, washed with cold water, and dried in the air. The yield of trans-[PtCl2(NH3)(NCMe)] was ca. 70%. Analysis calculated for C2H6Cl2Pt: C, 7.4; H, 1.9; N, 8.6%. Found: C, 7.2; H, 1.8; N, 8.5%.
Synthesis of trans-[PtCl2(NH3){Z-HN=C(OMe)Me}]
trans-[PtCl2(NH3)(NCMe)] (0.43 g, 1.3 mmol) was suspended in methanol (5 ml), cooled to 0°C (ice bath) and treated with powdered KOH (50 mg). After stirring for 30 min, the solution was filtered, the solid residue was washed with cold methanol until complete removal of residual base (neutral pH of the filtered washing solvent) and dried in the air. The yield of trans-[PtCl2(NH3){Z-HN=C(OMe)Me}] was ca. 80%. Analysis calculated for C3H10N2OCl2Pt: C, 10.1; H, 2.8; N, 7.9. Found: C, 10.2; H, 2.8; N, 7.8%.
Synthesis of trans-[PtCl2(NH3){E-HN=C(OMe)Me}]
The E isomer was obtained by isomerization of the Z isomer. In a typical experiment, trans-[PtCl2(NH3){Z-HN=C(OMe)Me}] (0.15 g, 0.42 mmol) was suspended in methanol (60 ml) and treated with 30 mg of powdered KOH. The slurry was left stirring overnight. After neutralization with concentrated HCl, the solvent was evaporated under reduced pressure, and the solid residue was extracted with dichloromethane. The dichloromethane solution was concentrated to a small volume by evaporation of the solvent under reduced pressure and chromatographed on an open column of silica gel using dichloromethane containing increasing amounts of acetone (from 0.5 to 20%, v/v) as eluant. The first eluted product was the desired compound obtained in ca. 50% yield. Analysis found: C, 10.5; H, 2.9; N, 7.7%.
Tumor Cell Lines and In Vitro Cytotoxicity Assay
Tumor cell lines representative of ovarian (SK-OV-3, OVCAR-8), lung (A549/ATCC, NCI-H460), colon (KM12, COLO 205, HCT-116), and breast (T-47D, MCF7, MDA) cancers were obtained from the National Cancer Institute, Biological Testing Branch (Frederick, MD), and maintained in the logarithmic phase at 37°C in a 5% CO2-humidified air in RPMI 1640 medium supplemented with 10% fetal calf serum, 2 µM glutamine, penicillin, and streptomycin (100 U/ml and 0.1 mg/ml, respectively). A2780 ovarian cancer cells were kindly supplied by Dr. R. Ozols (Fox Chase Cancer Center, Philadelphia, PA) and maintained in RPMI 1640 medium supplemented with 10% fetal calf serum, 2 µM glutamine, 10 µg/ml insulin, penicillin, and streptomycin (100 U/ml and 0.1 mg/ml, respectively). LOVO colon cancer cells and CALU-3 lung cancer cells were obtained from American Type Culture Collection (Rockville, MD) and maintained in Ham's F12K medium, 10% fetal bovine serum, and minimal essential medium Eagle, 2 mM glutamine, 1.5 g/l sodium bicarbonate, 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 10% fetal bovine serum, respectively. All culture media and reagents were from Euroclone (Paignton, UK).
The growth inhibitory effect of platinum complexes was evaluated by
using the cell proliferation kit I (MTT) (Roche Molecular Biochemicals, Milano, Italy), following the supplier's protocol. Briefly, the cells grown in the culture flasks were trypsinized, and
100 µl of medium containing the appropriate cell number (A2780: 50,000; SK-OV-3, T-47D, MDA: 20,000; KM12, COLO, LOVO, CALU: 15,000; OVCAR8: 10,000; A549, H460: 7,500; HCT116, MCF7: 7,500) was inoculated into 96-well microplates. After 24 h from seeding, the cells were incubated with various concentrations of platinum complexes
freshly dissolved in the culture medium
for 72 h at 37°C, followed by an additional 4-h incubation with 10 µl/well tetrazolium salt solution (5 mg/ml). The cells were dissolved in 100 µl of 10% SDS
solubilization solution, and the absorbance was measured at 570 nm. The
drug concentration that inhibited cell growth by 50% (IC50) was obtained from semilogarithmic
dose-response plots.
Assessment of In Vivo Antitumor Activity
Murine P388 Leukemia.
P388 leukemia cells were obtained from
the National Cancer Institute (Bethesda, MD) and maintained in DBA/2J
female mice (Charles River, Calco, Italy). For experimental purposes,
female B6D2F1 mice weighing 18 to 20 g were used, and the
antileukemic effect of platinum complexes was evaluated as previously
described (Coluccia et al., 1999a
).
SK-OV-3 Ovarian Carcinoma Cell Xenograft.
SK-OV-3 tumor cell
suspensions (2 × 106 cells/mouse) were
injected s.c. into CD-1 female nude (nu/nu) mice (Charles River) on day
0. Treatment with cisplatin (Pharmacia and Upjohn, Milano, Italy) or
mixed Z (freshly dissolved in saline) was performed i.p. on
days 7, 14, and 21 from tumor implant (10 mice/group, 10 controls) at 2 and 4 mg/kg doses. Tumor mass was measured by caliper on days 9, 16, 23, and 31 from tumor implant, and the effect of treatment was
expressed as %TWI, calculated according the following formula:
%TWI = 100
[(mean tumor weight of treated mice/mean
tumor weight of controls) × 100]. Results of in vivo antitumor
activity experiments were analyzed by the Mann-Whitney nonparametric test.
Platination of the Oligonucleotides
The oligonucleotides containing a single mixed Z
monofunctional adduct were obtained by reacting the pyrimidine-rich
d(TGT) or d(TGC) oligonucleotides, at 30 µM concentration, with mixed Z at a platinum to oligonucleotide molar ratio of 6 in 10 mM
NaClO4, 5 mM acetate buffer, pH 3.6, for 40 min
at 37°C, as previously described (Bernal-Mendez et al., 1997
). The
platinated oligonucleotides were purified by strong anion exchange
chromatography (Mono Q HR5/5 column) with a 2 mM NaOH, 0.2 to 0.8 NaCl
gradient. The fractions were neutralized with HCl and desalted on
Sep-Pak C18 cartridges (Waters, St Quentin en
Yvelines, France). The platinated oligonucleotides, in 100 mM NaCl,
were kept at
20°C. It has been verified that the oligonucleotides
contained one platinum residue that was bound at the single guanine
residue by reaction with dimethyl sulfate as previously described
(Lemaire et al., 1991
; Boudvillain et al., 1995
).
Interstrand Cross-Links in Double-Stranded Oligonucleotides
To follow the formation of interstrand cross-links, the
single-stranded oligonucleotides containing a single monofunctional adduct were hybridized with their complementary strands and then incubated at 37°C in 50 or 150 mM NaClO4, 3 mM
phosphate buffer, pH 7.5, 0.5 mM EDTA. Aliquots were withdrawn at
various time intervals and analyzed by gel electrophoresis under
denaturing conditions as described (Brabec and Leng, 1993
).
Quantitation of the gel bands was done on a Molecular Dynamics
PhosphorImager, using ImageQuant software version 3.3 (Molecular
Dynamics, Sunnyvale, CA) for data processing.
Interstrand Cross-Links in DNA Restriction Fragments
Plasmid pSPKB was digested by HpaI and
SspI endonucleases into two fragments (1871 and 588 bp,
respectively). The two restriction fragments were reacted with
transplatin or mixed Z at a molar ratio of
platinum/nucleotide residue equal to 0.001 or 0.005. The samples were
incubated in 10 mM NaClO4, at 37°C for 24 h. After addition of NaCl (100 mM), DNA fragments were
32P-phosphorylated at the 3'-end with the Klenow
fragment of DNA polymerase I and [
-32P]ATP.
The 588-bp fragments with and without interstrand cross-links were
separated by electrophoresis on denaturing 1% agarose (Brabec and
Leng, 1993
). The number of interstrand cross-links per bound platinum
residue was determined from the amounts of DNA in the two corresponding
bands and assuming a Poisson distribution of ICLs (Farrell et al.,
1990
).
RNA Mapping Experiments
The unplatinated transcription template was synthesized by
polymerase chain reaction amplification of a 135-bp fragment from plasmid pSPKB. This fragment contained T7 RNA polymerase promoter 10 bases away from the 3'-end of the upper strand. The primers were
5'-d(CGATTTAGGTGACACTATAG) and 5'-d(CGAAATTAATACGACTCACTATAGGG). The
DNA fragments were reacted with transplatin or mixed Z, in 10 mM NaClO4, for 24 h at 37°C. The molar
ratios of platinum over DNA were chosen to get about 50% of the DNA
molecules containing at least one interstrand cross-link. The samples
were treated with thiourea (10 mM) for 40 min at 37°C to remove the
monofunctional adducts. The two types of molecules, those containing or
not containing interstrand cross-links, were purified by agarose
(1.5%) gel electrophoresis under denaturing conditions. The gel was
neutralized, and the two types of fragments were eluted. After one
heating/reannealing cycle, the fragments were used as templates for RNA
synthesis by T7 RNA polymerase as described (Lemaire et al., 1991
).
Hydroxyl Radical Footprinting
The protocol for the footprinting experiments was essentially
that previously described (Churchill et al., 1990
). The reaction mixtures contained 50 mM NaCl, 10 mM Tris-HCl, pH 7.5, and the platinated (or unplatinated) duplexes (about 6 × 10
9 M) with either the pyrimidine-rich or the
purine-rich strand 32P-labeled at the 5'-end.
Cleavage of the phosphodiester backbones was done by introducing iron
(40 µM), EDTA (80 µM), 0.03%
H2O2, and sodium ascorbate
(2 mM) for 5 min at 20°C. The reaction was stopped by adding thiourea
(15 mM), EDTA (3 mM), sodium acetate (0.3 M), and tRNA (0.3 mg/ml).
After precipitation, the samples were loaded onto a 24% denaturing
polyacrylamide gel. Maxam-Gilbert sequencing reactions were run in parallel.
Ligation and Electrophoresis
Duplexes of various lengths (from 20- to 22-mer, see Fig. 1),
unplatinated or containing a single ICL, were 32P
5'-end phosphorylated with polynucleotide kinase and
[
-32P]ATP. The duplexes were incubated with
T4 DNA ligase in 10 mM MgCl2, 1 mM ATP, 10 mM
Tris-HCl, pH 7.5, at 16°C for 1 h. The migration of the ligated
products was examined on 8% native polyacrylamide electrophoresis gels
as described (Koo et al., 1986
; Boudvillain et al., 1995
).
Interaction between HMG1 and Platinated DNAs
Rat HMG1 and the corresponding domain A were expressed in
Escherichia coli from previously reported plasmids
(pT7-RNHMG1 and K82Z, respectively). The purification of the proteins
was done following the protocols already described (Bianchi, 1991
;
Locker et al., 1995
).
The determination of the dissociation constants was done as described
(Dunham and Lippard, 1997
) with minor modifications. The reaction
mixtures containing 6% Ficoll, 1 mM EDTA, 10 mM HEPES, pH 7.5, 0.2 mg/ml bovine serum albumin, 80 mM NaCl, 10 mM
MgCl2, 2000 cpm platinated DNA (about
10
10 M), and varying concentrations of HMG1 (or
domains) in 10 µl were kept in ice for 20 min prior to loading. The
reaction mixtures were analyzed by gel electrophoresis in prerun and
precooled 45 mM Tris-borate, 1 mM EDTA, pH 8.3, 8% native
polyacrylamide gels [29:1
acrylamide/N,N'-methylenebis(acrylamide), 0.5% ammonium persulfate]. The gels were run at 200 V. Quantitation of the gel bands
was done on a Molecular Dynamics Phosphorimager. In the competition
experiments to determine the relative affinities of HMG1 (or domain A)
for platinated or unplatinated duplexes, the reactions were done as
just described, but first the protein and the competitor were mixed and
incubated in ice for 10 min, and then the probe
(32P 5'-end-labeled duplex containing a single
cisplatin intrastrand cross-link) was added. After 20 min in ice, the
reaction mixtures were analyzed by gel electrophoresis. The apparent
dissociation constants of the competitors were calculated as described
(Dunham and Lippard, 1997
). The results were also plotted as inhibition (percentage) of binding of 32P-labeled duplex as
a function of the logarithm of the competitor concentration.
| |
Results |
|---|
|
|
|---|
In Vitro Cytotoxicity.
The effect of mixed Z, mixed
E, and transplatin was evaluated in a panel of human tumor
cell lines containing examples of ovary (A2780, SK-OV-3, OVCAR-8), lung
(A549/ATCC, NCI-H460, CALU), colon (KM12, LOVO, COLO 205, HCT-116), and
breast (T-47D, MCF7, MDA) cancer (Fig.
2). Both mixed Z and mixed
E showed a cytotoxic potency higher than that of
transplatin, the mean IC50 values in the tumor
cell panel being 103, 37, and 215 µM, respectively. Interestingly,
the platinum-iminoether complexes showed major efficacy against ovarian
and colon tumor cells, whereas lung cancer cells appeared to be more
resistant.
|
In Vivo Antitumor Activity.
The antitumor activity of
platinum-iminoether complexes was investigated in the i.p.-i.p. murine
P388 leukemia system (Table 1).
Both mixed Z and mixed E showed in vivo activity
(%T/C > 125). Mixed Z was definitely more active (and
less toxic) than mixed E. The treatment with mixed
Z at 15 and 20 mg/kg determined %T/C values of 173 and 190, along with one of six and two of six cures, respectively. On the
contrary, the best %T/C for mixed E was obtained at 15 mg/kg (%T/C, 152), and a severe reduction of body weight along with
two of six toxic deaths were observed at the 20-mg/kg dose.
|
|
Interaction between DNA and Mixed Z.
Numerous
studies support that the formation of adducts in the reaction between
cisplatin or transplatin and DNA proceeds in two successive
solvent-assisted reactions (Bancroft et al., 1990
). Assuming a similar
mechanism for mixed Z, we wanted to know whether the
reaction of mixed Z with double-stranded DNA resulted in the formation of intrastrand and/or ICL and then to determine the rates of
the cross-linking reactions. These studies were performed on large
platinated DNA restriction fragments or on double-stranded oligonucleotides containing a single adduct, and we chose to
investigate mixed Z because of its higher antitumor activity.
Reactivity of DNA Restriction Fragments with Mixed
Z.
The formation of ICLs can be easily revealed by
gel electrophoresis under denaturing conditions, the migration of the
DNA molecules with and without ICLs being very different because of the
difference in molecular weight. The 588-bp DNA restriction fragments
from plasmid pSPKB were reacted with either mixed Z or
transplatin for 24 h, and then the molecules with and without ICLs
were separated on an alkaline agarose gel (1%) (Fig.
3). The values of ICL/adduct were 0.13 for transplatin and 0.10 for mixed Z, respectively
(precision 10%).
|
RNA Polymerase Mapping.
It is known that bifunctional adducts
in cisplatin- or transplatin-modified DNA can prematurely terminate in
vitro RNA synthesis by T7 or SP6 RNA polymerases (Lemaire et al., 1991
;
Brabec and Leng, 1993
). This approach has been used to characterize the
preferred binding sites for mixed Z. After a 24-h reaction
with mixed Z or transplatin, DNA fragments (135 bp) were
treated with thiourea to remove the monofunctional adducts (vide
infra). The fragments with and without ICLs were separated by agarose
gel electrophoresis under denaturing conditions and then used as
templates for RNA synthesis by T7 RNA polymerase. Sequence analysis of
the fragments (Fig. 4A) did not reveal
any stop during transcription of transplatin- or mixed
Z-modified DNA that did not contain ICLs. We previously concluded that in double-stranded DNA modified by transplatin no
intrastrand cross-links are formed (Boudvillain et al., 1995
; Bernal-Mendez et al., 1997
). The present results suggest that transplatin and mixed Z behave similarly as far as their
inability to form intrastrand cross-links.
|
Closure of the Monofunctional Adducts within Double-Stranded Oligonucleotides. Further investigations were aimed at determining the rate of the interstrand cross-linking reaction and the nature of the cross-linked bases. Experiments were done on double-stranded d(TGC) and d(TGT) oligonucleotides containing a single mixed Z monofunctional adduct. For sake of simplicity, we present only the results relative to the d(TGC) sequence, because they are identical to those of the d(TGT) sequence.
The single-stranded oligonucleotide containing a single mixed Z monofunctional adduct was 32P-labeled at the 5'-end and then hybridized with its complementary strand. The sample was incubated at 37°C in 50 or 150 mM NaClO4. The reaction products were analyzed by polyacrylamide gel electrophoresis under denaturing conditions. This technique allows the separation of oligonucleotides containing intrastrand or interstrand cross-links (Bernal-Mendez et al., 1997
|
Hydroxyl Footprinting.
The hydroxyl radicals generated by
reaction of the EDTA complex of iron(II) with hydrogen peroxide
initiate cleavage of the DNA phosphodiester backbone by abstracting a
hydrogen atom from a deoxyribose. The hydroxyl radicals cleave
mixed-sequence DNA nearly equally at each backbone position (Draganescu
and Tullius, 1996
). We have taken advantage of this reaction to
identify the nature of the bases in the mixed Z ICLs.
|
Distortions of DNA Induced by the ICLs.
Several studies have
shown that some structural features of cisplatin- or
transplatin-modified oligonucleotides, such as bending of the double
helix longitudinal axis and variation from the canonical twist of
B-DNA, can be determined from electrophoretic mobility of multimers of
these oligonucleotides on polyacrylamide gels (Bellon and Lippard,
1990
). We have applied this technique to characterize the
conformational changes of the DNA double helix induced by mixed
Z ICLs within the d(TGT) duplex.
|
Resistance of the Monofunctional Adducts to Thiourea.
It is
well known that transplatin monofunctional adducts are rapidly removed
by thiourea (Eastman and Barry, 1987
), a sulfur-containing molecule,
whereas
trans-[PtCl2(E-iminoether)2]
monofunctional adducts are more resistant (Brabec et al., 1996
;
Boccarelli et al., 1999
). We wanted to determine the effect of thiourea
on mixed Z monofunctional adducts.
|
Interaction between HMG1 and Platinated DNAs.
We were
interested to determine whether HMG domains were able to bind
specifically to DNAs modified by mixed Z. The results relative to domain A from rat HMG1 are summarized in Fig.
9. In agreement with published data
(Dunham and Lippard, 1997
) domain A recognized the 18-bp d(AG*G*)duplex
containing a single cisplatin intrastrand cross-link at the d(GpG) site
of the pyrimidine-rich strand (Fig. 1), as indicated by the presence of
a shifted band that increased with increasing protein concentration
(Fig. 9, 1). The dissociation constant Kd
for domain A-d(AG*G*) complex is about 5 nM. This value differs
slightly from that previously reported (Dunham and Lippard, 1997
),
reflecting different experimental conditions. Competition experiments
in which labeled d(AG*G*) was displaced from domain A by unlabeled
d(AG*G*) (Fig. 9, 2) gave a Kd of about 10 nM. The affinities for domain A of several other duplexes were tested
by competition experiments. None of the following duplexes, the
unplatinated d(AGG) duplex, the unplatinated 18-bp d(AGC) duplex, the
18-bp d(AGC) duplex containing either a cisplatin ICL or a transplatin
ICL, or a mixed Z ICL, or a mixed Z
monofunctional adduct, was specifically recognized. They all behaved
similarly, and the Kd for these
duplexes-domain A complexes were in the 5 µM range.
|
| |
Discussion |
|---|
|
|
|---|
The main purpose of this work was to determine the effect on antitumor activity and DNA interaction properties of transplatin after replacement of one NH3 by an iminoether group.
The major biological effect has been observed with trans-[PtCl2{Z-HN=C(OMe)Me(NH3)] (mixed Z). It is only 2-fold more cytotoxic than transplatin toward tumor cells in vitro, but, unlike transplatin, it is endowed with a selective antitumor activity in in vivo models. To our knowledge, this is the first time that a platinum complex with trans geometry has shown the ability to cure tumor-bearing animals (P388 system). Moreover, the antitumor efficacy of mixed Z was confirmed by using an established s.c. tumor (SK-OV-3 xenograft) and drug administration distant (i.p.) from the tumor site.
The next step was to characterize the interaction of mixed
Z-DNA. No intrastrand cross-links are formed, as deduced
from transcription footprinting on a mixed Z-modified DNA
fragment and from the electrophoretic pattern of double-stranded
oligonucleotides containing a single monofunctional adduct. It has been
previously reported that transplatin does not form intrastrand
cross-links within dsDNA (Boudvillain et al., 1995
; Bernal-Mendez et
al., 1997
), and thus, transplatin and mixed Z behave
similarly as far as their inability to cross-link nucleotide residues
on the same strand is concerned.
Both transplatin and mixed Z form ICLs between complementary
G and C residues in the reaction with dsDNA, as deduced from RNA
polymerase and hydroxyl radical footprinting experiments. The RNA
polymerase footprinting reveals that potential (G·C) binding sites are unequally modified, as shown by the different intensities of
the bands. This reflects a sequence effect that modulates the reactivity of G residues with mixed Z in the first step of
reaction and/or the following closure of the monofunctional adducts.
The sequence effect on formation of monofunctional adducts in the reaction between DNA and cisplatin is well documented (Davies et al.,
1998
; Legendre et al., 1998
; Guo and Sadler, 1999
; Jamieson and
Lippard, 1999
). The negative electrostatic potential at the N7 position
of G residues [the preferred binding sites of platinum(II) complexes]
depends upon the nature of the flanking residues (Pullman and Pullman,
1981
). As far as the second step is concerned, we find a difference in
the rate of closure of mixed Z monofunctional adducts within
double-stranded d(TGT) and d(TGC) oligonucleotides. All these results
support a sequence effect on the two steps of the interstrand
cross-linking reaction. Finally, the rate of closure decreases as the
salt concentration increases, suggesting that factors destabilizing the
double helix favor the formation of the ICLs (Bernal-Mendez et al.,
1997
; Zaludova et al., 1997
).
T7 RNA polymerase is not stopped by transplatin or mixed Z
monofunctional adducts. This result extends previous findings of DNA
modified by the monofunctional platinum derivative
chlorodiethylenetriamineplatinum(II) (Lemaire et al., 1991
) or by more
bulky compounds such as
cis-[Pt(NH3)2(N7-N-methyl-2-diazapyrenium)Cl]2+
(Anin et al., 1992
) or
trans-[PtCl2(Z-iminoether)2]
(M. Coluccia, A. Schwartz and M. Leng, unpublished results). On
the other hand, trans-[PtCl2(E-iminoether)2]
monofunctional adducts behave differently because they arrest T7 RNA
polymerase (Zaludova et al., 1997
).
The closure of mixed Z monofunctional adducts into ICLs
within double-stranded oligonucleotides is about 2 times slower than that of transplatin, which is itself about 10 times slower than cisplatin (Malinge and Leng, 1999
). An explanation for the slow closure
of transplatin monofunctional adducts can be found in the
three-dimensional structure of a duplex containing a single transplatin
ICL. In this structure (Paquet et al., 1999
), the platinated G residue
is in the syn conformation and the adjacent base pairs are
pushed away along the axis of the double helix by the platinum
NH3 ligands. Two events, rotation of the
platinated G residue from anti to syn
conformation and displacement of the adjacent base pairs, are necessary
to locate the platinum residue near the complementary cytosine residue.
These two independent events have to occur concomitantly, and this
makes the interstrand cross-linking reaction unlikely.
The three-dimensional structure of a duplex containing a single mixed
Z ICL has not yet been determined. Compared with transplatin ICL, we expect some structural changes due to the larger size of the
iminoether group. In fact, the distortions induced by
transplatin and mixed Z ICL are different, as judged by gel
mobility shift of multimers of cross-linked duplexes relative to
unplatinated controls. Transplatin ICL behaves as a directed bend and
introduces some flexibility into the helix (Brabec et al., 1993
). The
mixed Z ICL introduces more flexibility and behaves as a
hinge joint, as shown by the anomalous migration of the multimers of
mixed Z duplexes that is almost independent from the length
of the cross-linked duplexes. Despite these structural differences,
both transplatin and mixed Z cross-link complementary G and
C residues in dsDNA with about the same rate and yield.
It is known that transplatin monofunctional adducts are removed by
thiourea, whereas the bifunctional adducts are resistant (Eastman and
Barry, 1987
). The thiourea deplatination reaction rate on mixed
Z monofunctional adducts within double-stranded oligonucleotides depends slightly upon the sequence
(t1/2 = 10 and 21 min for d/TGT) and
d(TGC), respectively) and is in the same range of magnitude as that of
transplatin monofunctional adducts (t1/2 = 10 min). Both transplatin and mixed Z monofunctional adducts
are also removed at the same rate by glutathione
(t1/2 ~ 350 min). Therefore, the
accessibility of the platinum residue is not hampered by the iminoether
group, and both adducts behave similarly with respect to small
sulfur-containing molecules.
Several results support the implication of HMG1-like proteins in the
mechanism of action of cisplatin (Jamieson and Lippard, 1999
; Zamble
and Lippard, 1999
). They bend DNA and recognize specifically prebent
DNA structures that they can further bend (Bianchi and Bertrame, 1998
).
HMG1 as well as its A and B domains interact specifically with DNA
modified by cisplatin at d(GpG) (Jamieson and Lippard, 1999
; Zamble and
Lippard, 1999
, and references therein), and recently the crystal
structure of HMG1 domain bound to a 16-bp oligonucleotide containing a
single (G1,G2)-intrastrand cross-link has been resolved (Ohndorf
et al., 1999
). We have compared the relative affinities of HMG1 (and
domain A) to DNA containing a monofunctional mixed Z adduct,
a transplatin ICL, or a mixed Z ICL. The proteins do not
recognize preferentially the modified DNAs, which behave as the
unplatinated sample. Unlike cisplatin, the recognition of a mixed
Z monofunctional adduct or ICL by HMG1-like proteins does
not seem to be implicated in the antitumor activity of the complex.
The results on the interaction between HMG1 and transplatin ICLs
confirm previous findings (Kasparkova and Brabec, 1995
; Locker et al.,
1995
). We have also studied the interaction between HMG1 (and domain A)
and a duplex containing a cisplatin ICL. The structure of the cisplatin
ICL has been resolved by NMR and X-ray crystallography (Malinge
and Leng, 1999
, and references therein). The double helix is largely
unwound and its axis is bent toward the minor groove. The platinum
residue is located in the minor groove of DNA and the cytosine residues
are extruded from the double helix. The structures of the cisplatin
(G1,G2)-intrastrand cross-link (Takahara et al., 1995
; Ohndorf et al.,
1999
) and cisplatin ICL are quite different; therefore, the latter is
not expected to be specifically recognized by HMG1. In fact, we do not
observe any preferential binding. This result differs from the one
recently reported (Kasparkova and Brabec, 1995
).
The general conclusion of the in vitro experiments is that mixed Z resembles transplatin with respect to the interactions with DNA. On the other hand, mixed Z is an antitumor drug, but transplatin is not. The similar in vitro DNA interaction of mixed Z and transplatin, which contrasts with their in vivo behavior, might have relevant mechanistic implications, suggesting that the clinical inactivity of transplatin could not depend upon its peculiar DNA binding mode. A comparative investigation of the nature of adducts formed in the in vivo reaction between DNA and mixed Z or transplatin should shed light, in the near future, on this matter.
Replacement of a NH3 by an iminoether very likely
modifies some cellular pharmacological properties (increased
accumulation and DNA binding) of the complex. Preliminary data support
this hypothesis, which is also favored by the fact that the
bis-imminoether complexes
trans-[PtCl2{E-NH=C(OMe)Me}2],
trans-[PtCl2{E-NH=C(OEt)Me}2], and
trans-[PtCl2{Z-NH=C(OEt)Me}2]
enter cells much more efficiently than does cisplatin, and their DNA
adduct formation is, at least, 20-fold higher than that of cisplatin
(Coluccia et al., 1999a
, b
). Accordingly, it is tempting to speculate
that both mixed Z monofunctional adducts and ICLs are
involved in the pharmacological action of the complex. It is generally
accepted that monofunctional adducts are not involved in the antitumor
activity of cisplatin because platinum complexes that bind
monofunctionally to DNA as [Pt(NH3)Cl]+ and
chlorodiethylenetriammineplatinum(II)chloride are inactive (Jamieson
and Lippard, 1999
). However, the long-lived mixed Z monofunctional adducts could be important because of their potential to
cross-link DNA to proteins. On the other hand, mixed Z ICLs could be important because they are expected to block DNA and RNA polymerases.
Importantly, the in vivo experiments show that the replacement of one NH3 by an iminoether modifies the toxicity of transplatin and very likely also its pharmacokinetic properties, because mixed Z is able to reach, with therapeutic efficacy, the tumor site. Whether these promising preclinical investigations will lead to a new platinum drug for cancer patients will become clearer in the near future, after more detailed pharmacological and toxicological investigations.
| |
Footnotes |
|---|
Received June 26, 2000; Accepted September 6, 2000
Marc Leng worked to the last of his days on this paper,
giving the most important contribution to its realization.
Unfortunately, Marc died of cancer in May 2000, but neither our long
collaboration nor our friendship are interrupted, because we will
always remember the joy of staying together.
This work was supported in part by grants from Ligue Contre le Cancer Loiret, Agence Nationale pour la Recherche sur le Sida, Association pour la Recherche sur le Cancer, and European Union Cost D8/0007/97 and BMH4-CT97-2485 contracts.
Send reprint requests to: Mauro Coluccia, Department of Biomedical Sciences and Human Oncology, University of Bari Medical School, Piazza Giulio Cesare 11, 70124 Bari, Italy. E-mail mauro.coluccia{at}dimo.uniba.it
| |
Abbreviations |
|---|
cisplatin and transplatin, cis- and trans-diamminedichloroplatinum(II); mixed E and mixed Z, trans-dichloro(ammine)(E-iminoether)platinum(II) and trans-dichloro(ammine)(Z-iminoether)platinum(II); ICL, interstrand cross-link; bp, base pairs; ri, input molar ratio of drug over nucleotide residues; dsDNA, double-stranded DNA; HMG1, high mobility group 1; %T/C, mean survival time (%) of treated animals versus controls; %TWI, percentage of tumor weight inhibition of treated mice versus controls; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Kasparkova, S. Pospisilova, and V. Brabec Different Recognition of DNA Modified by Antitumor Cisplatin and Its Clinically Ineffective trans Isomer by Tumor Suppressor Protein p53 J. Biol. Chem., May 4, 2001; 276(19): 16064 - 16069. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||