|
|
|
|
Vol. 59, Issue 3, 470-474, March 2001
Laboratory of Molecular and Biochemical Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai, Japan (T.F., H.I., N.M., M.I., K.K., A.N.); and the Department of Microbiology, Graduate School of Medicine, The University of Tokyo, Bunkyo-ku, Tokyo, Japan (S.K.)
| |
Abstract |
|---|
|
|
|---|
In an attempt to identify genes that can confer resistance to cisplatin, we introduced a yeast genomic library into Saccharomyces cerevisiae and selected for transformants that grew in the presence of a normally toxic concentration of cisplatin. Plasmids were rescued from the transformants and were analyzed for the presence of individual open reading frames that conferred resistance to cisplatin. We isolated two genes, CIN5 and YDR259c, that increased resistance to cisplatin when overexpressed in Saccharomyces cerevisiae. These genes encoded two proteins, Cin5 and Ydr259c, that were homologous to yAP-1, a basic leucine zipper transcriptional factor that is known to mediate cellular resistance to various toxic agents. The two proteins exhibited stronger homology to each other (33.2% identity, 49.2% similarity) than to all other gene products in S. cerevisiae. Overexpression of each of these proteins also conferred resistance to two DNA-alkylating agents, methylmethanesulfonate and mitomycin C. An experiment with fusion proteins with green fluorescent protein revealed that Cin5 and Ydr259c were localized constitutively in the nuclei of yeast cells. Our results suggest that Cin5 and Ydr259c might be involved in pleiotropic drug-resistance and might protect yeast against the toxicity of cisplatin and other alkylating agents via a single mechanism. These two nuclear proteins might act as transcriptional factors, regulating the expression of certain genes that confer resistance to DNA-alkylating agents.
| |
Introduction |
|---|
|
|
|---|
cis-Diamminedichloroplatinum(II)
(cisplatin) is one of the most widely used chemotherapeutic agents for
the treatment of human ovarian cancer and other tumors (Chu, 1994
;
Yoshida et al., 1994
). In addition to its toxic side effects, a major
limitation of cisplatin chemotherapy is acquired resistance. The
increases in the dose of the drug that are necessary to overcome even a
small increase in cellular resistance can cause severe toxicity (Von
Hoff et al., 1979
). An understanding of the molecular basis of both
acquired and inherent resistance of cisplatin, therefore, might help us to improve clinical protocols significantly.
Laboratory studies with tumor tissues and cell lines suggest that
resistance to cisplatin is nearly always multifactorial (Parker et al.,
1991
; Dabholkar and Reed, 1996
; Gosland et al., 1996
). The
factors involved in resistance include impaired cellular uptake of
cisplatin (Fujii et al., 1994
; Shen et al., 1998
), enhanced intracellular detoxification by systems that involve glutathione (Godwin et al., 1992
; Ishikawa et al., 1994
) or metallothionein (Naganuma et al., 1987
; Kelley et al., 1988
), altered patterns of
DNA platination (Johnson et al., 1994
), and enhanced repair of DNA
damage (Masuda et al., 1988
; Parker et al., 1991
; Dabholkar and Reed,
1996
; Gosland et al., 1996
). However, the full details of the mechanism
of cisplatin resistance are not yet clearly understood.
Genetic analyses of drug toxicity have been facilitated by the use of yeast model systems that have allowed cloning and analyses of genes that might contribute to drug resistance. In the present study, we isolated two genes that, when overexpressed from multicopy plasmids, conferred cisplatin resistance on Saccharomyces cerevisiae. These genes encode proteins in the yeast bZIP family, Cin5 and Ydr259c, the functions have not yet clearly been characterized. Cells that overexpressed each gene were also resistant to the DNA-alkylating agents methyl methanesulfonate and mitomycin C, but they remained sensitive to other compounds, such as doxorubicin and peplomycin. Our data suggest that both Cin5 and Ydr259c might be involved in pleiotropic drug-resistance and might protect yeast cells against the toxicity of DNA-alkylating agents such as cisplatin by the same mechanism.
| |
Materials and Methods |
|---|
|
|
|---|
Yeast Strains and Media.
Throughout this study, we used
Saccharomyces cerevisiae W303B (MAT
his3
can1-100 ade2 leu2 trp1 ura3). The yeast genomic DNA library was
made by cloning size-fractionated Sau3AI (5- to 10-kilobase)
fragments into the BamHI cloning site of the YEp13 vector.
Cells were grown in yeast extract-peptone-dextrose medium or in
synthetic dextrose (SD) medium without leucine (
Leu). Cells were
transformed by the lithium acetate procedure (Gietz et al., 1992
).
Cultures were grown at 30°C. Plasmids were isolated from yeast cells
as described by Hoffman (1993)
.
DNA Sequencing. The nucleotides sequences of genomic inserts in the isolated plasmids were determined with an automated sequencer (ABI, Natick, MA), with the YEp13-F primer (TGCTCGCTTCGCTACTTGA) or the YEp13-R primer (ATACCCACGCCGAAACAAGC).
Manipulation of DNA. Genes that supported growth in the presence of cisplatin (Nippon Kayaku Co. Ltd., Tokyo, Japan) were excised from clones and subcloned as DNA fragments in pRS425 vector. Sequencing identified genomic inserts as CIN5 and YDR259c.
Construction of Genes for Green Fluorescent Protein
(GFP)-Tagged Cin5 and Ydr259c.
HA-CIN5 and
HA-YDR259c genes were amplified by the polymerase
chain reaction with the following oligonucleotides as primers: 5'-GTCACAGCTGCCATGTACCCATACGATGTTCCAGATTACGCTTTAATGCAAATAAAAATGGAC-3' and 5'-AGCACTTCTTCAGGGGGATG-3' for CIN5 and
5'-GTCACAGCTGCCATGTACCCATACGATGTTCCAGATTACGCTCAA- AACCCTCCGTTGATTCGT-3'
and 5'-TACAATAAATAGGGAGCAGA-3' for YDR259c. The products of
polymerase chain reaction were ligated into the pGEM-T easy vector
(Promega, Madison, WI). To generate cp-GFP-HA-CIN5 and
cp-GFP-HA-YDR259c, the NcoI-SalI
fragment of pRS cp-GFP-HA-YAP1(Kuge et al., 1997
) was
replaced by the NcoI-PvuII fragment of pGFP536 (Shiroki et al., 1999
) and the PvuII-SalI
fragment of HA-CIN5 or of HA-YDR259C.
Measurement of the Inhibition of Growth by Various
Compounds.
The effects of various compounds on yeast strains that
harbored the genes CIN5 (pRS-CIN5) or
YDR259C (pRS-YDR259C) or the empty pRS425 vector
(control) were quantified by growing cells in SD (
Leu) medium. The
levels of Cin5-mRNA or Ydr259C-mRNA in the yeast strains carrying
pRS-CIN5 or pRS-YDR259C were 3- or 13-fold higher
than the control strain, respectively. Each suspension of cells
(104 cells) was cultured in 200-µl aliquots of
fresh medium that contained various concentrations of the respective
compound. After 48 h, the absorbance at 620 nm
(A620) was determined
spectrophotometrically to quantify the growth of each strain. For assay
using agar-solidified medium, each overnight culture, diluted to 5 × 106 cells/ml, was spotted on plates of
agar-solidified medium with or without cisplatin. Plates were monitored
after incubation for 3 days at 30°C. Each experiment was repeated at
least twice and representative results are shown.
| |
Results and Discussion |
|---|
|
|
|---|
In our search for novel genes that confer resistance of cisplatin,
we introduced a yeast genomic DNA library in the vector YEp13 into
W303B yeast cells. Transformants (5 × 103)
were spread on plates of agar-solidified SD (
Leu) medium containing cisplatin (220 µM) and cultured for 3 days at 30°C. Under these conditions, yeast cells that had been transformed with the empty Yep13
vector did not form colonies. Single colonies of transformants that had
grown in the presence of cisplatin were picked up and plasmids were
rescued from these cells and amplified in Escherichia coli.
Plasmids were reintroduced into W303B yeast cells to confirm the phenotype.
We obtained
seven plasmids that conferred resistance to cisplatin and we sequenced
and mapped the inserted genomic DNA in each plasmid using the
Saccharomyces Genome Database. The inserted DNA of three of
these plasmids (Nos. 1-2, 3-5, and 11-1) and that of the other four
plasmids (Nos. 11-2, 11-3, 13-1, and 15-2) were found to have been
derived almost identically from the same region of yeast chromosomes XV
and IV, respectively. To identify the genes involved in cisplatin
resistance, we subcloned the inserted DNA in plasmids 3-5 and 11-2 in
pRS425. The first gene responsible for the above-described phenotype
was found in subclone 3-5e (Figs. 1A and
2) and the second gene was found in subclone 11-2a (Figs. 1B and 2).
The insert of each subclone contained a single ORF: CIN5 and
YDR259c, respectively. The deduced products of these two
ORFs exhibited the strongest homology to each other (33.2% identity,
49.2% similarity) among the deduced products of all yeast genes. Each
contained a bZIP motif in the carboxyl-terminal domain. This motif is
strongly conserved in the AP-1 transcription factors of yeast, such as
Yap1 and Yap2 (Fernandes et al., 1997
) (Fig. 3). A computer search of
sequence databases for mammalian genes failed to identify sequences
with high global similarity to both CIN5 and
YDR259c.
|
|
|
|
|
Yeast cells transformed with CIN5 and YDR259c
(pRS-CIN5 and pRS-YDR259c) were resistant not
only to cisplatin but also to methylmethansulfonate and mitomycin C
(Fig. 4). By contrast, these strains were not significantly resistant
to doxorubicin and 5-fluorouracil (data not shown). Recent observations
indicate that overexpression of Cin5 or of Ydr259c also increases
tolerance to sodium and lithium (Mendizabal et al., 1998
), and
overexpression of Cin5 confers resistance to quinidine, mefloquine, and
chloroquine (Delling et al., 1998
). These observations suggest that the
proteins encoded by CIN5 and YDR259c might be
involved in pleiotropic drug resistance and might protect yeast cells
against the toxicity of cisplatin and other chemicals through a single
mechanism. We found that deletion of the CIN5 or
YDR259c gene in wild-type yeast (W303B) did not sensitize
the cells to cisplatin (data not shown), an indication that the
functions of endogenous Cin5 and Ydr259c can substitute for one another
at the basal cellular levels of both proteins.
We examined the cellular localization of Cin5 and Ydr259c by inducing the expression of fusion proteins of Cin5 or Ydr259c with GFP in W303B cells (Fig. 5A). Both GFP-Cin5 and GFP-Ydr259c were detected as single spots in individual yeast cells (Fig. 5B, 1 and 4). A comparison with the sites of DNA staining clearly revealed that the proteins were localized in the nuclei (Fig. 5B, 2 and 5). The fusion proteins were constitutively localized in nuclei and their localization was unchanged by treatment of cells with cisplatin (data not shown).
As mentioned above, Cin5 and Ydr259c exhibited significant similarity
to each other and each contained a highly conserved bZIP motif in the
carboxyl-terminal domain, a characteristic of yeast AP-1 transcription
factors, such as Yap-1 and related proteins (Fernandes et al., 1997
).
Overexpression of Yap-1 confers multidrug resistance that is mediated
by the trans-activation of various genes (Toone and Jones,
1999
). Yap-1 is involved in the expression of several ATP-binding
cassette-type transporters (Wemmie et al., 1994
; Bauer et al., 1999
).
In humans, these transporters are clinically relevant because they are
responsible for resistance of tumors to chemotherapeutic drugs. In the
present study, yeast cells overexpressing Cin5 or Ydr259c showed no
significant differences from control cells in terms of the accumulation
of platinum after treatment with cisplatin (data not shown), a result
that suggests that neither Cin5 nor Ydr259c influences the expression
of transporter proteins. Moreover, overexpression of Yap-1 in W303B
cells failed to increase the resistance to cisplatin (data not shown).
Our results suggest that Cin5 and Ydr259c might have a different
function from Yap-1, even though all three proteins include a highly
conserved bZIP motif. However, it is possible that Cin5 and Ydr259c,
which are constitutively localized in the nuclei of yeast cells, might
act as transcriptional factors and might regulate expression of genes involved in resistance to cisplatin and other DNA-alkylating agents. Further analysis is necessary to elucidate the mechanisms of
pleiotropic resistance that results from the overexpression of Cin5 and Ydr259c.
| |
Acknowledgments |
|---|
We thank Nippon Kayaku Co. Ltd. (Tokyo, Japan) for providing the cisplatin used in this study.
| |
Footnotes |
|---|
Received August 28, 2000; Accepted November 20, 2000
This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas (Diagnosis and Treatment of Cancer) from the Ministry of Education, Science, Sports and Culture of Japan.
Send reprint requests to: Akira Naganuma, Ph.D., Laboratory of Molecular and Biochemical Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Sendai 980-8578, Japan. E-mail: naganuma{at}mail.pharm.tohoku.ac.jp
| |
Abbreviations |
|---|
cisplatin, cis-diamminedichloroplatinum(II); bZIP, basic leucine zipper; SD, synthetic dextrose; HA, influenza virus hemagglutinin; GFP, green fluorescent protein; ORF, open reading frame.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. Kowalski, L. Pendyala, B. Daignan-Fornier, S. B. Howell, and R.-Y. Huang Dysregulation of Purine Nucleotide Biosynthesis Pathways Modulates Cisplatin Cytotoxicity in Saccharomyces cerevisiae Mol. Pharmacol., October 1, 2008; 74(4): 1092 - 1100. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tan, H. Feizi, C. Luo, S. H. Fan, T. Ravasi, and T. G. Ideker A systems approach to delineate functions of paralogous transcription factors: Role of the Yap family in the DNA damage response PNAS, February 26, 2008; 105(8): 2934 - 2939. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Agarwal, T. Xu, M. R. Jacob, Q. Feng, M. C. Lorenz, L. A. Walker, and A. M. Clark Role of Heme in the Antifungal Activity of the Azaoxoaporphine Alkaloid Sampangine Eukaryot. Cell, February 1, 2008; 7(2): 387 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Liao, B. Hu, M. J. Arno, and B. Panaretou Genomic Screening in Vivo Reveals the Role Played by Vacuolar H+ ATPase and Cytosolic Acidification in Sensitivity to DNA-Damaging Agents Such as Cisplatin Mol. Pharmacol., February 1, 2007; 71(2): 416 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Flaherty, G. Giaever, J. Kumm, M. I. Jordan, and A. P. Arkin A latent variable model for chemogenomic profiling Bioinformatics, August 1, 2005; 21(15): 3286 - 3293. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zakrzewska, A. Boorsma, S. Brul, K. J. Hellingwerf, and F. M. Klis Transcriptional Response of Saccharomyces cerevisiae to the Plasma Membrane-Perturbing Compound Chitosan Eukaryot. Cell, April 1, 2005; 4(4): 703 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. I. Wu, J. A. Brown, M. J. Dorie, L. Lazzeroni, and J. M. Brown Genome-Wide Identification of Genes Conferring Resistance to the Anticancer Agents Cisplatin, Oxaliplatin, and Mitomycin C Cancer Res., June 1, 2004; 64(11): 3940 - 3948. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Furuchi, T. Takahashi, S. Tanaka, K. Nitta, and A. Naganuma Functions of yeast helicase Ssl2p that are essential for viability are also involved in protection from the toxicity of adriamycin Nucleic Acids Res., May 11, 2004; 32(8): 2578 - 2585. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wysocki, P.-K. Fortier, E. Maciaszczyk, M. Thorsen, A. Leduc, A. Odhagen, G. Owsianik, S. Ulaszewski, D. Ramotar, and M. J. Tamas Transcriptional Activation of Metalloid Tolerance Genes in Saccharomyces cerevisiae Requires the AP-1-like Proteins Yap1p and Yap8p Mol. Biol. Cell, May 1, 2004; 15(5): 2049 - 2060. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-C. Li Genome-wide coexpression dynamics: Theory and application PNAS, December 24, 2002; 99(26): 16875 - 16880. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ishida, J. Lee, D. J. Thiele, and I. Herskowitz From the Cover: Uptake of the anticancer drug cisplatin mediated by the copper transporter Ctr1 in yeast and mammals PNAS, October 29, 2002; 99(22): 14298 - 14302. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||