|
|
|
|
Vol. 59, Issue 3, 434-441, March 2001
Departments of Molecular Biology (Y.Z., K.B.T., X.L., R.S.A., D.J.B.) Bioinformatics (D.M., L.V.), Renal Pharmacology (H.-L.W., G.M.D., I.J.M., J.P.H., L.R.F.), Clinical Cellular Biochemical Pathology (R.B., J.A., L.A.T.), Gene Expression Science (N.C.H.), Pulmonary Pharmacology (H.M.S.), and Immunology (C.M.D.), SmithKline Beecham Pharmaceuticals, King of Prussia, Pennsylvania; and Department of Vascular Biology (S.W.), SmithKline Beecham Pharmaceuticals, New Frontiers Science Park, Harlow, Essex, England
| |
Abstract |
|---|
|
|
|---|
Using a genomics-based reverse pharmacological approach for screening
orphan G-protein coupled receptors, we have identified and cloned a
novel high-affinity histamine receptor. This receptor, termed AXOR35,
is most closely related to the H3 histamine receptor, sharing 37%
protein sequence identity. A multiple responsive element/cyclic AMP-responsive element-luciferase reporter assay was used to identify histamine as a ligand for AXOR35. When transfected into human embryonic
kidney 293 cells, the AXOR35 receptor showed a strong, dose-dependent
calcium mobilization response to histamine and H3 receptor agonists
including imetit and immepip. Radioligand binding confirmed that the
AXOR35 receptor was a high-affinity histamine receptor. The
pharmacology of the AXOR35 receptor was found to closely resemble that
of the H3 receptor; the major difference was that
(R)-
-methylhistamine was a low potency agonist of the AXOR35 receptor. Thioperamide is an antagonist at AXOR 35. Expression of AXOR35 mRNA in human tissues is highest in peripheral blood mononuclear cells and in tissues likely to contain high concentrations of blood cells, such as bone marrow and lung. In situ hybridization analysis of a wide survey of mouse tissues showed that mouse AXOR35 mRNA is selectively expressed in hippocampus. The identification and
localization of this new histamine receptor will expand our understanding of the physiological and pathological roles of histamine and may provide additional opportunities for pharmacological
modification of these actions.
| |
Introduction |
|---|
|
|
|---|
Histamine is known to produce
effects on multiple organ systems, including contraction of smooth
muscle, stimulation of gastric acid secretion and cardiac
contractility, and inhibition of autonomic transmitter release. Three
distinct G-protein-coupled receptors, designated H1, H2, and H3, have
been identified for histamine. Although the existence of these
receptors has been established pharmacologically for 20 years, the H1
and H2 receptors were cloned in 1991 (Gantz et al., 1991
; Yamashita et
al., 1991
), and the H3 receptor remained unidentified until last year
(Lovenberg et al., 1999
). Interestingly, the genes encoding the H1, H2,
and H3 receptors share less protein sequence identity with each other than with other biogenic amine receptor family members, suggesting that
these histamine receptors evolved from different ancestor sequences.
Although lacking in significant overall sequence homology, the
histamine receptors apparently acquired crucial elements for the
recognition of histamine during their evolution. Over the last decade,
there is a growing body of pharmacological evidence suggesting the
possibility of further histamine receptor heterogeneity, particularly
with respect to H3-mediated responses (West et al., 1990
; Raible et
al., 1994
; Yanai et al., 1994
; Leurs et al., 1996
; Harper et
al., 1999
).
In the present communication, we report the identification of a novel histamine receptor, AXOR35, and its initial pharmacological characterization. Our data showed that although the AXOR35 receptor has many properties in common with the H3 receptor, there are also clear differences between the two receptors in terms of their pharmacology and tissue distribution.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
The burimamide and improgan were synthesized by
colleagues in the Department of Medicinal Chemistry, SmithKline Beecham
Pharmaceuticals (King of Prussia, PA). Imetit, immepip,
N-
-methylhistamine (N-
-MeHA), (R)-
-methyl-histamine [(R)-
-MeHA]
HTMT dimaleate
(6-[2-(4-imidazolyl)ethylamino]-N-(4-trifluoromethylphenyl)heptanecarboxamide) and iodophenpropit were purchased from Tocris (Ballwin, MO). Histamine, dimaprit, thioperamide, clozapine, cimetidine, and pyrilamine were from
RBI (Natick, MA).
Cloning of Human AXOR35. Full-length cloning was performed using Marathon-ready cDNA from human bone marrow (Clontech, Palo Alto, CA). PCR was performed using gene specific primers corresponding to the putative coding sequence of the gene from an unfinished genomic sequence (GenBank accession number AC007922), and AP adaptor primers (Clontech). The complete AXOR35 cDNA was isolated from human bone marrow and leukocytes by RT-PCR using the following primers (the underlined nucleotides are start and stop codons): 5' ATGCCAGATACTAATAGCACA 3' and 5' TTAAGAAGATACTGACCGACT 3'. The product was cloned into pCR2.1 (Invitrogen, Carlsbad, CA) and fully sequenced.
The mouse AXOR35 probe used for in situ hybridization studies was obtained by screening a mouse cDNA library at low stringency using human AXOR35 cDNA as a probe. The partial cDNA is 0.5 kilobases and 68% identical to human AXOR35. For mammalian expression and functional analysis, a full-length human AXOR35 ORF was subcloned into the pCDN expression vector (Aiyar et al., 1994Luciferase Reporter Assay.
Transient transfection of HEK293
cells and reporter assays were performed as described previously
(Fitzgerald et al., 1999
). The reporter vector contained the luciferase
gene under the control of a promoter consisting of three multiple
response elements (MRE) and a cAMP response element (CRE).
Radioligand Binding Assay.
Membranes were prepared according
to Nambi et al. (1994)
from Cos-1 cells transiently transfected with
pCDN/AXOR35 or pCDN using Lipofectamine plus (Life Technologies,
Gaithersburg, MD). Saturation binding was performed with 2 to 60 nM
[3H]histamine (Amersham Pharmacia Biotech,
Piscataway, NJ) and 22 µg of membrane protein. Histamine (10 µM)
was used to define nonspecific binding. Competition assays were
performed using 40 nM [3H]histamine and 9 µg
of membrane protein. Ninety-percent of the total binding signal was
specific. Assay buffer consisted of 50 mM Tris-HCl, pH 7.5, and 10 mM
MgCl2. Assays were initiated by addition of
membranes in a final volume of 50 µl. Assays were incubated for
1 h at 30°C and then vacuum-filtered and rinsed on a Brandel
cell harvester through Whatman GF/C filters presoaked in 0.3% polyethylenimine.
Calcium Mobilization Assays.
HEK293 cells were transiently
transfected as described previously (Fitzgerald et al., 1999
) with 4 µg of the chimeric G-protein Gqi5 (Conklin et al., 1993
) and 11 µg
of AXOR35 or pCDN. Calcium mobilization assays were performed as
described previously (Fitzgerald et al., 2000
) with a minor
modification. Instead of sulfinpyrazone, 2.5 mM probenecid was used to
inhibit organic anion transport.
Quantitative PCR (TaqMan Analysis).
Human tissues of four
different persons (two men, two women, except prostate) were generously
provided by Dr. R. Ravid in Netherland's Brain Bank (Amsterdam, the
Netherlands), or purchased as preprepared RNA from Biochain (San
Leandro, CA), CLONTECH (Palo Alto, CA). All samples were anonymous and
were obtained under conditions of informed consent. The tissue samples
and RNA samples were stored at
80°C. Poly(A)+
RNA was isolated, reverse transcribed, and specific gene mRNA levels
were measured in each sample using TaqMan analysis as described previously (Sarau et al., 1999
). Primers and probe for AXOR35 were as
follows: forward primer, 5'-CTGTGTCTTATAGAACTCAACATACTGGG-3', reverse
primer, 5'-CACTAAGAACCACAGCACCC-3' and TaqMan probe
6FAM-ACGGCCACCATCAGAGTAAACAATCTTCAAG-TAMRA
Tissue Preparation and in Situ Hybridization.
Male and
female adult CD-1 mice (Charles River, Raleigh, NC) were dissected and
tissues were collected, embedded in Tissue-Tek OCT (optimal cutting
temperature) embedding media (Sakura Finetek USA Inc., Torrance, CA),
and rapid-frozen in liquid nitrogen-cooled isopentane or liquid
nitrogen, then stored at
80°C until used. Cryosections (5-7 µm)
were prepared at
25°C (Leica CM 3050; Leica Microsystems, Inc.,
Deerfield, IL) and mounted on adhesive-coated slides (Instrumedics,
Inc., Hackensack, NJ). The in situ hybridization method used was a
modification of the procedures of Braissant et al. (1996)
and Yang et
al. (1999)
.
| |
Results |
|---|
|
|
|---|
Cloning and Sequence Analysis of the AXOR35 Receptor.
As
part of a large genomics-based program to identify and clone orphan
G-protein-coupled receptors as novel drug targets (Stadel et al.,
1997
), we identified an unfinished human genomic sequence (GenBank
accession number AC007922) encoding a putative partial orphan 7 transmembrane receptor. After the use of a series of molecular cloning
techniques, a full-length cDNA was isolated from human bone marrow and
peripheral blood mononuclear cells (PBMC) and named AXOR35. The cDNA
encodes a 390-amino-acid polypeptide with 36.6% identity to the human
H3 receptor (Fig. 1A), and only 18.9%
and 18.1% identity to H1 and H2 receptors, respectively. During the
preparation of this article, Oda et al. (2000)
reported a human
G-protein-coupled receptor with a sequence (GPRv53) nearly identical to
the AXOR35 receptor, differing by only three amino acids: V138
A,
R206
H and R253
Q. Our sequence matches 100% with the genomic
sequence (GenBank accession number AC007922).
|
Luciferase Reporter Assay of Cells Expressing the AXOR35
Receptor.
A MRE/CRE-directed luciferase reporter assay was used to
identify histamine as the natural ligand for AXOR35. This assay has previously been shown to detect responses from Gi-, Gs- or Gq-coupled receptors (Fitzgerald et al., 1999
). Because the AXOR35 receptor closely resembles the H3-histamine receptor, we first tested histamine and H3 agonists for their ability to induce a functional response in
the cells transiently cotransfected with the reporter gene and AXOR35
or vector control. Shown in Fig. 2, in
HEK293 cells transfected with the AXOR35 receptor cDNA, histamine
inhibited forskolin-stimulated luciferase activity consistent with an
action mediated through a Gi-coupled receptor. Histamine had no effect on pCDN-transfected cells, demonstrating that its effect was
specifically mediated via the AXOR35 receptor. The H3 selective
agonists immepip and N-
-methylhistamine also inhibited
luciferase activity. Serotonin, dopamine, and histidine had no
significant inhibitory effect on AXOR35 cDNA-transfected cells
compared with pCDN-transfected cells. Additionally, norepinephrine (10 µM) and epinephrine (10 µM) (not shown) stimulated luciferase
activity to 800% and 1300% over forskolin-stimulation, respectively,
in both AXOR35 and pCDN-transfected cells, indicating the presence of
an endogenous
2-adrenergic receptor in HEK293 cells (Fitzgerald et al., 1999
).
|
[3H]Histamine Binding Studies of the AXOR35
Receptor.
Analysis of [3H]histamine
binding to membranes from COS-1 cells transiently transfected with
AXOR35 cDNA showed high-affinity and saturable binding with
Kd and Bmax
values of 17.6 nM and 1 pmol/mg of protein, respectively (Fig.
3). No binding signal was detected in
membranes prepared from COS cells transiently transfected with the
control vector, pCDN. Competition binding studies were performed to
determine the affinities of the histaminergic agonists and antagonists.
As shown in Fig. 4A, histamine and the
H3-receptor agonists imetit, immepip, N-
-MeHA, and
(R)-
-MeHA competed for [3H]histamine binding with
Ki values of 17 ± 4, 6 ± 1, 23 ± 2, 149 ± 38, and 348 ± 63 nM, respectively. The
H2 agonist, dimaprit and the H1 agonist, HTMT dimaleate had
Ki values of 677 ± 79 and 1229 ± 142 nM, respectively. In addition, the H3 histamine
antagonists, iodophenpropit, burimamide, and thioperamide,
competed for [3H]histamine binding with
Ki values of 18 ± 4, 160 ± 29, and 519 ± 96 nM, respectively (Fig. 4B). Clozapine, an atypical
antipsychotic that blocks both
5-hydroxytryptamine2A/C and
D2 dopamine receptors, showed modest affinity
(Ki = 693 ± 89 nM). Improgan, a novel
histamine receptor agonist, which apparently does not interact with any of the known histamine receptors, had low affinity
(Ki = 6 µM) at AXOR 35. The H1
antagonist, pyrilamine (mepyramine) and the H2 antagonist, cimetidine,
had IC50 values greater than 100 µM.
|
|
Calcium Mobilization Analysis of Cells Expressing the AXOR35
Receptor.
A calcium mobilization assay was established using a
fluorometric imaging plate reader to obtain EC50
values in response to agonist treatment. The chimeric G-protein,
Gqi5 (Conklin et al., 1993
), was required to
permit the AXOR35 receptor to couple to calcium mobilization. The
chimeric protein consisted of the G
q subunit in which the five
carboxyl-terminal residues are replaced with the corresponding
carboxyl-terminal residues from
G
i2. Histamine, imetit,
immepip, N-
-MeHA, and (R)-
-MeHA induced
calcium mobilization responses with EC50 values
of 19 ± 3 nM, 15 ± 2 nM, 29 ± 2 nM, 56 ± 4 nM,
and 147 ± 16 nM, respectively, in cells cotransfected with the
AXOR35 receptor and Gqi5 (Fig. 4C). HTMT (10 uM), a histamine
derivative, did not significantly induce calicum mobilization in cells
transfected with AXOR35 and Gqi5. The H3 antagonists, iodophenpropit,
burimamide and thioperamide were tested in the calcium mobilization
assay to determine whether they were behaving as agonists or
antagonists at AXOR35. Iodophenpropit (10 µM) and burimamide (10 µM) showed partial agonism in AXOR35/Gqi5-transfected cells, whereas
thioperamide (10 µM) showed no activity in the calcium mobilization
assay. Furthermore, thioperamide dose dependently shifted the histamine
dose-response curve at AXOR35 with a KB value of 132 nM (r2 = 0.94; slope = 0.78). These data demonstrate that thioperamide is acting as an
antagonist at AXOR35. Cells transfected with pCDN and
Gqi5 or AXOR35 receptor alone showed no response
to histamine or the other compounds tested.
Expression of AXOR35 Receptor.
To investigate the
physiological role of the AXOR35 receptor, we profiled the tissue
distribution of this receptor in a range of human tissues using RT-PCR
based TaqMan analysis (Fig. 5A). Expression of AXOR35 receptor mRNA was most abundant in PBMC, and
moderately abundant in bone marrow and lung. It was expressed at a high
level in human neutrophils (Fig. 5B). Interestingly, as shown in Fig.
5C, the level of AXOR35 receptor expression was 3-, 11-, and 23-fold
higher in resting mononuclear cells, CD4+ T
cells, and CD8+ T cells than in the activated
cells. A very low level of expression was detected in resting and
activated CD19+ B cells and resting
CD14+ monocytes.
|
|
| |
Discussion |
|---|
|
|
|---|
Using a genomics-based approach, we identified and cloned a novel
histamine receptor. Pharmacologically, the AXOR35 receptor closely
resembles the H3 receptor, because selective H3 agonists like imetit
and immepip are potent agonists of AXOR35. Furthermore, the mode of
signal transduction seems to be identical for both H3 and AXOR35
receptors, because each couples to the
G
i G-protein subtype and
subsequently inhibits adenylyl cyclase. Consistent with the
G
i coupling,
histamine-induced calcium mobilization responses of the AXOR35 receptor
required cotransfection with Gqi5.
The major difference noted in the pharmacology of AXOR35 and H3
histamine receptors is the low potency and affinity of
(R)-
-MeHA to the AXOR35 receptor compared with the H3
receptor. This was observed in both functional (calcium mobilization)
and radioligand binding assays, where (R)-
-MeHA was
8-fold less potent and 20-fold lower affinity than histamine,
respectively (Figs. 3 and 5; Table 1). In
contrast, (R)-
-MeHA is a potent inhibitor
(IC50, 1 nM) of forskolin-induced cAMP formation
in cells expressing the human H3 receptor (Lovenberg et al., 1999
).
Furthermore, (R)-
-MeHA had substantially higher binding
affinity (Kd = 0.15 nM) than histamine
(Ki = 3 nM) for the H3 receptor. In a
variety of functional and radioligand binding assays using native H3
receptors from various animal species, (R)-
-MeHA was
consistently shown to have equal or greater potency than histamine
(Arrang et al., 1987
; West et al., 1990
) (Table 1). The low potency of
this agonist in our assays clearly shows that the AXOR35 receptor has a
pharmacology that differs from the H3 receptor. Very recently, Oda et
al. (2000)
also observed the low relative potency of
(R)-
-MeHA (17- and 94- fold weaker than histamine in
functional and binding assays, respectively) at a novel histamine
receptor virtually identical AXOR35.
|
Another potential difference between AXOR35 and the H3 receptor is the
lower potency of thioperamide at AXOR35. Our findings in both
functional (KB = 132 nM) and binding assays
(Ki = 519 nM) show thioperamide to have
over 10-fold lower affinity than reported in functional
(KB= 4 nM, Arrang et al., 1987
;
IC50 = 20 nM, Lovenberg et al., 1999
) or
radioligand binding assays (Ki = 20 nM,
Lovenberg et al., 1999
) measuring affinity at native or recombinant
H3 receptors. Assessment of the pharmacological significance of this
potency difference will require the comparison of potencies for a
structurally diverse series of antagonists in parallel assays using
AXOR35 and H3 receptors.
Several other descriptions of H3 receptor heterogeneity (West et al.,
1990
; Leurs et al., 1996
; Harper et al., 1999
) have been reported.
However, in each of these reports, the putative H3 subtypes did not
differ substantially in their affinity for (R)-
-MeHA, and
heterogeneity was based on differential affinity of H3 antagonists.
Hence, it seems that the H3 receptor heterogeneity observed by these
authors does not involve a contribution of the AXOR35 receptor. The
existence of a non-H1, non-H2, and non-H3-histamine receptor has been
proposed based on the ability of cimetidine and the cimetidine-like
compound improgran to induce antinociception that is not mediated
through known histamine receptors (Li et al., 1996
, 1997
). However,
improgan does not stimulate AXOR35 and competes very weakly for
[3H]histamine binding to AXOR35, indicating
that it is not likely to be the receptor linked to antinociception.
Another interesting non-H1, non-H2, or non-H3 receptor is the HTMT
receptor. HTMT, a derivative of histamine, is a potent
immunosuppressive agent that stimulates H1, H2, and HTMT receptors in
lymphocytes (Khan et al., 1986
). AXOR35, like the HTMT receptor (Qui et
al., 1993
), is expressed in lymphocytes and neutrophils. However,
AXOR35 does not seem to be the HTMT receptor. Although HTMT has modest
affinity at AXOR35, HTMT does not induce calcium mobilization in
AXOR35/Gqi5-transfected cells. In addition, thioperamide, which does
not antagonize the HTMT receptor (Qui et al., 1993
), behaves as an
antagonist at AXOR35.
Raible et al. (1994)
characterized a novel histamine receptor on human
eosinophils that mediated calcium mobilization. This histamine receptor
had pharmacological characteristics similar to those of the AXOR35
receptor, with (R)-
-MeHA being about 30-fold less potent
than histamine. Burimamide, generally regarded as an H3 antagonist,
showed partial agonist activity in their assay; interestingly, we found
that burimamide activates the AXOR35 receptor in our calcium
mobilization assay (data not shown), providing another parallel between
the native histamine receptor on human eosinophils and the AXOR35
receptor. Although burimamide was reported to have high affinity
for the H3 receptor (Alves-Rodrigues et al., 1998
; West et al.,
1999
), there is no report of agonist or partial agonist activity
in H3 models. Our data showing expression of AXOR35 mRNA in peripheral
blood mononuclear cells is consistent with its involvement in
eosinophil calcium mobilization. Oda et al. (2000)
demonstrated the
expression of their novel histamine receptor in eosinophils.
The AXOR35 receptor was found to be predominantly expressed in human
peripheral blood mononuclear cells, whereas the H3 receptor is
expressed only in brain (Lovenberg et al., 1999
). Although in situ
hybridization revealed specific expression of the mouse AXOR35 receptor
in restricted regions of mouse hippocampus, the in situ hybridization
of the H3 receptor in rat brain showed high levels of mRNA in thalamus,
ventromedial hypothalamus, and caudate nucleus (Lovenberg et al.,
1999
). Therefore, the distribution of the AXOR35 mRNA observed in the
present study clearly differed from that of the human H3 receptor.
The expression of the AXOR35 receptor in PBMC and resting mononuclear
cells, CD4+/CD8+ T cells
suggests that this receptor may play a role in immune modulation.
Histamine signaling through the H1 receptor is reported to have a
stimulatory effect on the immune system, whereas signaling through the
H2 receptor has an inhibitory effect (Beer et al., 1984
; Falus et al.,
1992
). H3 receptor agonists were found to inhibit TNF release by
stimulating the release of an anti-inflammatory cytokine, IL10 (Sirois
et al., 2000
). Here we identified a new histamine receptor expressed on
immune cells, suggesting that some of the effects previously associated
with H1, H2, and H3 histamine receptors may need to be reevaluated. The
observation that AXOR35 message RNA is expressed at higher levels in
resting compared with activated leukocytes is currently under further investigation.
The identification of an additional histamine receptor will help to explain many biological actions of histamine and may resolve some of the inconsistencies in reports of the pharmacology of histamine receptor agonists and antagonists. The clear pharmacological differences observed thus far between the AXOR35 and H3 receptors suggest that selective agonists and/or antagonists can be identified. With these pharmacological tools, it will be possible to differentiate the functional roles of these receptors in both normal physiological regulation and disease pathology.
| |
Acknowledgments |
|---|
We thank P. Nuthulaganti, J. J. Foley, and P. T. Buckley for many calcium mobilization studies; Dr. Paul R. Murdock and Lei Chuang for preparing TaqMan samples; and members of the sequencing core facility in the Department of Genetic Technology for DNA sequencing. We are grateful to Drs. Christine M. Debouck and David Brooks for their support and advice on this project.
| |
Footnotes |
|---|
Received November 29, 2000; Accepted January 5, 2001
Send reprint requests to: Dr. Yuan Zhu, Department of Molecular Biology, SmithKline Beecham Pharmaceuticals, 709 Swedeland Road, PO Box 1539, King of Prussia, PA 19406. E-mail: yuan_zhu-1{at}sbphrd.com
| |
Abbreviations |
|---|
N-
-MeHA, N-
-methylhistamine;
(R)-
-MeHA, (R)-
-methylhistamine;
HTMT dimaleate, 6-[2-(4-imidazolyl)ethylamino]-N-(4-trifluoromethylphenyl)heptanecarboxamide;
HEK, human embryonic kidney;
MRE, multiple responsive element;
CRE, cAMP-responsive element;
RT, reverse transcription/transcriptase;
PCR, polymerase chain reaction;
PBMC, peripheral blood mononuclear cells;
pCDN, plasmid containing cylomegalovirus promoter, DHFB and Neo
selection markers.
| |
References |
|---|
|
|
|---|
, -
,-
in the adult rat.
Endocrinology
137:
354-366[Abstract].
-methylhistamine binding differ from that of rodents.
Eur J Pharmacol
377:
223-229[Medline].
-methylhistamine binding to rat tissues.
Jpn J Pharmacol
65:
107-112[Medline].This article has been cited by other articles:
![]() |
T. L. Sutton, A. Zhao, K. B. Madden, J. E. Elfrey, B. A. Tuft, C. A. Sullivan, J. F. Urban Jr., and T. Shea-Donohue Anti-Inflammatory Mechanisms of Enteric Heligmosomoides polygyrus Infection against Trinitrobenzene Sulfonic Acid-Induced Colitis in a Murine Model Infect. Immun., October 1, 2008; 76(10): 4772 - 4782. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Francis, S. Glaser, S. DeMorrow, E. Gaudio, Y. Ueno, J. Venter, D. Dostal, P. Onori, A. Franchitto, M. Marzioni, et al. Small mouse cholangiocytes proliferate in response to H1 histamine receptor stimulation by activation of the IP3/CaMK I/CREB pathway Am J Physiol Cell Physiol, August 1, 2008; 295(2): C499 - C513. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Damaj, C. B. Becerra, H. J. Esber, Y. Wen, and A. A. Maghazachi Functional Expression of H4 Histamine Receptor in Human Natural Killer Cells, Monocytes, and Dendritic Cells J. Immunol., December 1, 2007; 179(11): 7907 - 7915. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Morgan, B. McAllister, L. Cross, D. S. Green, H. Kornfeld, D. M. Center, and W. W. Cruikshank Histamine 4 Receptor Activation Induces Recruitment of FoxP3+ T Cells and Inhibits Allergic Asthma in a Murine Model J. Immunol., June 15, 2007; 178(12): 8081 - 8089. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. van Rijn, P. L. Chazot, F. C. Shenton, K. Sansuk, R. A. Bakker, and R. Leurs Oligomerization of Recombinant and Endogenously Expressed Human Histamine H4 Receptors Mol. Pharmacol., August 1, 2006; 70(2): 604 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Fryer, G. A. Reinhart, and T. A. Esbenshade Histamine in cardiac sympathetic Ganglia: a novel neurotransmitter? Mol. Interv., February 1, 2006; 6(1): 14 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. D. Lim, R. M. van Rijn, P. Ling, R. A. Bakker, R. L. Thurmond, and R. Leurs Evaluation of Histamine H1-, H2-, and H3-Receptor Ligands at the Human Histamine H4 Receptor: Identification of 4-Methylhistamine as the First Potent and Selective H4 Receptor Agonist J. Pharmacol. Exp. Ther., September 1, 2005; 314(3): 1310 - 1321. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gutzmer, C. Diestel, S. Mommert, B. Kother, H. Stark, M. Wittmann, and T. Werfel Histamine H4 Receptor Stimulation Suppresses IL-12p70 Production and Mediates Chemotaxis in Human Monocyte-Derived Dendritic Cells J. Immunol., May 1, 2005; 174(9): 5224 - 5232. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Slominski, D. J. Tobin, S. Shibahara, and J. Wortsman Melanin Pigmentation in Mammalian Skin and Its Hormonal Regulation Physiol Rev, October 1, 2004; 84(4): 1155 - 1228. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Thurmond, P. J. Desai, P. J. Dunford, W.-P. Fung-Leung, C. L. Hofstra, W. Jiang, S. Nguyen, J. P. Riley, S. Sun, K. N. Williams, et al. A Potent and Selective Histamine H4 Receptor Antagonist with Anti-Inflammatory Properties J. Pharmacol. Exp. Ther., April 1, 2004; 309(1): 404 - 413. [Abstract] [Full Text] |
||||
![]() |
P. Blandina, M. Efoudebe, G. Cenni, P. Mannaioni, and M. B. Passani Acetylcholine, Histamine, and Cognition: Two Sides of the Same Coin Learn. Mem., January 1, 2004; 11(1): 1 - 8. [Full Text] [PDF] |
||||
![]() |
K. Takeshita, K. Sakai, K. B. Bacon, and F. Gantner Critical Role of Histamine H4 Receptor in Leukotriene B4 Production and Mast Cell-Dependent Neutrophil Recruitment Induced by Zymosan in Vivo J. Pharmacol. Exp. Ther., December 1, 2003; 307(3): 1072 - 1078. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. KUNZMANN, P.-Y. MANTEL, J. G. WOHLFAHRT, M. AKDIS, K. BLASER, and C. B. SCHMIDT-WEBER Histamine enhances TGF-{beta}1-mediated suppression of Th2 responses FASEB J, June 1, 2003; 17(9): 1089 - 1095. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Hofstra, P. J. Desai, R. L. Thurmond, and W.-P. Fung-Leung Histamine H4 Receptor Mediates Chemotaxis and Calcium Mobilization of Mast Cells J. Pharmacol. Exp. Ther., June 1, 2003; 305(3): 1212 - 1221. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fernandez, F. Monczor, B. Lemos, C. Notcovich, A. Baldi, C. Davio, and C. Shayo Reduction of G Protein-Coupled Receptor Kinase 2 Expression in U-937 Cells Attenuates H2 Histamine Receptor Desensitization and Induces Cell Maturation Mol. Pharmacol., December 1, 2002; 62(6): 1506 - 1514. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gengs, H.-T. Leung, D. R. Skingsley, M. I. Iovchev, Z. Yin, E. P. Semenov, M. G. Burg, R. C. Hardie, and W. L. Pak The Target of Drosophila Photoreceptor Synaptic Transmission Is a Histamine-gated Chloride Channel Encoded by ort (hclA) J. Biol. Chem., October 25, 2002; 277(44): 42113 - 42120. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Gantner, K. Sakai, M. W. Tusche, W. W. Cruikshank, D. M. Center, and K. B. Bacon Histamine H4 and H2 Receptors Control Histamine-Induced Interleukin-16 Release from Human CD8+ T Cells J. Pharmacol. Exp. Ther., October 1, 2002; 303(1): 300 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Hough, J. W. Nalwalk, R. Stadel, H. Timmerman, R. Leurs, B. C. Paria, X. Wang, and S. K. Dey Inhibition of Improgan Antinociception by the Cannabinoid (CB)1 Antagonist N-(Piperidin-1-yl)-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (SR141716A): Lack of Obligatory Role for Endocannabinoids Acting at CB1 Receptors J. Pharmacol. Exp. Ther., October 1, 2002; 303(1): 314 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shin, E. Coates, N. J. Murgolo, K. L. Morse, M. Bayne, C. D. Strader, and F. J. Monsma Jr. Molecular Modeling and Site-Specific Mutagenesis of the Histamine-Binding Site of the Histamine H4 Receptor Mol. Pharmacol., July 1, 2002; 62(1): 38 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Uveges, D. Kowal, Y. Zhang, T. B. Spangler, J. Dunlop, S. Semus, and P. G. Jones The Role of Transmembrane Helix 5 in Agonist Binding to the Human H3 Receptor J. Pharmacol. Exp. Ther., May 1, 2002; 301(2): 451 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Riccio, C. Mattei, R. E. Kelsell, A. D. Medhurst, A. R. Calver, A. D. Randall, J. B. Davis, C. D. Benham, and M. N. Pangalos Cloning and Functional Expression of Human Short TRP7, a Candidate Protein for Store-operated Ca2+ Influx J. Biol. Chem., March 29, 2002; 277(14): 12302 - 12309. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wieland, G. Bongers, Y. Yamamoto, T. Hashimoto, A. Yamatodani, W. M. B. P. Menge, H. Timmerman, T. W. Lovenberg, and R. Leurs Constitutive Activity of Histamine H3 Receptors Stably Expressed in SK-N-MC Cells: Display of Agonism and Inverse Agonism by H3 Antagonists J. Pharmacol. Exp. Ther., December 1, 2001; 299(3): 908 - 914. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Liu, S. J. Wilson, C. Kuei, and T. W. Lovenberg Comparison of Human, Mouse, Rat, and Guinea Pig Histamine H4 Receptors Reveals Substantial Pharmacological Species Variation J. Pharmacol. Exp. Ther., October 1, 2001; 299(1): 121 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Hough Genomics Meets Histamine Receptors: New Subtypes, New Receptors Mol. Pharmacol., March 1, 2001; 59(3): 415 - 419. [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||