Introduction

Top Abstract Introduction Materials and Methods Results Discussion Conclusion References

The 5-HT₃ receptor is a ligand-gated ion channel found in the central and peripheral nervous system, where it mediates fast synaptic transmission (Peters et al., 1992; Yakel et al., 1992; Roerig et al., 1997). 5-HT₃ receptors were thought to be homogeneous because for many years only a single class of 5-HT₃ receptor subunit, the 5-HT_3A subunit, had been cloned (Maricq et al., 1991; Hope et al., 1993; Werner et al., 1994; Miyake et al., 1995; Lankiewicz et al., 1998). Davies et al. (1999) succeeded in showing the existence of a  -subunit of the human 5-HT₃ (5-HT_3B) receptor, which is closely related to the known 5HT_3A (41% amino acid identity) and Hanna et al. (2000) reported the existence of mouse and rat 5-HT_3B receptor subunits. The existence of an additional subunit involved in the formation of heteromeric 5-HT₃ receptors was already proposed from the substantial heterogenity of the properties of native 5-HT₃ receptors (Derkach et al., 1989; Yang et al., 1992; Hussy et al., 1994; Jones and Surprenant, 1994; Fletcher and Barnes, 1998).

Agonist activation of the 5-HT₃ receptor depolarizes the cell, which desensitizes in the continuous presence of agonist. Based on work with ACh and glutamate receptors, desensitization is thought to shape the synaptic response. Altering desensitization of rapidly activated receptors has been proposed as a mechanism for synaptic plasticity (Huganir et al. 1986). Several factors are known to regulate the kinetics of desensitization of ion channel, including membrane voltage, amino acid sequence, both intracellular and extracellular calcium, phosphorylation, and the developmental state of the cells (Yakel, 1992; Yakel et al., 1993). The molecular mechanism of desensitization is still unknown and controversial (Lin and Stevens, 1994). Recently, we found that heterologous expression of homomeric human or guinea pig 5-HT_3A receptors in HEK 293 cells revealed great differences in time courses of desensitization in that the guinea pig receptor showed prolonged desensitization kinetics compared with the human 5-HT_3A receptor (Lankiewicz et al., 1998).

Knowing the molecular determinants for the species differences in the rate of desensitization (i.e., decline of amplitude in continuous presence of agonist) and inactivation (i.e., closing of channels after removal of agonist) properties will help us to understand this basic phenomenon of 5-HT₃ receptor function at the molecular level. Although nearly all ligand-gated channels have been shown to desensitize, there are only very limited data showing the physiological relevance of desensitization. Desensitization is mostly discussed in relation to termination of postsynaptic currents and as a mechanism for the modulation of synaptic efficacy. A better understanding of the molecular mechanisms of desensitization may also trigger new insights into synaptic function and its regulation.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion Conclusion References

Construction of Chimeric Receptors. Random chimeric cDNA was constructed as described previously (Lankiewicz et al., 1998). For chimeras with guinea pig cDNA at the 5' end, primers (50 pmol) were used that fit the 5' region of the 5-HT_3A guinea pig_short (GP_s) (P6) and the 3' region of the 5-HT_3A human cDNA (P10). For the reverse chimeras, we used primers P9 and P8 fitting the 3' ending of the 5-HT_3A GP_s and the 5' prime region of the 5-HT_3A human (H) cDNA, respectively. Chimeric cDNA was amplified in two cycles (45 s at 94°C, 1 s at 50°C) to generate incomplete polymerase chain reaction products, followed by 20 cycles (45 s at 94°C, 45 s at 60°C, 2 min at 72°C) using 0.125 U of Pfu-polymerase (Stratagene, La Jolla, CA), 2.5 U of Taq-polymerase, and a mixture of 1 ng of HindIII cut p5-HT_3A GP_s and p5-HT_3A H as the template. The reaction product was digested with HindIII and XbaI and subcloned into an eucaryotic expression vector (pRc/CMV; Invitrogen, Carlsbad, CA). The "switch-point" was mapped by restriction digestion with PstI, and chimeric cDNAs of interest were sequenced on both strands. The switch-point was defined as the first detectable nucleotide of B in an A × B chimera. We produced the chimeric 5-HT_3A receptors C1, E1, E2, E4, and X23 (see under Results). The resulting pE1, pE2, pE4, and pX23 contained the 5'-end of the 5-HT_3A GP_s up to position 1367, 1026, 792, and 800, respectively, fused to the 3'-end of 5-HT_3A H beginning at position 1334, 1011, 867 and 785, respectively (Miyake et al., 1995). pC1 is a combination of the 5-HT_3A H 5'-end up to position 946 and 5-HT_3A GP_s 3'-end beginning at position 876: P6, CCCAAGCTTGCCACCATGGTGCTGTGGCTCCAGCTG; P8, TACCTT/CGACCAATCCTAT/CT/CCT/ATAGATCTTCGT; P9, ATTGGATCCAGACCATCTTCATTGTGCA/GGCTG; (5 ') CCCAAGCTTGTCGCTATGCTGCTG-TGGGTC; P10, (3') CATCTAGACTTGGCTTGTGATTGCTGAGATG.

Site Directed Mutagenesis. Mutagenesis of the plasmids p5-HT_3A GP_s, p5-HT_3A H (Lankiewicz et al., 1998) was performed using the U.S.E. Mutagenesis Kit from Amersham Pharmacia Biotech (Piscataway, NJ) (GP_I264V) and using the QuikChange Site-Directed Mutagenesis Kit from Stratagene (H_S248T and GP_T254S). In the case of the guinea pig 5-HT_3A receptor, threonine 254 was mutated to serine and isoleucine 264 was mutated to valine. For the human 5-HT_3A receptor, serine 248 was mutated to threonine. For the mutations, the following oligonucleotides were used (altered nucleotides are underlined): HS248T, 5'-CCT CTT CTA TGT GGT CAC GTT GCT ACT GCC CAG CAT-3'; 5'-GAT GCT GGG CAG TAG CAA CGT GAC CAC ATA GAA GAG-3'; GPT254S, 5'-CGG CGA CCT CTC TTC TAT GCA GTC AGC TTG CTG CTG- 3'; 5'-CAG CAG CAA G C T GAC TGC ATA GAA GAG AGG T CG CCG-3'; GPI264V: 5'-CAT CTT TCT CAT GGT CGT GGA CAT TGT GG-3'. A silent mutation, present in each oligonucleotide, introduced a new enzyme restriction site or deleted a restriction site to facilitate mutant screening. Mutations were confirmed by sequencing of both strands.

Functional Expression in HEK293 Cells. Culture and transfection of HEK293 cells was done as described previously (Gorman et al., 1990; Lankiewicz et al., 1998). Cells were grown in minimum essential medium supplemented with 10% fetal calf serum in 5% CO₂ at 37°C. Transfection was accomplished by mixing 15 µg of expression vector and 250 µl of 250 mM CaCl₂. The material was added dropwise to 250 µl of 2× HEPES buffered saline. The precipitate then was added to 20% confluent HEK293 cells and allowed to incubate for 5 h before washing the cells twice with phosphate-buffered saline (137 mM NaCl, 8.1 mM Na₂HPO₄, 2.7 mM KCl, 1.5 mM KH₂PO₄, 0.9 mM CaCl₂, and 0.5 mM MgCl₂, pH 7.2). Stable cell lines were established by selection with 500 µg/ml G418.

Electrophysiology and Solutions. Transfected HEK293 cells expressing the recombinant 5-HT_3A receptors (H_S248T, GP_T254S, GP_I264V, E4, C1, E1, E2, and X23) were recorded in the whole-cell voltage-clamp configuration (Hamill et al., 1981) under visual control using an inverted microscope (Zeiss, Jena, Germany). The cells were kept in an external solution containing: 145 mM NaCl, 10 mM glucose, 1 mM EGTA, and 10 mM HEPES. pH was adjusted to 7.3 with NaOH. Patch electrodes were pulled from borosilicate glass (Clark Electromedical Instruments, Pangbourne, England) using a horizontal pipette puller (DMZ Universal Puller, Zeitz-Instruments, Munich, Germany) to yield pipettes with resistances of 3 to 6 M. Pipettes were filled with a solution containing 145 mM CsCl, 10 mM glucose, 10 mM HEPES, and 1 mM EGTA. pH was adjusted to 7.2 with CsOH.

	Results

Top Abstract Introduction Materials and Methods Results Discussion Conclusion References

HEK293 cells expressing human or guinea pig homomeric 5-HT_3A receptors were recorded in the whole-cell voltage-clamp configuration. Because it is widely accepted that calcium depresses the peak current and is intimately involved in the mechanism of desensitization (reviewed in Yakel, 1992), we first investigated the effect of calcium ions on the kinetics of 5-HT_3A receptor responses of wild-type human or guinea pig receptors, respectively. We measured the kinetics of current amplitudes of human and guinea pig receptor responses during prolonged application (240 s) of 10 µM 5-HT (see also Lankiewicz et al., 1998) in calcium-free solutions and in presence of 1 mM or 3 mM CaCl₂ and showed that CaCl₂ remarkably accelerated the desensitization kinetics of human or guinea pig 5-HT_3A receptors (Fig. 1, Table 1). In contrast, the activation kinetics of the 5-HT-induced currents were not significantly affected by calcium (data not shown).

View larger version (14K): [in this window] [in a new window]   Fig. 1.   Normalized whole-cell, voltage-clamp recordings of wild-type human (left) and guinea pig (right) 5-HT3A receptors in absence of Ca2+ or in presence of 3 or 10 mM [Ca2+]o. The amplitudes were normalized, as the peak currents are depressed in a dose-dependent manner by extracellular calcium. The bar indicates the application of 10 µM 5-HT. The decay time of the current from 90 to 10% of amplitude of 5-HT-induced currents are indicated in the Table 1.

The effect of calcium on the desensitization kinetics of guinea pig receptors is weaker than its effect on human 5-HT_3A receptors as measured by the decay time from 90 to 10% of current. To eliminate the accelerating effect of calcium ions on the desensitization kinetics, all further investigations were done in calcium-free solutions.

The rapid application of 10 µM 5-HT induced rapid currents (activation_10-90%, 58.6 ± 2.6 ms for human, 124.5 ± 18.6 ms for guinea pig) that reached a maximum of several hundred picoamperes to a few nanoamperes, depending on the expression level of the receptor protein, and decreased with characteristic decay constants. Heterologous expression of homomeric human or guinea pig 5-HT_3A receptors revealed great differences in the time course of desensitization. The guinea pig receptor showed prolonged desensitization kinetics compared with the human 5-HT_3A receptor (Lankiewicz et al., 1998). Human 5-HT_3A receptors desensitized over 42.7 ± 3.4 s from 90 to 10% of maximum current (n = 19), whereas guinea pig 5-HT_3A receptors took 151.4 ± 9.2 s to desensitize (n = 15) (compare also Lankiewicz et al., 1998). Representative current traces are depicted in Fig. 1.

Figure 2 demonstrates the dependence of the desensitization kinetics of the human 5-HT_3A receptor on the 5-HT concentration. The time course of desensitization accelerates with increasing 5-HT concentration (73.6 ± 5.9 s with 1 µM 5-HT, 41.8 ± 4.5 s with 30 µM, and 12 ± 2.3 s with 1 mM 5-HT; n = 12, 10, and 11 cells, respectively). In contrast, the time course of inactivation (i.e., closing of the channels after removing of 5-HT) of this receptor is independent from the agonist concentration (8.4 ± 0.6 s with 1 µM 5-HT, 9.7 ± 0.7 s with 30 µM, and 8.5 ± 0.5 s with 1 mM 5-HT; n = 10, 10, and 8 cells, respectively). The same is true for the guinea pig 5-HT_3A receptor. Because of the slow desensitization of the guinea pig receptor in presence of 1 µM 5-HT the kinetics were not estimated for this concentration. With 30 µM 5-HT, the time course of desensitization was 120 ± 21.7 s (n = 5), and the desensitization time course from 90 to 10% of current was 51.2 ± 24.5 s with 1 mM 5-HT (n = 3).

View larger version (42K): [in this window] [in a new window]   Fig. 2.   Diagram showing the dependence of desensitization kinetics of the human () and guinea pig 5-HT3A receptors () on the 5-HT concentration. The ordinate indicates the decay time [s] from 90 to 10% of the current. Guinea pig 5-HT3A receptors slowly desensitize in presence of 1 µM 5-HT. The breaks in the time-axis and the bar are set to indicate this fact.

To investigate recovery from desensitization, complete desensitization was induced and the agonist was subsequently washed off. The arrival of 5-HT_3A receptors in the resting, activatable state was measured from the amplitude of the inward current evoked by a near maximum effective concentration of agonist after a variable period of washing. Figure 3 shows the recovery time (resensitization) of the completely desensitized human or guinea pig 5-HT_3A receptor. Prolonged application of 10 µM 5-HT for up to 4 min completely desensitized the 5-HT_3A receptors. The 5-HT-induced currents regained 100% of the control amplitude after 30 s of wash (recovery) (n = 5-8 cells).

View larger version (25K): [in this window] [in a new window]   Fig. 3.   Diagram showing the resensitization of human () or guinea pig () 5-HT3A receptors. The receptors were completely desensitized by prolonged application of 10 µM 5-HT. The normalized amplitude of 5-HT (10 µM) induced currents is indicated as a function of recovery (wash) time [s].

We investigated the molecular substrate (i.e., the primary structure) of the species difference in desensitization and inactivation kinetics by constructing chimeric receptors between the human and guinea pig 5-HT_3A receptor sequences (Lankiewicz et al., 1998). The chimeric receptors consisted of the guinea pig amino terminus, the human carboxy-terminal domain (E1, E2, E4, and X23), and the chimeric receptor C1, which consisted of the human amino terminus and the guinea pig carboxy-terminal domain. The switch-points (see under Materials and Methods) are indicated in Fig. 6. Transient expression of the chimeric receptor plasmids in HEK 293 cells produced functional 5-HT_3A receptor channels with apparent affinities (EC₅₀) for 5-HT (E1, 1.9 ± 0.01 µM, n_H = 2.1; E2, 1.2 ± 0.1 µM, n_H = 2.1 ± 0.2; E4, 1.3 ± 0.1 µM, n_H = 1.3; C1, 1.3 ± 0.1 µM, n_H = 2.1 ± 0.3 and X23, 1.6 ± 0.1 µM, n_H = 1.3) comparable with that of wild-type 5-HT_3A receptors (human, 2.3 ± 0.2 µM, n_H = 2.3 ± 0.4 and guinea pig, 2.1 ± 0.9 µM, n_H = 2.8 ± 0.5) (Fig. 4). Application of 10 µM 5-HT revealed a correlation between the time constant of decay and the M1 domain. The chimeric receptors E1, E2, X23, and C1 that possesed the guinea pig M1 and N-terminal domains as common structural features showed GP-like desensitization kinetics (163.9 ± 16.3 s, 143.3 ± 17.3 s, 189 ± 22.7 s, and 172.8 ± 22.6 s, respectively; n = 8-18 cells) (Figs. 5, A and C, and 6 and Table 2). In contrast, the chimeric receptor E4 (with human M1 to M4) desensitized rapidly (48.8 ± 4 s; n = 18) (Figs. 5, A and C, and 6 and Table 2). The same held for the inactivation kinetics: The chimeric receptors E1, E2, X23, and C1 showed inactivation constants (90-10%) of 16.1 ± 1 s, 17.1 ± 0.9 s, 22.9 ± 2 s, and 20.8 ± 1.7 s, respectively (n = 13-18 cells), whereas the inactivation time constant of E4 was 7.2 ± 0.5 s (n = 17).

View larger version (27K): [in this window] [in a new window]   Fig. 4.   Diagram showing the dose-response relationships of all 5-HT3A receptors investigated (wild-type human and wild-type guinea pig, C1, E1, E2, E4, X23, GPT254S, HS248T, and GPI264V).

View larger version (53K): [in this window] [in a new window]   Fig. 5.   A, diagram showing the desensitization kinetics of wild-type and chimeric 5-HT3A receptors. The decay time [s] (from 90 to 10% of maximum current) of 5-HT (10 µM) induced currents is indicated for guinea pig (GP, ), human (H, ), and chimeric 5-HT3A receptors (, E1, E2, C1, X23, and E4). B, diagram showing the desensitization kinetics of wild-type and mutant 5-HT3A receptors. The decay time [s] (from 90 to 10% of maximum current) of 5-HT (10 µM) induced currents is indicated for guinea pig (GP, ), human (H, ), and the mutant 5-HT3A receptors (GPI264V, GPT254S, HS248T, ). C, diagram showing the inactivation kinetics of wild-type and chimeric 5-HT3A receptors. The decay time [s] (from 90 to 10% of maximum current) of 5-HT (10 µM, 500 ms) induced currents is indicated for guinea pig (GP, ), human (H, ), and chimeric 5-HT3A receptors (, E1, E2, C1, X23 and E4). D, diagram showing the inactivation kinetics of wild-type and mutant 5-HT3A receptors. The decay time [s] (from 90 to 10% of maximum current) of 5-HT (10 µM, 500 ms) induced currents is indicated for guinea pig (GP, ), human (H, ), and mutant 5-HT3A receptors (GPI264V, GPT254S, HS248T, ). E, diagram showing the activation kinetics of wild-type and chimeric 5-HT3A receptors. The rise time [s] (from 10 to 90% of maximum current) of 5-HT (10 µM) induced currents is indicated for guinea pig (GP, ), human (H, ) and the chimeric 5-HT3A receptors (, E1, E2, C1, X23, and E4). F, diagram showing the activation kinetics of wild-type and mutant 5-HT3A receptors. The rise time [s] (from 10 to 90% of maximum current) of 5-HT (10 µM, 500 ms) induced currents is indicated for guinea pig (GP, ), human (H, ), and mutant 5-HT3A receptors (GPI264V, GPT254S, HS248T, ).

View larger version (31K): [in this window] [in a new window]   Fig. 6.   Whole-cell voltage-clamp recordings of wild-type human (H) and guinea pig (GP) 5-HT3A receptors (first row) and chimeric receptors (row 2 to 6; C1, E1, E2, E4, and X23), showing the different desensitization (left column), and inactivation kinetics (middle column). The application of 5-HT (10 µM) is indicated by the bar and the arrows. Representative current recordings of wild-type receptors are shown in gray (same signals in all rows). The amplitudes of the 5-HT-induced inward currents ranged from 2.1 nA to 4.6 nA (Vhold = 50 mV), depending on the level of protein expression. The right column depicts the structure of the chimeric receptors. The human sequence is shown in black, and the guinea pig sequence is shown in gray. The switch-point was defined as the first detectable nucleotide of B in an A × B chimera. The resulting pE1, pE2, pE4, and pX23 contained the 5' end of the 5-HT3A GPs up to positions 1499, 1158, 792, and 932, respectively, fused to the 3' end of 5-HT3 H beginning at positions 1553, 1230, 865, and 1004, respectively. pC1 is a combination of the 5-HT3A H 5' end up to position 724 and 5-HT3A GPs 3' end beginning at position 876.

On the assumption that the M1 domain determines the desensitization and inactivation kinetics, we compared the amino-acid sequence of the M1 region in human and guinea pig 5-HT_3A receptors and found four amino-acids in M1 of human 5-HT_3A that differed from the GP sequence: position 252 was V in H and A in GP (i.e., V252A); the three remaining differences were S254T, V264I, and M265V.

The amino acids in the GP sequence at positions A252 and V265 are identical in GP, mouse, and rat. Because the human 5-HT_3A receptor shows desensitization and inactivation kinetics in the same order of magnitude as mouse or rat 5-HT_3A receptors (Lankiewicz et al., 1998), we concluded that these amino acid positions were not responsible for determining the desensitization and inactivation kinetics.

As the GP sequence T254 and I264 are different from the residues of the other species, we used site directed mutagenesis to replace the GP T254 with serine (GP_T254S) and I264 with valine (GP_I264V), according to the respective positions in the human 5-HT_3A receptor sequence. The human S248 was replaced with threonine (H_S248T), corresponding to the respective position in the GP 5-HT_3A receptor sequence. (Note that the position 254 of the GP sequence corresponds to position 248 of the human sequence).

Transiently transfected HEK293 cells expressing GP_T254S 5-HT_3A receptors produced 5-HT-induced currents that desensitized and inactivated much more quickly than did currents of wild-type GP 5-HT_3A receptors (desensitization_90-10%, 47.5 ± 4 s, n = 17; inactivation_90-10%, 8 ± 0.4 s, n = 23). The receptors showed human-like desensitization and inactivation kinetics (Fig. 5, B and D, and 7). In contrast to the GP_T254S receptors, the cells expressing the GP_I264V 5-HT_3A receptors showed the same desensitization and inactivation kinetics as the wild-type 5-HT_3A (151.6 ± 13.4 s, n = 12 and 14.7 ± 0.8 s, n = 19, respectively); i.e., the I264V mutation did not change the kinetics (Fig. 5, B and D. and 7). On the other hand, the S248T mutation of the human sequence (H_S248T) produced currents with guinea pig-like desensitization and inactivation kinetics (113.9 ± 9.5 s, n = 23, and 14.2 ± 1.9 s, n = 19, respectively) (Fig. 5, B and D, and 7). The EC₅₀ for 5-HT of all investigated receptors (chimeras and point mutations) were not changed compared with wild-type human or guinea pig 5-HT_3A receptors (Fig. 4, Table 3).

View larger version (21K): [in this window] [in a new window]   Fig. 7.   Whole-cell, voltage-clamp recordings of wild-type human (H) and guinea pig (GP) 5-HT3A receptors (first row) and mutant receptors (row 2-4; GPT254S, HS248T, and GPI264V), showing the different desensitization (left column) and inactivation kinetics (right column). The bar and the arrows indicate application of 10 µM 5-HT. Representative current recordings of wild-type receptors are shown in gray (same signals in all rows). The amplitudes of the 5-HT-induced inward currents ranged from 400 pA (GPT254S) to 4.4 nA (Vhold = 50 mV). The lower panel shows the comparison of the amino acid sequence of the M1 (putative transmembrane) region (box) of H, GP, GPT254S, HS248T, and GPI264V 5-HT3A receptors. The consensus sequence is shown in the first row of the alignment.

The wild-type guinea pig 5-HT_3A receptors showed no voltage-dependence of desensitization kinetics by application of 10 µM 5-HT: 151.4 ± 9 s at 50 mV and 126.8 ± 23 s at +50 mV (n = 3). In contrast, the human 5-HT_3A receptors did show a voltage dependence: the decay time (Time_90-10%) was 42.7 ± 3.4 s at 50 mV and 12 ± 3 s at +50 mV (n = 7) (compare Lankiewicz et al., 1998).

In contrast to desensitization and inactivation kinetics, the time course of the activation of the 5-HT induced currents (rise time, 10-90% of current) was not changed by the mutations (Fig. 5, E and F). The activation kinetics of the wild-type guinea pig 5-HT_3A receptor was significantly slower than that of the wild-type human 5-HT_3A receptor (58.6 ± 2.6 ms for human and 124.5 ± 18.6 ms for guinea pig receptor, respectively; n = 13 and 10 cells). The point mutation of the guinea pig sequence resulting in GP_T254S and GP_I264V (167.5 ± 8 ms and 140 ± 16.5 ms, respectively) showed the same activation kinetics as did the wild-type. The mutation of the human sequence, resulting in H_S248T, also produced receptors with unaltered activation kinetics (75.4 ± 8.7 ms; n = 13). The chimeric receptors E1, E2, C1, and X23 showed slow (guinea pig-like) activation kinetics (133 ± 9 ms, 132 ± 31 ms, 120 ± 13.6 ms, and 115 ± 13.5 ms, respectively; n = 8 to 10 cells), whereas the E4 chimeric receptor showed fast (human-like) activation kinetics (65 ± 5 ms; n = 10). Taking these data together, we conclude that the M1 region determines the activation kinetics.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion Conclusion References

We demonstrate that the time course of desensitization and inactivation of 5-HT-induced currents in recombinant human or guinea pig homomeric 5-HT_3A receptors is strongly influenced by a single amino acid in the M1 region of the receptor protein.

The effect of extracellular Ca ²⁺ on 5-HT₃ receptor currents has been studied in different preparations, revealing sometime opposing effects on desensitization kinetics (reviewed in Yakel, 1992). Our data demonstrated calcium-mediated effects on the peak amplitudes and desensitization kinetics of the currents. To avoid these effects, we investigated the desensitization kinetics of 5-HT-induced currents under calcium-free conditions.

Desensitization Kinetics of 5-HT_3A Receptors. The decline of amplitude in continuous presence of agonist is the phenotype of receptor desensitization. The process of 5-HT₃ receptor desensitization is thought to be coupled to binding of the agonist to a specific site on the receptor protein. However, little is known about the molecular structures and mechanisms underlying the gating process. By following the changes in desensitization behavior of various chimeras between the human and guinea pig sequences, we could delimit the molecular substrate for determining this difference in desensitization kinetics to the first transmembrane region (M1) of the receptor protein. Using site directed mutagenesis, a single serine residue in the human 5-HT_3A receptor sequence (S248) was identified that, when substituted with the threonine residue found in the equivalent guinea pig sequence (T254), conferred guinea pig-like slow kinetics on the time course of desensitization of the human receptor. Correspondingly, the reverse mutation (guinea pig T254S) resulted in a fast, human-like time course of desensitization.

Concentration and Voltage Dependence of the Desensitization Rate. The desensitization rate of the 5-HT_3A receptor wild-type and mutant varies with agonist concentration, higher concentrations of agonist desensitize the receptor more rapidly. The time course of desensitization of human 5-HT_3A receptors was about six times longer at 1 µM than at 1000 µM 5-HT. For the guinea pig receptors, we could only compare the decay times for 30 µM and 1000 µM 5-HT, and found a similar relation of kinetics.

Recovery from Desensitization of 5-HT_3A Receptors. The rate of recovery from desensitization can determine the ability of the synapse to respond to repetitive firing and thus represents a major factor contributing to the plasticity of synapses. As we show, recovery of the slowly desensitizing guinea pig type of receptor is in the same magnitude as the fast human receptors. The nature of this phenomenon is unknown. The data on sigmoid recovery from desensitization (see Fig. 3) excludes the possibility that the kinetics is determined by a single rate limiting dissociation step or conformational transition. Therefore, it has been assumed that recovery from desensitization involves multiple steps that occur at similar rates. Similar multistep mechanisms might also apply to the recovery from desensitization of nicotinic ACh receptors (Franke et al., 1991; Dilger and Liu, 1992).

Activation and Inactivation Kinetics of 5-HT_3A receptors. The response of the human 5-HT_3A receptor reached 90% of its peak within approximately 59 ms after application of 10 µM 5-HT, and the guinea pig receptor within 125 ms. Similarly, Gunthorpe et al. (2000) reported a 10 to 90% rise time of 103 ± 9 ms for 5-HT-induced currents in HEK293 cells heterologously expressing murine 5-HT_3A receptors. However, similarly low forward rate constants are described for 5-HT₃ receptors in neuroblastoma cells (Mienville, 1991) and -aminobutyric acid_A receptors (Adelsberger et al., 1996).

	Conclusion

Top Abstract Introduction Materials and Methods Results Discussion Conclusion References

Taken together, our results imply that the underlying conformational change of this part of the molecule during desensitization and inactivation has a high degree of similarity. 5-HT₃ receptors mediate fast excitatory synaptic transmission in the central and pheripheral nervous system and play roles in synaptic plasticity and development as well as in several chronic and acute neurological disorders. Receptor desensitization is a way to regulate synaptic responses. The identification of specific structural elements of the 5-HT₃ receptor involved in desensitization may facilitate new insights into synaptic function and its regulation. 5-HT₃ receptors stripped of their normal desensitization provide a powerful tool for investigating receptor channel properties otherwise masked by the fast onset of receptor desensitization. The 5-HT₃ receptor makes it possible for 5-HT to function in rapid excitatory synaptic transmission. Until recently, 5-HT was thought to act primarily as a modulator of neuronal excitability. Characterization of the kinetic and pharmacological properties of the 5-HT₃ receptor, its presence in the mammalian central nervous system (Bloom and Morales, 1998), and the clinical and behavioral actions of 5-HT₃ receptor-specific ligands (see also Apud, 1993) suggest a new physiological function for 5-HT in the brain (Yakel et al., 1990).