|
|
|
|
Vol. 59, Issue 2, 248-253, February 2001
B
Activation Via Conventional PKC Isotypes in
Lipopolysaccharide-Stimulated 70Z/3 Pre-B Lymphocyte Tumor Cells
Laboratory of Cellular Oncology, National Cancer Institute, National Institute of Health, Bethesda, Maryland (M.L.); and Biopotency Evaluation Laboratory, Korea Research Institute of Bioscience and Biotechnology, Yusong, Taejon, Korea (Y.J.J.)
| |
Abstract |
|---|
|
|
|---|
Paclitaxel, a potent antitumor agent, has been shown to be
lipopolysaccharide (LPS) mimetic in mice, stimulating signaling pathways and gene expression indistinguishably from LPS. In the present
study, we showed the intracellular signaling pathway of paclitaxel-induced nuclear factor-
B (NF-
B) activation and its suppressive effect on LPS-induced signaling in murine 70Z/3 pre-B cells. Stimulation of 70Z/3 cells with LPS for 30 min caused activation of NF-
B in the nuclei by detection of DNA-protein binding specific to NF-
B. Similarly, paclitaxel also produced a marked and
dose-related NF-
B activation. However, pretreatment of cells with 10 µM paclitaxel for 18 h resulted in complete inhibition of
LPS-mediated NF-
B activation. Interestingly, the activity of I
B
kinase (IKK-
), which plays an essential role in NF-
B activation
through I
B phosphorylation, was largely enhanced in
paclitaxel-treated cells, detected as I
B
phosphorylation. Because
protein kinase C (PKC) is implicated in the activation of NF-
B via
IKK-
, the effect of paclitaxel on PKC activation was also measured.
It was shown that NF-
B nuclear translocation and DNA binding in
response to paclitaxel was completely blocked by the conventional PKC
inhibitor, Gö 6976. Moreover, immunoblotting analysis with
paclitaxel-treated cell extract demonstrated that the conventional PKC
isotype PKC-
was found to be involved in the regulation of
paclitaxel-induced NF-
B activation, as determined by electrophoretic
mobility shift of PKC. Therefore, these data suggest that paclitaxel
may activate IKK-
via conventional PKC isotypes, resulting in
NF-
B activation and, finally, desensitization of LPS-inducible
signaling pathway in 70Z/3 pre-B cells.
| |
Introduction |
|---|
|
|
|---|
Paclitaxel (Taxol), isolated
from the bark of the Pacific yew tree, is one of the more promising
agents for treatment of breast cancer (Rowinsky, 1994
) and is shown to
block cells at the G2/M junction of the cell
cycle (Blagosklonny et al., 1996
). The primary mechanism of action of
paclitaxel is attributed to its ability to bind to microtubules and
prevent their assembly. In addition to the blockage of mitosis,
paclitaxel also triggers cellular responses that mimic those induced by
LPS, a potent activator of the innate immune system, such as tyrosine
phosphorylation of mitogen-activated protein kinases, translocation of
NF-
B, and induction of gene expression (Perera et al., 1996
; Das and White, 1997
).
In particular, activation of the transcription factor NF-
B is
implicated in the induction of a number of genes by LPS (Garrett et
al., 1999
). In unstimulated cells, this transcription factor exists in
an inactive state in the cytoplasm complexed to the inhibitory protein
I
B. In mammalian cells, the I
B family consists of
I
B
, I
B
, I
B
, p105, and p100 (Whiteside and Israel,
1997
). Among the I
B members, I
B
and I
B
are the most
prominent and have been extensively characterized. Upon activation,
I
B undergoes phosphorylation and degradation, and the NF-
B
heterodimer translocates into the nucleus, where it binds to DNA and
activates transcription (Rice and Ernst, 1993
). Activation of
NF-
B-dependent transcription has been observed consistently after
stimulation by Raf-1, PKC, or protein tyrosine kinase receptors
(Steffan et al., 1995
; Baumann et al., 2000
). In fact, however,
additional kinases may be involved in LPS-mediated I
B
phosphorylation (Schouten et al., 1997
). A high-molecular-mass I
B
kinase (IKK) complex, consisting of IKK-
, IKK-
, NF-
B-inducing
kinase (NIK) and two adaptor or scaffold proteins, has been studied
intensively (Woronicz et al., 1997
).
Evidence has accumulated that PKC may be associated with activation of
IKK (Lallena et al., 1999
; Trushin et al., 1999
). PKC comprises a
family of related serine/threonine protein kinases implicated in the
regulation of various cellular processes, including proliferation and
differentiation (Liu, 1996
). The PKC family is composed of at least 11 members classified into three major groups-conventional PKC, including
PKC-
, -
1, -
2, and
-
; novel PKC, including PKC-
, -
, -
, -
, and -µ; and
atypical PKC, including PKC-
and -
(Parekh et al., 2000
).
It has been thought that NF-
B activation suppresses the signals for
cell death. However, here we show that NF-
B activation via
conventional PKC may contribute to immune suppression by paclitaxel in
LPS-stimulated pre-B cells, indicating that NF-
B can have the
contrasting effects depending on the stimulus. Therefore, it is now
clear that NF-
B transcription factors have a role in regulating the
immune system, either as essential for immune suppression or, perhaps
more commonly, as stimulators of immune response.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
Anti-Raf, anti-IKK-
, and anti-IKK-
were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The
Anti-PKC antibody sampler kit was from Life Technologies (Gaithersburg,
MD). Anti-phospho-I
B
was obtained from New England Biolabs
(Beverly, MA). Protein A-agarose was from Roche Diagnostics (Nutley,
NJ). Dulbecco's modified Eagle's medium, fetal calf serum,
penicillin, and streptomycin were purchased from Life Technologies.
Reagents for SDS-polyacrylamide gel electrophoresis were from Bio-Rad
(Hercules, CA). [
-32P]ATP (3000 Ci/mmol) was
purchased from New England Nuclear (Boston, MA). GF 109203X, Gö
6976, PD 98059, and SB 203580 were purchased from Calbiochem (San
Diego, CA). Paclitaxel and LPS were obtained from Sigma (St. Louis,
MO). Paclitaxel was dissolved in dimethyl sulfoxide and freshly diluted
for each experiment.
Cell Line. The murine pre-B cell line, 70Z/3 (ATCC TIB 152), was obtained from the American Type Culture Collection (Manassas, VA). The cells were cultured in RPMI 1640 medium supplemented with 100 U/ml penicillin, 100 U/ml streptomycin, 2 mM L-glutamine (Life Technologies), 50 µM 2-mercaptoethanol, and 10% bovine calf serum.
Electrophoretic Mobility Shift Assay (EMSA).
Nuclear
extracts were prepared as described previously. (Lee and Yang, 2000a
).
The protein content of the nuclear extracts was determined by the
Bio-Rad protein assay according to the manufacturer's instructions,
and gel mobility shift assays were performed. Briefly, 5 µg of
nuclear extracts were incubated with 2 µg of poly(dI-dC) (Sigma) and
32P-end-labeled DNA probe (double-stranded,
synthetic, 26-base-pair oligonucleotides GATCTCAGAGGGGACTTTCCGAAGAGA
containing the
B enhancer of immunoglobulin-
light chain gene).
Identity of the shifted bands was confirmed by competition with
unlabeled oligomer containing NF-
B site.
In Vitro c-Raf-1 Kinase Assay.
The cell lysates were
prepared as described previously (Ferrier et al., 1997
).
Immunoprecipitation was performed on the whole cell lysates using
anti-Raf (Santa Cruz Biotechnology) and protein A-agarose beads. After
incubation for 2 h at 4°C, immunoprecipitates were washed twice
with ice-cold lysis buffer. After washing with kinase buffer (20 mM
Tris, pH 7.4, 20 mM NaCl, 1 mM dithiothreitol, 10 mM
MgCl2), Raf kinase activity was assayed by
phosphorylation of the recombinant MEK (Santa Cruz Biotechnology). The
samples were resolved by SDS-PAGE, and phosphoproteins visualized by autoradiography.
I
B Kinase (IKK) Assay.
Immunoprecipitation was carried
out using either anti-IKK-
or IKK-
antibody and followed by the
kinase assay (Nemoto et al., 1998
). The kinase reaction was performed
in 30 µl of kinase buffer (20 mM HEPES, pH 7.8, 10 mM
MgCl2, 100 µM
Na3VO4, 20 mM
-glycerophosphate, 2 mM dithiothreitol, 50 mM NaCl) for 30 min at
30°C in the presence of 10 µM ATP/10 µCi of
[
-32P]ATP (10 Ci/mmol) (NEN Life Science
Products) and 500 ng of the substrate GST-I
B-
(Santa Cruz
Biotechnology). The reactions were terminated with 4× Laemmli sample
buffer. Proteins were analyzed on 12.5% SDS-polyacrylamide gels,
dried, and visualized by autoradiography.
Cell Fractionation and Western Blot Assay.
Once 70Z/3 pre-B
cells reached subconfluence, the cells were incubated for additional
times in the presence of LPS or paclitaxel. The cells then were washed
with ice-cold PBS, lysed in lysis buffer (20 mM Tris-HCl, pH 7.4, 5 mM
EGTA, 1 mM phenylmethylsulfonyl fluoride, and 20 µM leupeptin), and
disrupted by Dounce homogenization. The cell homogenates were
fractionated by ultracentrifugation into particulate (plasma
membrane-enriched) (100,000g for 1 h pellet of the
nucleus-free, 800g supernatant), and cytosolic
(100,000g supernatant) fractions. SDS-polyacrylamide gel
electrophoresis and immunoblot analysis using the anti-PKC antibodies,
which recognize the isoforms of PKC-
, -
, and -
, were
performed. The enhanced chemiluminescence (Amersham Pharmacia Biotech,
Piscataway, NJ) protocol was used to visualize the immunoreactive bands.
In Vitro PKC Assay.
Immunoprecipitation was carried out
using either PKC
or PKC
antibody and followed by the kinase
assay. In brief, immunoprecipitates were resuspended in reaction buffer
(20 mM Tris-HCl, pH 7.4, 10 mM MgCl2, 1.2 mM
CaCl2, 20 µM ATP, 0.2 mg/ml Histone H1, 10 µM phorbol-12-myristate-13-acetate, 40 µg/ml phosphatidylserine, and 2.5 µCi of [
-32P]ATP). The reactions
were carried out at 30°C for 5 min and terminated by the addition of
sample buffer. Proteins were separated by SDS-PAGE and visualized by autoradiography.
| |
Results |
|---|
|
|
|---|
Paclitaxel-Induced NF-
B Activation.
In agreement with other
reports (Zheng et al., 1993
; Garrett et al., 1999
) suggesting that
NF-
B plays a central role in LPS-mediated transcriptional
regulation, LPS increased NF-
B binding activity in nuclear extracts
of 70Z/3 pre-B cells. The intensity of NF-
B binding activity
markedly increased after exposure of the cells to 1 µg/ml of LPS for
30 min (Fig. 1A). Similarly, paclitaxel also produced a marked nuclear translocation of NF-
B (Fig. 1C). This
activation was dose-dependent and required
5 µM paclitaxel. The kinetics of NF-
B activation in 70Z/3 cells after paclitaxel exposure are shown in Fig. 1B. Paclitaxel stimulation of NF-
B reached maximum level within 30 min of treatment and was sustained for
a longer time (2 h or more) after exposure.
|
Inhibitory Effect of Paclitaxel on LPS-Induced NF-
B
Activation.
Our previous results have shown that spleen cells can
be induced to a state hyporesponsive to LPS stimulation by pre-exposing them to paclitaxel (Lee et al., 2000b
). Therefore, to identify the
effect of paclitaxel on LPS-induced NF-
B activation, 70Z/3 cells
were treated with LPS for various times relative to paclitaxel treatment. In particular, pretreatment of 70Z/3 cells with paclitaxel for 18 h resulted in complete inhibition of LPS-mediated NF-
B activation, as determined by the loss of DNA binding (Fig.
2A). However, short-term pretreatment or
simultaneous treatment with paclitaxel had no inhibitory effects on LPS
induction (Fig. 2B).
|
Effect of Paclitaxel on I
B Kinase and I
B
Phosphorylation.
During activation of NF-
B, I
B is
phosphorylated, which serves to target it for ubiquitination and
degradation. Several groups have recently characterized and cloned two
I
B kinases (IKK-
and IKK-
) that phosphorylate the residues in
the I
B molecule. Paclitaxel had a major effect on IKK-
activity,
which peaked at 30 min, whereas an almost negligible increase in the
activity of IKK-
was observed at this time point (Fig.
3A). This result indicates that IKK-
is the principal kinase involved in paclitaxel-induced I
B
phosphorylation, although IKK-
has a higher basal activity. We also
determined I
B phosphorylation using a phospho-specific anti-I
B
antibody that detects I
B
only when activated by phosphorylation at Ser-32. In agreement with the results described in Fig. 3A, treatment of cells with paclitaxel led to an increase of phosphorylated I
B
, reaching a plateau between 30 and 120 min (Fig. 3B).
|
Stimulation of PKC-
and -
by Paclitaxel.
To further
characterize the effect of paclitaxel on upstream events, a series of
inhibitors of protein kinase were used (Fig. 4A). GF 109203X inhibits the conventional
and novel isoforms, whereas Gö 6976 inhibits more efficiently the
conventional isoforms. Pretreatment of cells for 2 h with GF
109203X did not interfere with activation of NF-
B by LPS or
paclitaxel. LPS- and paclitaxel-induced NF-
B activation was,
however, effectively blocked by Gö 6976, suggesting a critical
role for conventional PKCs. To confirm the effect of these two PKC
inhibitors, we performed dose-response analysis of both inhibitors. As
shown in Fig. 4B, Gö 6976 produced a marked inhibition of NF-
B
activation at concentrations as low as 0.5 µM. However, GF 109203X
exhibited little inhibitory effect on LPS- and paclitaxel-induced
NF-
B activation. In particular, compared with LPS-induced NF-
B
activation, paclitaxel-induced NF-
B activation was more resistant to
GF 109203X. On the other hand, because previous reports showed that the
mitogen-activated protein kinase pathway is important in the activation
of NF-
B (Nakano et al., 1998
), we also investigated the effect of
MEK inhibitor (PD 98059) and p38 kinase inhibitor (SB 203580) on
NF-
B activation by paclitaxel or LPS. PD 98059 inhibited LPS-induced NF-
B activation, although SB 203580 was still inactive. In contrast, paclitaxel-induced NF-
B activation was not affected by either PD
98059 or SB 203580. In addition, to determine whether oncogenic Raf is required to activate NF-
B, we performed in vitro Raf-1 kinase
assay by phosphorylation of MEK-1 (Fig. 4C). Contrary to the idea that
Raf-1 is involved in NF-
B activation (Flory et al., 1998
), neither
LPS nor paclitaxel activated Raf-1 detectably.
|
, conventional isotype; PKC-
, novel isotype; PKC-
, atypical
isotype) of each isotype. We were unable to detect a characteristic
translocation noted with PKC activation. Instead, the prominent LPS-
and paclitaxel-induced shifts in the electrophoretic mobility of PKCs
were observed when SDS-solubilized membrane and cytosolic fractions
were analyzed. Exposure of the cells to 1 µg/ml LPS for 30 min
induced the electrophoretic mobility shift of PKC-
, and -
in
cytosolic and membrane fraction (Fig. 5A,
lane 2). In contrast, no apparent changes in gel mobility were observed
with PKC-
of either cytosolic or membrane fraction. Paclitaxel
treatment also showed a similar shift in gel mobility of PKC-
and
especially PKC-
(Fig. 5A, lanes 3-5). However, the kinetics of
shift in gel mobility of cytosolic PKC-
by paclitaxel was slower
than those of conventional PKCs. The band shift of PKC-
was maximal
at 30 min and then declined, whereas the band shift of PKC-
was
induced after 30 min through 2 h. Interestingly, paclitaxel
pretreatment before LPS activation resulted in inhibition of
LPS-induced shift in gel mobility of conventional PKCs but had no
effect on the shift in gel mobility of PKC-
(Fig. 5A, lanes 6 and
7), suggesting that PKC-
is not involved in NF-
B activation by
paclitaxel. To confirm the effect of paclitaxel on PKC activation, we
measured the PKC activity of cytosolic and membrane fraction after
immunoprecipitation using PKC-
and PKC-
antibodies. Figure 5B
shows that, as measured by the incorporation of
[
-32P]ATP into histone, PKC activity was
well correlated with the supershift of PKC. In addition, we found that
treatment with paclitaxel for 18 h caused the complete
down-regulation of PKC
but had little effect on PKC-
. (Fig. 5C).
Therefore, our results indicated that conventional PKCs, such as
PKC-
, but not -
and -
, were involved in the regulation of
paclitaxel-induced NF-
B activation.
|
| |
Discussion |
|---|
|
|
|---|
Paclitaxel, like LPS, was able to stimulate the translocation of
primarily the 50- and 65-kDa heterodimers of NF-
B to the nucleus in
70Z/3 pre-B cells. Paclitaxel-induced NF-
B activation reached a
maximal level after 30 min of treatment and maintained this levels for
2 h or more. However, LPS-induced NF-
B activation was
completely inhibited by pre-exposing cells to paclitaxel. Many reports
have recently suggested that LPS and paclitaxel share a common
receptor/signaling complex (Byrd et al., 1999
; Lee et al., 2000b
). In
addition, CD18, which participates in LPS-induced binding and signal
transduction, was identified as a paclitaxel-binding protein (Bhat et
al., 1999
). Therefore, the suppressive effect of paclitaxel on LPS
signaling seems to be attributable to the desensitization of NF-
B
signaling. In addition, we can not exclude the possibility that the
ability of paclitaxel to activate NF-
B may induce immunoregulatory
and cytotoxic cytokines, which in turn may contribute to its
immunosuppressive effects.
Paclitaxel specifically enhanced IKK-
activity but had no
stimulatory effect on IKK-
activity, suggesting that IKK-
is the
principal kinase involved in paclitaxel-induced I
B phosphorylation. In unstimulated cells, IKK-
inhibited the constitutive I
B kinase activity of IKK-
(O'Mahony et al., 2000
). Surprisingly, LPS failed to stimulate IKK-
activity. IKK-i was recently shown to
be an LPS-inducible I
B kinase that may play a special role in the
immune response (Shimada et al., 1999
). Thus, IKK-i, but not
IKK-
or IKK-
, may be involved in stimulating the translocation of
NF-
B to the nucleus or in enhancing its DNA binding activity.
Because Raf-1 was initially presented as I
B kinase (Li and Sedivy,
1993
) and was reported to be involved in LPS signaling (Hambleton et al., 1995
; Lee et al., 1996
), we analyzed the effect of paclitaxel on
Raf-1 kinase. Paclitaxel has been also known to induce apoptosis that
is associated with Raf-1 (Blagosklonny et al., 1996
). However, in the
present study, paclitaxel exhibited no effect on Raf-1 kinase activity
in 70Z/3 pre-B cells. This finding is consistent with the reported
results that immune complexes of
-Raf-1:ER did not phosphorylate a
purified GST-I
B-
fusion protein (Hambleton et al., 1995
).
Furthermore, it has been shown recently that oncogenic Raf can activate
NF-
B, not through induced nuclear translocation, but through the
activation of the transcriptional function of the NF-
B RelA/p65
subunit (Wang and Baldwin, 1998
). On the other hand, subsequent work
has pointed to an indirect mechanism involving an autocrine pathway
that ultimately uses stress-activated protein kinase/p38-dependent mechanisms (Troppmair et al., 1998
). These data suggest a role for Raf-1 far more distal to the phosphorylation of
I
B.
Many results have demonstrated a critical role for the PKC isoforms in
the NF-
B pathway at the level of IKK-
activation and I
B
degradation. In particular, it has been reported that LPS-induced
NF-
B activation was inhibited by antisense oligonucleotides for
PKC-
, -
I, and -
, but not -
(Chen et al., 1998
). In this study, a highly selective cell-permeable conventional PKC inhibitor, Gö 6976, inhibited LPS-induced NF-
B activation, indicating
that conventional PKC activation is an obligatory event in the
LPS-mediated regulation of NF-
B activation in 70Z/3 cells. A similar
effect, although less pronounced, is observed with the MEK inhibitor PD 98059. This result suggests that extracellular signal-regulated kinase pathway plays, in part, an important role in the
LPS-induced NF-
B activation. However, the p38 mitogen-activated
protein kinase inhibitor SB 203580 had no effect on LPS-induced NF-
B
activation. The results suggested by others (Garrett et al., 1999
), in
which LPS-induced NF-
B activation was not dependent on activation of p38, showed consistency with our results. We also showed that Gö
6976 markedly suppressed NF-
B activation by paclitaxel. However, both PD 98059 and SB 203580 had little effect on paclitaxel-induced NF-
B activation, implying that paclitaxel signaling may diverge further downstream from LPS pathway despite their sharing a common receptor/signaling complex, such as the stimulation of Rho. In the case
of Rho, two different signal transduction pathways exist, leading to
the stimulation of Rho and subsequent stress fiber formation in Swiss
3T3 fibroblasts (Peppelenbosch et al., 1995
). In Rac-dependent pathway,
Rho is activated by arachidonic acid metabolites produced when Rac1 is
activated by phosphatidylinositol 3-kinase, which is not necessary in
Rac-independent pathways.
Interestingly, paclitaxel had no effect on the amount of distribution
of PKC in cultured pre-B cells but induced a change in the mobility of
PKC on SDS-PAGE. Despite few published direct demonstration, it is
assumed that an increase in the phosphorylation of PKCs upon cell
stimulation could be a marker PKC activation (Heidenreich et al., 1990
;
Acs et al., 1997
). In addition, we identified that, as measured by the
incorporation of [
-32P]ATP into histone, PKC
activity was well correlated with the supershift of PKC. In our
studies, PKC-
, but not -
or -
, was found to be involved in the
regulation of paclitaxel-induced NF-
B activation in 70Z/3 pre-B
cells. This demonstrates that conventional PKCs may contribute to
NF-
B activation by paclitaxel through the activation of the IKK-
.
Trushin et al. (1999)
have demonstrated that IKK-
is the target for
PKC. Moreover, IKK-
associates in vitro with PKC
but is unable to
interact with Raf-1 (Lallena et al., 1999
). In addition, our result
suggest that PKC-
is most likely not directly involved in the
regulation of paclitaxel-induced NF-
B, although the recombinant
PKC
was known to directly phosphorylate IKK-
in vitro (Sanz et
al., 1999
). On the other hand, LPS-induced phosphorylation and
degradation of I
B
and NF-
B activation were not affected by
dominant negative PKC-
overexpression (St-Denis et al., 1998
),
suggesting the involvement of PKC isoforms different from those in
paclitaxel-induced signaling.
Activation-induced cell death, a form of apoptosis, is the major
mechanism by which immune cell homeostasis is maintained (Russell
1995
). When pre-B cells were treated with paclitaxel, we observed the
activation of nuclear NF-
B DNA binding complexes similar to those
seen with LPS stimulation. However, under these conditions, cells
experience growth arrest and subsequently undergo apoptosis, giving
NF-
B a proapoptotic role in activation-induced cell death. Moreover,
stimulation of pre-B cells with LPS concomitant with paclitaxel
treatment does not rescue these cells, suggesting that the
paclitaxel-induced NF-
B signal is dominant in the induction of cell
death under these conditions. Lin et al. (1999)
reported the
paradoxical role of NF-
B in apoptosis, functioning as both a
proapoptotic and antiapoptotic regulatory factor within a single cell
type. Therefore, our results lead to the conclusion that the context of
a NF-
B-inducing stimulus is a critical determinant in the outcome of
a signal that can lead to proliferation, differentiation, or death.
In summary, we show that paclitaxel, like LPS, causes the translocation
of NF-
B through classical PKC isotype-dependent IKK-
activation,
which in turn might desensitize spleen cells toward incoming
LPS-induced signal in murine 70Z/3 pre-B cells.
| |
Footnotes |
|---|
Received June 6, 2000; Accepted October 20, 2000
Send reprint requests to: Dr. Michael Lee, Laboratory of Cellular Oncology, National Cancer Institute, NIH, Bldg. 37, Room 3E-08, 9000 Rockville Pike, Bethesda, MD 20892. E-mail: leemi{at}mail.nih.gov
| |
Abbreviations |
|---|
LPS, lipopolysaccharide;
NF-
B, nuclear
factor-
B;
IKK, I
B kinase;
PKC, protein kinase C;
PAGE, polyacrylamide gel electrophoresis;
MEK, mitogen-activated protein
kinase kinase;
GST, glutathione S-transferase;
EMSA, electrophoretic mobility shift assay.
| |
References |
|---|
|
|
|---|
B by membrane shuttle kinase MEKK1, a signaling pathway critical for transformation.
Proc Natl Acad Sci USA
97:
4615-4620
, -
I, or -
but not -
inhibit lipopolysaccharide-induced nitric oxide synthase expression in RAW 264.7 macrophages: Involvement of a nuclear factor
B-dependent mechanism.
J Immunol
161:
6206-6214
B by antineoplastic agents.
J Biol Chem
272:
14914-14920
B and human immunodeficiency virus type 1 replication in T lymphocytes.
J Virol
72:
2788-2794
, in cultured fetal chick neurons.
J Biol Chem
265:
15076-15082
B kinase
by protein kinase C isoforms.
Mol Cell Biol
19:
2180-2188
B activation during the early stage of B cell development.
Toxicol Lett
114:
173-180[Medline].
B transcription factor by dissociating the cytoplasmic NF-
B-I
B complex.
Proc Natl Acad Sci USA
90:
9247-9251
B functions a both a proapoptotic and antiapoptotic regulatory factor within a single cell type.
Cell Death Differ
6:
570-582[Medline].
B kinase
and
by two upstream kinases, NF-
B-inducing kinase and mitogen-activated protein kinase/ERK kinase kinase-1.
Proc Natl Acad Sci USA
95:
3537-3542
B kinase by mitogen-activated protein kinase kinase kinase 1 and NF-
B-inducing kinase.
Mol Cell Biol
18:
7336-7343
B kinase a (IKK
)-IKK
complex is directional: IKK
regulates IKK
under both basal and stimulated conditions.
Mol Cell Biol
20:
1170-1178
B translocation in murine macrophages.
Infect Immunol
64:
878-884[Abstract].
B activation by I
B-
.
EMBO J
12:
4685-4695[Medline].
B activation.
EMBO J
18:
3044-3053[Medline].
B
is a target for the mitogen-activated 90 kDa ribosomal S6 kinase.
EMBO J
16:
3133-3144[Medline].
B kinases.
Int Immunol
11:
1357-1362
modulates lipopolysaccharide-induced functions in a murine macrophage cell line.
J Biol Chem
273:
32787-32792
B
phosphorylation by PKC- and Ca2+-dependent signal transduction pathways.
J Immunol
155:
4685-4691[Abstract].
B kinase and NF-
B in T lymphocytes.
J Biol Chem
274:
22923-22931
B-dependent transcription by tumor necrosis factor-
is mediated through phosphorylation of RelA/p65 on serine 529.
J Biol Chem
273:
29411-29416
B proteins: structure, function and regulation.
Semin Cancer Biol
8:
75-82[Medline].
B kinase-
: NF-
B activation and complex formation with I
B kinase-
and NIK.
Science (Wash DC)
278:
866-870
B 50 kDa subunit and loss of the 105 kDa precursor in RAW264 macrophage-like cells.
J Biol Chem
268:
17233-17239This article has been cited by other articles:
![]() |
J. S. Kang, Y. D. Yoon, M. H. Han, S.-B. Han, K. Lee, K. H. Lee, S.-K. Park, and H. M. Kim Glabridin Suppresses Intercellular Adhesion Molecule-1 Expression in Tumor Necrosis Factor-{alpha}-Stimulated Human Umbilical Vein Endothelial Cells by Blocking Sphingosine Kinase Pathway: Implications of Akt, Extracellular Signal-Regulated Kinase, and Nuclear Factor-{kappa}B/Rel Signaling Pathways Mol. Pharmacol., March 1, 2006; 69(3): 941 - 949. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Bava, V. T. Puliappadamba, A. Deepti, A. Nair, D. Karunagaran, and R. J. Anto Sensitization of Taxol-induced Apoptosis by Curcumin Involves Down-regulation of Nuclear Factor-{kappa}B and the Serine/Threonine Kinase Akt and Is Independent of Tubulin Polymerization J. Biol. Chem., February 25, 2005; 280(8): 6301 - 6308. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||