|
|
|
|
Vol. 59, Issue 5, 1022-1028, May 2001
Department of Integrative Biology, and the Institute of Molecular Medicine, University of Texas, Houston, Texas (I.G.S.); and Departments of Medicine and Molecular Pharmacology and the Albert Einstein Comprehensive Cancer Center, Albert Einstein College of Medicine, Bronx, New York (R.Z., Y.W., S.D., I.D.G.)
| |
Abstract |
|---|
|
|
|---|
The reduced folate carrier (RFC1) plays a major role in the delivery of folates into mammalian cells. RFC1 is an anion exchanger with seven conserved positively charged amino acid residues within 12 predicted transmembrane domains. This article explores the role of these residues in transport function by the development of cell lines in which arginines and lysines in RFC1 were replaced with leucine by site-directed mutagenesis. Three cell lines transfected with R131L, R155L, or R366L all lacked activity, despite high levels of protein expression in the plasma membrane, suggesting the crucial role of these amino acid residues in RFC1 function. In several mutant carriers, R26L, R42L, and K332L, there was little or no change in the influx Kt value for MTX or influx Ki value for folic acid. However, the R26L, R42L, and K332L carriers had decreased affinity for reduced folates. This was most prominent for K404L, which had 11- and 4-fold increases in influx Ki for 5-methyl-THF and 5-formyl-THF, respectively, compared with L1210 cells. The marked influx stimulation observed with wild-type carrier when extracellular chloride was decreased was significantly diminished when influx was mediated by the K404L carrier, but was only slightly decreased with the R26L, R42L, and K332L mutants. This suggested that the K404 residue may be a major site of inhibition by chloride in the wild-type carrier. These studies indicate the important role that some positively charged residues within transmembrane domains of RFC1 play in RFC1 function.
| |
Introduction |
|---|
|
|
|---|
The
reduced folate carrier (RFC1) mediates the membrane transport of the
major plasma folate, 5-methyltetrahydrofolate (5-methyl-THF), and hence
is crucial to the delivery of one-carbon units required for nucleic
acid and methionine biosynthesis (Dixon et al., 1994
). RFC1 is a member
of the major facilitator superfamily of carriers that transport a
variety of diverse inorganic and organic solutes in prokaryotic and
eukaryotic cells (Pao et al., 1998
). RFC1 is predicted to have 12 transmembrane domains bisected by a long cytoplasmic loop, which, along
with the N and C termini, are directed to the cytoplasm (Dixon et al.,
1994
; Ferguson and Flintoff, 1999
). RFC1 generates uphill transport of
folates through an exchange mechanism linked to organic anions that are
concentrated within the intracellular compartment (Goldman, 1971
;
Henderson and Zevely, 1983
; Yang et al., 1984
).
Recent studies from this laboratory employing chemical mutagenesis with
antifolate selective pressure, along with studies from other
laboratories, have identified residues, particularly within the first
transmembrane domain of RFC1, that, when mutated, produce marked
changes in the spectrum of carrier affinities for folate and antifolate
substrates as well as selective changes in the mobility of the
carrier-folate complex (Zhao et al., 1998a
,b
, 1999a
; Jansen et al.,
1998
; Tse et al., 1998
).
There are 12 charged amino acids within the predicted transmembrane
domains of RFC1; of these, seven are conserved among the cloned
mammalian carriers and carry a positive charge. Charged amino acids
within transmembrane domains of other facilitative carriers have been
shown to take part in substrate recognition and binding, maintenance of
tertiary carrier structure, and changes in carrier conformation that
are associated with the bidirectional movements of carrier and
substrate (Jarolim et al., 1995
; Muller et al., 1996
; Steiner-Mordoch
et al., 1996
; Fei et al., 1997
; Kavanaugh et al., 1997
; Merickel et
al., 1997
; Karbach et al., 1998
; Lanz and Erni, 1998
). Because folates
are bivalent anions and RFC1 is an anion exchanger that is inhibited by
a broad spectrum of organic and inorganic anions (Goldman, 1971
;
Henderson and Zevely, 1983
), it seemed plausible that interactions
between folates and this carrier would involve, and require the
integrity of, positively charged residues. This possibility was
explored in the present studies by the application of site-directed
mutagenesis to substitute each of the conserved lysines and arginines
located in transmembrane domains of RFC1 with the neutral leucine. The data demonstrate the importance of these amino acid residues in the
maintenance of carrier function; in particular, the binding of reduced folates.
| |
Materials and Methods |
|---|
|
|
|---|
Chemicals.
[3',5',7-3H]-(6S)-5-formyl-THF and
[3',5',7-3H]-(6S)-5-methyl-THF were
obtained from Moravek Biochemicals (Brea, CA);
[3',5',7-3H]-MTX was obtained from Amersham
Pharamcia Biotech (Piscataway, NJ). Folates were purified by high
performance liquid chromatography before use (Fry et al., 1982
).
Nonlabeled reduced folates were racemic. All other reagents were
obtained in the highest purity available from various commercial sources.
Construction of Plasmids.
Mutations were generated using
overlapping PCR (Ho et al., 1989
) with Pfu DNA polymerase
(Stratagene, La Jolla, CA). In all the PCR reactions, pSRC was used as
the template. pSRC plasmid was produced by subcloning the RFC1 coding
sequence into the pcDNA3.1 mammalian expression vector (Invitrogen, San
Diego, CA). The RFC1 coding sequence was obtained from the template
pPGK-RFC1 plasmid (Brigle et al., 1995
) by PCR with the following
primers: upstream GCGGATCCACCATGGTGCCCACTGGCCAGGTG and downstream
GCCTCGAGTCACAGCCCCGCCCAGGCAAAGCAG containing the
indicated BamHI and XhoI restriction sites
(underlined), respectively. The BamHI-primer contained the
start codon and the XhoI-primer contained the stop codon
(marked in bold). The PCR fragment was digested with
BamHI/XhoI restriction enzymes and subcloned into
the pcDNA3.1 expression vector. To generate the site-directed mutants,
two overlapping upstream and downstream fragments containing the
desired mutations were generated and then used for PCR-fusion [for
details see Ho et al. (1989)
]. BamHI- and XhoI-
containing primers described above were used as flanking primers. To
create specific substitutions, the nucleotide pairs represented in
Table 1 were used as internal primers
that carried the mutations. PCR-fused fragments harboring the specific
mutations within the full-length RFC1 cDNA were subcloned into the
pcDNA3.1 vector using BamHI/XhoI restriction
sites. Single mutations in all constructs were verified by sequencing
the entire RFC1 coding region on automated sequencer models ABI 373A
and ABI 377 (PerkinElmer Corporation, Norwalk, CT) in the
DNA-Sequencing Facility of the Albert Einstein Comprehensive Cancer
Center.
|
Cell Culture Conditions and Generation of Cell Lines.
Cells
were grown in RPMI 1640 medium containing 2.3 µM folic acid,
supplemented with 10% bovine calf serum (HyClone, Logan, UT), 2 mM
glutamine, 20 µM 2-mercaptoethanol, 100 U/ml penicillin, and 100 µg/ml streptomycin. All cell lines expressing mutant RFC1s were
obtained by transfection of the MTXrA line, which
lacks functional carrier, with DNA plasmids containing site-directed
RFC1 mutants as reported previously (Brigle et al., 1995
). Briefly,
1 × 107 MTXrA cells
were electroporated (300 V, 800 µF) with 40 µg of circular plasmid
and selected in RPMI 1640 medium containing 750 µg/ml G418. Lines
were isolated by subsequent cloning on soft agar (Kuroki, 1973
).
Northern Analyses.
Total RNA was isolated using TRIzol
reagent (Life Technologies, Inc., Gaithersburg, MD) and 30 µg of RNA
was fractionated by electrophoresis on 1% formaldehyde-agarose gels.
Transfer and hybridization was performed as described (Brigle et al.,
1995
). RFCI mRNA was quantified by analysis on a PhosphorImager
(Molecular Dynamics, Sunnyvale, CA).
Western Analysis.
A polyclonal antibody, AE390, to the
distal C terminus of murine RFC1 (Met499 through
Ala512) was used to probe both total cell lysate
and plasma membranes, as reported previously (Zhao et al., 2000
). For
total lysate preparation, cells (3 × 107)
were harvested, washed twice with HBS (20 mM HEPES, 140 mM NaCl, 5 mM
KCl, 2 mM MgCl2, 5 mM glucose, pH 7.4 at 0°C)
and suspended in 100 µl of the same solution containing 10 µl of
protease inhibitor (P-8340; Sigma Chemical, St. Louis, MO). The cell
suspension was sonicated for 20 s in a tube submerged in ice
water. Plasma membranes were extracted as reported, except a protease
inhibitor cocktail (P8340) at a dilution of 1 to 1000 was used instead
of 1 mM phenylmethylsulfonyl fluoride (Henderson and Zevely, 1984
).
Protein concentrations of the total lysate and plasma membranes were
determined with the BCA Protein Assay Kit (Pierce, Rockford, IL). The
proteins were dissolved in a SDS-polyacrylamide gel electrophoresis
loading buffer [60 mM Tris, 10% glycerol (v/v), 2% SDS, and trace
bromphenol blue, pH 6.8] without heating and resolved on a 12%
SDS-polyacrylamide gel. The proteins were transferred to polyvinylidene
difluoride transfer membranes and processed by the enhanced
chemiluminescence ECL Plus Western blotting detection system, both
obtained from Amersham.
Transport Studies.
Influx measurements were performed by the
method described previously (Zhao et al., 1997
). Cells were harvested,
washed twice with HBS (20 mM HEPES, 140 mM NaCl, 5 mM KCl, 2 mM
MgCl2, and 5 mM glucose, pH 7.4) and resuspended
in HBS to 1.5 × 107 cells/ml. Cell
suspensions were incubated at 37°C for 25 min, then uptake was
initiated by the addition of [3H]MTX,
[3H]5-formyl-THF, or
[3H]5-methyl-THF and samples were taken at the
indicated times. Uptake was terminated by injection of 1 ml of cell
suspension into 9 ml of ice-cold HBS buffer. Cells were collected by
centrifugation, washed twice with ice-cold HBS and processed to
determine intracellular tritium (Fry and Goldman, 1982
). For all influx
measurements, uptake intervals were adjusted to ensure that initial
rates of MTX, 5-formyl-THF, and 5-methyl-THF uptake were sustained. For studies that assessed the effect of extracellular chloride on MTX
influx, HBS was replaced with a HEPES buffer containing 190 mM HEPES, 5 mM glucose, 5 mM KCl, and 2 mM MgCl2, pH 7.4. In
some studies, HEPES-sucrose-MgO buffer (20 mM HEPES and 235 mM sucrose, pH 7.4, with MgO) or a mixture with HBS were used. All buffers were
adjusted to an osmolarity of 290 mmol/kg.
| |
Results |
|---|
|
|
|---|
Mutagenesis and Cell Line Generation.
Conserved positively
charged amino acids predicted to reside in the transmembrane domains of
RFC1 were identified by comparison of protein sequences from different
species aligned by the Clustal method (Higgins and Sharp, 1988
).
Arginines at positions 26, 42, 131, 155, and 366, and lysines at
positions 322 and 404, are conserved in the mammalian RFC1 genes cloned
to date; among them, arginines 26, 42, 131, and 366 were invariant in
these species as well as in Caenorhabditis elegans (Fig.
1). Each of these amino acid residues was
replaced with leucine by site-directed PCR mutagenesis. Constructs containing a single mutated carrier were transfected into the MTXrA line, which is deficient in endogenous RFC1
function because of the substitution of a proline for alanine at
position 130 in the 3rd transmembrane domain (Brigle et al., 1995
).
|
|
|
MTX Influx Properties in Transfected Lines.
Transfectants were
assessed for their capacity to transport MTX. Four among seven mutants
demonstrated MTX transport activity (Fig.
3, Table 2). There was no detectable
increase in MTX influx in the MTXrA-R131L,
MTXrA-R155L, and
MTXrA-R366L transfectants compared with influx in
the MTXrA line, despite the high level of mutated
proteins present in the plasma membrane (see above and Fig. 2C).
|
|
|
|
|
The Impact of RFC1 Mutations on the Inhibitory Effects of Anions on
MTX Influx.
A variety of inorganic and organic anions inhibit
RFC1-mediated transport and influx is stimulated when chloride is
removed from the assay buffer (Goldman, 1971
; Henderson and Zevely,
1983
). Additional studies were undertaken to determine whether
neutralization of the positive charge of amino acids in transmembrane
domains might alter these ionic effects. The degree of inhibition of
MTX influx by 10 mM ATP was not different among the transfectants compared with L1210 cells (Fig. 6, top).
MTX influx was increased by 250% in anion-deficient HEPES in L1210
cells; influx in the MTXrA-R26L,
MTXrA-R42L, and MTXrA-K332L
lines was increased ~200% under these conditions. However, MTX
influx was increased by only ~25% in HEPES buffer in the
MTXrA-K404L line (Fig. 6, top). Thus, the K404L
mutant carrier seems to be only minimally sensitive to the presence of
chloride in the buffer.
|
| |
Discussion |
|---|
|
|
|---|
For most facilitative carriers, charged amino acid residues within
transmembrane domains can play a crucial role in substrate recognition,
binding, and translocation across the cell membrane (Jarolim et al.,
1995
; Muller et al., 1996
; Steiner-Mordoch et al., 1996
; Fei et al.,
1997
; Kavanaugh et al., 1997
; Merickel et al., 1997
; Lanz and Erni,
1998
), as well as in the maintenance of tertiary carrier structure
(Kaback and Wu, 1997
; Karbach et al., 1998
). RFC1 contains 12 charged
amino acid residues within its 12 predicted transmembrane domains.
These residues include four arginines, two lysines, three histidines,
two glutamates, and one aspartate. RFC1 has optimal activity at neutral
pH; arginine and lysine are positively charged at neutral pH, and the
histidine charge varies depending on the surrounding amino acid residues.
Based upon the protein sequence alignment of RFC1 cDNA from all species cloned to date (human, hamster, mouse, rat, and C. elegans), arginines R26, R42, R155, and R366, all of which reside in transmembrane domains, are fully conserved. Two of these, R26 and R155, are positioned in or are in immediate proximity to the origin of the predicted first and fifth transmembrane domains, respectively (Fig. 1). R131 is conserved in mammalian RFC1 but not in nematode, where it is replaced by the oppositely charged glutamate. However, its predicted location in the middle of the fourth transmembrane domain, in a highly conserved region, suggests functional importance. Neither K332 nor K404 are fully conserved; amino acid substitutions at corresponding positions in the nematode do not retain a positive charge because they are replaced with glutamine and aspartate, respectively. However, because these amino acids are invariant in all known mammalian RFC1s, their functional importance was studied.
No MTX transport activity at all was detected in three of the seven
mutant lines: MTXrA-R131L,
MTXrA-R155L, and
MTXrA-R366L. The presence of carrier protein
within the cell membrane indicates that this was not caused by a
failure of protein trafficking or insertion. Hence, these residues seem
to be essential for folate substrate binding and/or translocation. This
is consistent with the mutation and loss of function of these residues
(R131H, R155Q, and R366H) under antifolate selective pressure with
chemical mutagenesis (Zhao et al., 1999b
). This loss of function may be
caused by the loss of critical interactions between the carboxyl group
of the folates and the positively charged arginine residues within the carrier (Gutknecht et al., 1998
; Lampinen et al., 1998
; Passoja et al.,
1998
). Substitution of leucine for arginine should not result in a
major distortion of the
-helical structure. However, loss of
intramolecular bonds created by oppositely charged amino acids within
transmembrane domains could disrupt the tertiary structure and function
of the carrier, as has been demonstrated for paired charged amino acid
residues in transmembrane domains of the lactose permease and the
vesicular monoamine transporter (VMAT2) (Kaback and Wu, 1997
; Merickel
et al., 1997
). Pairs of charged amino acid residues could also
participate directly in conformational changes associated with the
translocation of substrates. A scenario in which arginine/glutamate and
glutamate/histidine pair between helixes VIII and V has been proposed
as the basis for the mechanism of energy coupling in lactose permease
(Kaback and Wu, 1997
).
Studies from our laboratory and others have identified mutations in
cell lines under antifolate selection that markedly alter RFC1
transport activity and specificity. One cluster of mutations in the
first transmembrane domain at amino acids 45, 46, or 48 produces
profound alterations in substrate binding and/or mobility of the
carrier-substrate complex. Substitution of an asparagine for serine at
amino acid 46 produced a substrate-specific change in the mobility of
the carrier without any change in binding (Zhao et al., 1998b
). A
glutamate-to-lysine substitution at amino acid 45 resulted in a
generalized decrease in carrier mobility, a substantial increase in
folic acid binding, a lesser increase in 5-formyl-THF binding, and a
marked fall in MTX binding to RFC1 (Zhao et al., 1998a
). Substitution
of isoleucine for phenylalanine at amino acid 48 produced a marked
increase in RFC1 affinity for folic acid without significant change in
MTX or dideazatetrahydrofolate transport (Tse et al., 1998
).
Interestingly, the loss of charge at position 42 located near these
critical amino acids preserved some carrier function without a change
in affinity for MTX (Table 3) and with a small, but comparable, loss of
affinity for all the reduced folates (Fig. 4).
There were small and comparable decreases in affinities for folate
substrates among all the mutated carriers except for the MTXrA-K404L. In this line there was a marked fall
in affinity for reduced folates, whereas the
Ki value for folic acid was unchanged and
there was only a small decrease in affinity for MTX (Tables 3 and 4).
This discrimination between oxidized and reduced folates must be
related to an adverse change in the binding pocket for the reduced
folate cofactors that is influenced by the puckering of the pteridine
moiety and/or possible changes in the para-aminobenzoic acid
position that occur when the pteridine ring is reduced, as also happens
in the interaction between reduced folates and dihydrofolate reductase
(Bystroff et al., 1990
; Reyes et al., 1995
). For folic acid and MTX,
the planar configuration of the pteridine ring in the oxidized state
apparently preserves binding at the mutated sites. The observation that
mutations involving the first, tenth, and eleventh transmembrane
domains have qualitatively similar effects on binding of 5-formyl- and
5-methyl-THF and tetrahydrofolic acid suggests that all these residues
in the wild-type carrier are required to create a conformation
favorable for the reduced folate molecules.
Also unique to the K404L carrier was loss of the major portion of the
inhibitory effect of chloride on MTX influx that has been well
documented for the wild-type carrier (Goldman, 1971
; Henderson and
Zevely, 1983
; Yang et al., 1984
). This raises the possibility that the
interaction between the arginine 404 residue and chloride in the
wild-type carrier may be involved in the usual suppression of folate
binding by this anion and that the preservation of function in this
mutant is caused, in part, by the loss of chloride inhibition.
Interestingly, another mutation that alters the interaction between
chloride and RFC1, E45K in the first transmembrane domain, has been
reported for both human and mouse RFC1 (Jansen et al., 1998
; Zhao et
al., 1998a
). For this mutant carrier, influx falls in the
absence of chloride, but as chloride is added back to the buffer,
influx increases
changes that are caused by an alteration
in the mobility of the carrier. In the case of the E45K mutant, the
stimulatory effect of chloride is attributed to neutralization of the
substituted positively charged residue, permitting partial restoration
of carrier mobility
an effect that was also reproduced with other,
small inorganic anions (Zhao et al., 1998a
). The observation that the
inhibitory effect of ATP was the same in all the mutant carriers and
the wild-type carrier raises the possibility that RFC1 may possess
distinct binding sites for chloride and ATP (and possibly other organic anions).
| |
Footnotes |
|---|
Received November 1, 2000; Accepted January 17, 2001
This work was supported by Grants CA39807 and CA82621 from the National Cancer Institute.
Send reprint requests to: Dr. I. David Goldman, Albert Einstein Comprehensive Cancer Center, Albert Einstein College of Medicine, Chanin Two, 1300 Morris Park Avenue, Bronx, NY 10461. E-mail: igoldman{at}aecom.yu.edu
| |
Abbreviations |
|---|
RFC1, the reduced folate carrier; 5-formyl-THF, 5-formyltetrahydrofolate; 5-methyl-THF, 5-methyltetrahydrofolate; MTX, methotrexate; PCR, polymerase chain reaction; HBS, HEPES buffered saline.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
B. K. Biswal and R. S. Verma Differential Usage of the Transport Systems for Folic acid and Methotrexate in Normal Human T-Lymphocytes and Leukemic Cells J. Biochem., November 1, 2009; 146(5): 693 - 703. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hou and L. H. Matherly Oligomeric Structure of the Human Reduced Folate Carrier: IDENTIFICATION OF HOMO-OLIGOMERS AND DOMINANT-NEGATIVE EFFECTS ON CARRIER EXPRESSION AND FUNCTION J. Biol. Chem., January 30, 2009; 284(5): 3285 - 3293. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Deng, Z. Hou, L. Wang, C. Cherian, J. Wu, A. Gangjee, and L. H. Matherly Role of Lysine 411 in Substrate Carboxyl Group Binding to the Human Reduced Folate Carrier, as Determined by Site-Directed Mutagenesis and Affinity Inhibition Mol. Pharmacol., April 1, 2008; 73(4): 1274 - 1281. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hou, J. Ye, C. L. Haska, and L. H. Matherly Transmembrane Domains 4, 5, 7, 8, and 10 of the Human Reduced Folate Carrier Are Important Structural or Functional Components of the Transmembrane Channel for Folate Substrates J. Biol. Chem., November 3, 2006; 281(44): 33588 - 33596. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Hou, S. E. Stapels, C. L. Haska, and L. H. Matherly Localization of a Substrate Binding Domain of the Human Reduced Folate Carrier to Transmembrane Domain 11 by Radioaffinity Labeling and Cysteine-substituted Accessibility Methods J. Biol. Chem., October 28, 2005; 280(43): 36206 - 36213. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Witt, S. E. Stapels, and L. H. Matherly Restoration of Transport Activity by Co-expression of Human Reduced Folate Carrier Half-molecules in Transport-impaired K562 Cells: LOCALIZATION OF A SUBSTRATE BINDING DOMAIN TO TRANSMEMBRANE DOMAINS 7-12 J. Biol. Chem., November 5, 2004; 279(45): 46755 - 46763. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kneuer, K. U. Honscha, and W. Honscha Sodium-dependent methotrexate carrier-1 is expressed in rat kidney: cloning and functional characterization Am J Physiol Renal Physiol, March 1, 2004; 286(3): F564 - F571. [Abstract] [Full Text] |
||||
![]() |
H. Sadlish, F. M. R. Williams, and W. F. Flintoff Functional Role of Arginine 373 in Substrate Translocation by the Reduced Folate Carrier J. Biol. Chem., October 25, 2002; 277(44): 42105 - 42112. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Balamurugan and H. M. Said Functional role of specific amino acid residues in human thiamine transporter SLC19A2: mutational analysis Am J Physiol Gastrointest Liver Physiol, July 1, 2002; 283(1): G37 - G43. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||