|
|
|
|
Vol. 60, Issue 3, 595-602, September 2001
Mediates the Proliferative but Not the
Cytotoxic Dose-Dependent Effects of Two Major Phytoestrogens on Human
Breast Cancer Cells
Departments of Pharmaco-Biology (M.M., D.B.) and Cellular Biology (S.M., M.L.P., S.A.), University of Calabria, Rende-Cosenza, Italy; and Département de Biologie Cellulaire, Université de Genève, Sciences III, Genève, Switzerland (B.C., D.P.)
| |
Abstract |
|---|
|
|
|---|
Phytoestrogens are a chemically diverse group of compounds made by
plants that can have estrogenic effects in animals. Both tumorigenic
and antitumorigenic effects have been reported. Although estrogens
stimulate the growth of many breast tumors, there is a negative
correlation between the incidence of breast cancer and the
phytoestrogen-rich diet of certain Asian populations. To begin to
resolve this paradox, we have analyzed the estrogenic properties of
genistein and quercetin, two flavonoid phytoestrogens particularly
abundant in soybeans. Trans-activation experiments with
a transfected reporter gene for nuclear estrogen receptors (ER) show
strong activation of the endogenous ER
by both phytoestrogens in two
MCF7 human breast cancer cell lines. This is supported by the
observation that the two phytoestrogens induce the down-regulation of
ER
mRNA and protein levels. Using chimeric proteins consisting of
the hormone binding domains of ER
and ER
fused to the Gal4 DNA
binding domain, we have established that genistein and quercetin are
full estrogenic agonists of both ER isoforms. Ligand binding experiments with purified ER
and ER
confirm that the two
phytoestrogens are ER ligands. At concentrations that are sufficient to
obtain substantial transcriptional activity, they stimulate the
proliferation of two ER
-dependent breast cancer cell lines. At high
concentrations, such as those reached with a soy-rich diet, genistein
and quercetin are strong cytotoxic agents that even kill ER-independent
HeLa cells. Thus, the mode of action of phytoestrogens and the balance between being risk or chemopreventive factors for breast cancer may
depend on the dietary load.
| |
Introduction |
|---|
|
|
|---|
Breast
cancer is the most frequent malignancy of women in North America, where
every year about 200,000 new cases are diagnosed and 50,000 women die
from the disease (Lopez-Otin and Diamandis, 1998
). The age-adjusted
death rates from breast tumors are 2- to 8-fold lower in Asian
countries compared with the United States and Western Europe (Parker et
al., 1996
), which, together with migrant studies, suggests a primary
role of dietary factors in reducing cancer risk in Asian women
(Adlercreutz, 1995
). Epidemiological and case-control studies have
reported a negative correlation between breast cancer and the intake of
soy products and the urinary excretion of phytoestrogens (Ingram et
al., 1997
; Kurzer and Xu, 1997
). However, interpretations and
conclusions have been contradictory (Messina et al., 1997
; de Souza,
1998
; Heaton and Lewis, 1998
; Humfrey 1998
; Mangtani and Silva, 1998
;
Tesarik and Mendoza, 1998
).
The phytoestrogens genistein and quercetin (Fig.
1), abundantly present in soybeans,
vegetables, and fruit (Price and Fenwick, 1985
), have attracted
research interest and have been considered natural chemopreventive
agents (Larocca et al., 1990
; Peterson and Barnes, 1991
; Adlercreutz et
al., 1995
; Kuo, 1996
). Many different mechanisms have been proposed to
explain the antiproliferative effects exerted by these chemicals,
including direct inhibition of tyrosine kinase activity (Akiyama et
al., 1987
, and references therein), DNA-topoisomerase II (Markovits et
al., 1989
), angiogenesis (Fotsis et al., 1993
), and synthesis of
heat-shock proteins (Hansen et al., 1997
). Flavonoids such as genistein
and quercetin may prevent DNA damage as free radical scavengers (Wei et
al., 1993
); most importantly, however, they may act as partial estrogen
agonists or antagonists (Kuiper et al., 1997
; Barkhem et al., 1998
).
|
Significant amounts of soy are "hidden" in normal processed food.
In a recent study (Hargreaves et al., 1999
), none of the subjects
reported having knowingly consumed soy products despite displaying
significant serum levels of phytoestrogens. Nanomolar amounts of
phytoestrogens were measured in soy-supplemented premenopausal women
and seemed to induce an estrogenic response in the breast. For
postmenopausal women, it has also been reported that flavonoids may
have some estrogenic activities, inducing vaginal cell maturation (Wilcox et al., 1990
), reduction of hot flushes, and hepatic
cholesterol synthesis (Anderson et al., 1995
; Murkies et al., 1995
).
The effects of 17
-estradiol (E2) and related compounds are mediated
by two members of the nuclear receptor superfamily, the estrogen
receptors (ER)
and
. Upon ligand binding, they undergo a
conformational change allowing chromatin interaction and the regulation
of transcription of target genes (Jensen, 1995
). Estrogens stimulate
the proliferation of many breast tumor cells, which has led to the use
of such antiestrogens as hydroxytamoxifen for endocrine therapy. The
presence of ER
in breast tumor biopsies has been recognized as a
positive prognostic marker that correlates with higher survival rates
and lower risk of relapse (Lopez-Otin and Diamandis, 1998
).
Estrogenic compounds in the food, for example the natural flavonoids
genistein and quercetin, might influence breast cancer progression in a
dose-dependent fashion. To provide evidence for this hypothesis we have
used the estrogen-dependent human breast cancer cell line MCF7, its
hormone-independent variant MCF7SH (Kalkhoven et al., 1996
), and the
ER-negative HeLa cell line as model systems. We examined the ability of
genistein and quercetin (1) to induce the transactivation function of
ER
and ER
, (2) to modulate ER
mRNA and protein levels, (3) to
bind ER
and ER
, and (4) to exert either growth stimulatory or
antiproliferative effects at concentrations that are physiologically
achievable through dietary uptake.
| |
Materials and Methods |
|---|
|
|
|---|
Reagents. E2, genistein, quercetin, and hydroxytamoxifen (OHT) were purchased from Sigma (St. Louis, MO). Hydroxyflutamide (OHF) and ZK98299 (ZK) were a gift from Schering (Berlin, Germany).
Plasmids.
Firefly luciferase reporter plasmids used
were XETL (Bunone et al., 1996
) for the ERs and GK1 (Webb et al., 1998
)
for the Gal4 fusion proteins. The Renilla reniformis
luciferase expression vector pRL-CMV (Promega, Madison, WI) was used as
a transfection standard. Gal4 chimeras Gal-ER
, Gal-ER(R), Gal-ER(L),
Gal-ER(543/4A), Gal-ER(
F), and Gal-ER
were expressed from
plasmids GAL93.ER(G), GAL93.ER(R), GAL93.ER(L), GAL93.ER(G)ML543/4AA),
GAL93.ER(
F), and GAL93. ER
, respectively. They were constructed
by transferring the coding sequences for the hormone binding domain
(HBD) of ER
(amino acids 282-595) from HEG0 (Tora et al., 1989
),
pCMVhERG521R (Ekena et al., 1996
), pCMVhERL525A (Ekena et al., 1996
), a
PCR-mutagenized intermediate with the point mutations M543A-L544A, and
a PCR fragment lacking the coding sequences for the F domain and for
the ER
HBD (C-terminal 287 amino acids) from plasmid pCMV5-hER
(a
gift from J.-Å. Gustafsson) into the mammalian expression vector
pSCTEVGal93 (Seipel et al., 1992
).
Cell Culture.
Wild-type human breast cancer MCF7 (MCF7wt)
cells were a gift from E. Surmacz (Philadelphia, PA). MCF7wt and HeLa
cells were maintained in DMEM without phenol red supplemented with 10%
FCS. The variant cell line MCF7SH (Kalkhoven et al., 1996
) was
maintained in DMEM without phenol red supplemented with 5%
charcoal-stripped (CS) FCS. MCF7wt and HeLa, and MCF7SH cells to be
processed for immunoblot or RT-PCR assays were switched to DMEM
supplemented with 5% CS-FCS and 1% CS-FCS, respectively, 4 days
before treatments.
Transfections and Luciferase Assays. Cells were transferred into 24-well plates with 500 µl of regular growth medium/well the day before transfection. The medium was replaced with DMEM lacking phenol red as well as serum on the day of transfection, which was performed using the Fugene6 Reagent as recommended by the manufacturer (Roche Diagnostics, Mannheim, Germany) with a mixture containing 0.5 µg of reporter plasmid, 5 ng of pRL-CMV, and 0.1 µg of effector plasmid where applicable. After 5 to 6 h the medium was replaced again with serum-free DMEM lacking phenol red, ligands were added at this point, and cells were incubated for 20 to 24 h. Luciferase activity was then measured with the Dual Luciferase Kit (Promega) according to the manufacturer's recommendations. Firefly luciferase activity was normalized to the internal transfection control provided by the Renilla luciferase activity.
Ligand Binding Assay for ERs.
The ability of genistein and
quercetin to compete with [3H]E2 for binding to
ER
and ER
was evaluated and compared with that of E2. Two
picomoles of purified recombinant human ER
and ER
proteins
(PanVera Corp., Madison, WI), each in 20 mM HEPES, pH 7.4, 1.5 mM EDTA,
0.5 mM dithiothreitol, and 10% (v/v) glycerol, were incubated with 1 nM [2,4,6,7-3H]E2 (72 Ci/mmol; Amersham
Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK ) in the
presence of serial dilutions of unlabeled E2, genistein, or quercetin
for 20 to 22 h at 4°C. Bound and free radioligands were
separated on Sephadex G-25 PD-10 columns. The amount of receptor-bound
[3H]E2 was determined by liquid scintillation
counting (OptiPhase, HiSafe 3 and 1409; Wallac, Inc., Gaithersburg,
MD). Relative counts per min were plotted against the concentration of
the ligand, and data were evaluated with the use of a nonlinear,
four-parameter logistic model to estimate the
IC50 value (the concentration of competitor at
half-maximal specific binding).
RT-PCR.
The evaluation of gene expression was performed by
semiquantitative RT-PCR as we have described previously (Maggiolini et al., 1999b
). For ER
, pS2, and the internal control gene 36B4, the
primers were: 5'GTGTACAACTACCCCGAGG3' (ER forward) and
5'CAGATTCATCATGCGGAACCGAGATG3' (ER reverse), 5'
TTCTATCCTAATACCATCGACG3' (pS2 forward) and 5'TTTGAGTAGTCAAAGTCAGAGC3' (pS2 reverse), and 5'CTCAACATCTCC-CCCTTCTC3' (36B4 forward) and 5'CAAATCCCATATCCTCGT- CC3' (36B4 reverse) to yield products of 1172, 210, and 408 bp, respectively, with 20, 15, and 15 PCR cycles, respectively.
Immunoblotting.
MCF7wt and MCF7SH cells were grown in 10-cm
dishes and exposed to ligands for 24 h before lysis in 500 µl of
50 mM HEPES, pH 7.5, 150 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 10% glycerol, 1% Triton X-100, a mixture of protease
inhibitors (Aprotinin, PMSF), and Na-orthovanadate. Equal amounts of
total protein were resolved on a 10% SDS-polyacrylamide gel. Proteins
were transferred to a nitrocellulose membrane, probed with the
antibodies F-10 against ER
and
-actin (Santa Cruz, Biotechnology,
Santa Cruz, CA), and revealed using the enhanced chemiluminescence
system (ECL, Amersham Pharmacia Biotech).
Proliferation Assays. For quantitative proliferation assays 1 × 104 MCF7wt, MCF7SH, or HeLa cells were seeded in 24-well plates in regular growth medium. Cells were washed extensively once they had attached and further incubated in medium without serum for 24 h. On the second day, the medium of MCF7wt and HeLa cells was changed and supplemented with 5% CS-FCS, and the medium of MCF7SH cells was supplemented with 1% CS-FCS. Ligands were added at this point; thereafter, medium was changed every day (with ligands). On day six, cells were trypsinized and counted in a hemocytometer.
| |
Results |
|---|
|
|
|---|
Genistein and Quercetin Activate Endogenous ER
.
We began by
examining whether a transiently transfected ER reporter gene is able to
respond to the flavonoids genistein and quercetin (Fig. 1). The
reporter plasmid XETL carries firefly luciferase sequences under the
control of an estrogen response element upstream of the thymidine
kinase promoter. As an internal transfection control, we cotransfected
a plasmid that expresses Renilla luciferase, which is
enzymatically distinguishable from firefly luciferase, from the strong
cytomegalovirus enhancer/promoter. Figure
2 shows the results obtained with two
related human breast cancer cell lines that exclusively express ER
and no ER
as judged by RT-PCR (data not shown): MCF7wt and its
variant MCF7SH. The latter expresses 10-fold elevated levels of ER
,
which might contribute to its unique properties. Although MCF7SH cells
can proliferate in a seemingly estrogen-independent fashion, they are
still dependent on ER
and blocked by antiestrogens (Kalkhoven et
al., 1996
). Moreover, MCF7SH cells support E2-induced reporter gene
expression with exquisite sensitivity and efficacy ("fold
induction") (Fig. 2A; see also Maggiolini et al., 1999a
).
|
from these cells. Both
phytoestrogens are strong inducers of XETL expression, albeit at higher
ligand concentrations and with somewhat reduced efficacies. Although
maximal stimulation by genistein and quercetin is reached only at 1 µM, 10 nM is sufficient to achieve a substantial induction (20- and
14-fold, respectively). The same transfection experiments with MCF7wt
cells (Fig. 2B) confirmed the ability of both phytoestrogens to
activate ER reporter gene expression, albeit with reduced maximal efficacy.
These transfection experiments suggested that the two phytoestrogens
signal through the endogenous ER
rather than another steroid
receptor. This was verified with antihormones in parallel experiments.
The antiestrogen OHT abolishes the activation by E2 and by both
phytoestrogens (Fig. 2C) whereas the antiandrogen OHF, and the
anti-progestin and antiglucocorticoid ZK 98'299 have no effect (Fig.
2C). Thus, the two phytoestrogens seem to be able to activate ER
directly.
Transcriptional Activation of ER
and ER
by Genistein and
Quercetin in a Heterologous System.
To provide further evidence
that genistein and quercetin trans-activate ER
directly,
and to examine the response of the other ER isoform, ER
, we turned
to a completely heterologous system. Nuclear receptors such as ER
contain two main transcription activation functions (AF): the
N-terminal AF1 and the C-terminal, HBD-associated AF2. The former is
constitutively active and not further stimulated by phytoestrogens
(data not shown), whereas the latter is known to be dependent on a full
agonist (Kumar et al., 1987
). Chimeric proteins consisting of the
heterologous DNA binding domain of the yeast transcription factor Gal4
and the ER
or ER
HBDs respond to both E2 and phytoestrogens in a
transient expression assay in HeLa cells (Fig.
3A). These results demonstrate that the
HBD of each ER isoform is sufficient for the response and that
genistein and quercetin are AF2 agonists.
|
HBD mutants with the use of Gal4
fusion proteins (Fig. 3B). The two point mutants L525A and G521R that
require considerably higher E2 concentrations for activation (Ekena et
al., 1996
F, which lacks the F-domain located
C-terminal to the HBD core, displays a robust response to both E2 and
the phytoestrogens. These data argue that the transcriptional response
to phytoestrogens depends on an intact hormone binding pocket and that
it is mediated by AF2 (and presumably also AF1 in the context of the
full-length receptor).
Genistein and Quercetin Down-Regulate ER
mRNA and Protein.
E2 is known to down-regulate the levels of ER
in breast cancer cell
lines through an increased turnover of the E2-activated ER
protein
and a reduced transcription rate of its own gene (Santagati et al.,
1997
). This down-regulation represents an additional hallmark of
activation of ER
by an agonist. This prompted us to investigate whether ER
mRNA and protein levels are sensitive to phytoestrogens in MCF7wt cells. ER
mRNA levels were compared by semiquantitative RT-PCR and standardized on the mRNA levels of the house-keeping gene 36B4 (Fig. 4A and B). A treatment
for 24 h with 10 µM genistein or quercetin down-regulates the
levels of ER
mRNA. As in the trans-activation assays
(Fig. 2B), the rank order of efficacy is E2 > genistein > quercetin. Using the same treatments, we also observed a dose-dependent
down-regulation of ER
protein content (Fig. 4C and D) that is
independent of new protein synthesis (Fig. 4E). At 100 nM, the
down-regulation is again most obvious with E2 and genistein, whereas
higher concentrations are required for quercetin.
|
Genistein but Not Quercetin Up-Regulates pS2 mRNA.
Having
determined that both phytoestrogens down-regulate ER
mRNA and
protein, we examined the induction of pS2, a well-known endogenous ER
target gene, by RT-PCR. Of the two phytoestrogens, only genistein is
able to induce an up-regulation of pS2 mRNA (Fig. 4, A and B). Thus,
structurally and functionally similar phytoestrogens may have
overlapping and yet distinct effects on endogenous targets.
Genistein and Quercetin Are Ligands for Both ER
and ER
.
The aforementioned results strongly suggested that the two
phytoestrogens are ER ligands. This issue was examined directly by a
binding competition experiment with purified recombinant human ER
and ER
proteins. We found that genistein and quercetin compete with
the radiolabeled E2 tracer for binding to the ERs in a
concentration-dependent manner (Fig. 5).
Half-maximal competition for ER
and ER
occurs at 756 and 1015 nM
and 22 and 113 nM with genistein and quercetin, respectively. Whereas
our data demonstrate that both phytoestrogens are direct ligands for
both ER
and ER
, quercetin is clearly a poorer binder of ER
,
because competition is barely more than 60% even at the highest
concentration (10 µM). We found the apparent affinities of ER
compared with ER
to be ~34- and ~9-fold higher for genistein and
quercetin, respectively. This is largely consistent with previous
reports on ER isoform-specific preferences in phytoestrogen binding
(Kuiper et al., 1997
; Barkhem et al., 1998
) (see under
Discussion).
|
Both Genistein and Quercetin Display a Biphasic Effect on
Proliferation of Breast Cancer Cells.
Having established that
genistein and quercetin are ER ligands and activators, we wanted to
evaluate a more complex physiological response. We analyzed the effects
of the phytoestrogens on the proliferation of estrogen-dependent MCF7wt
and estrogen-stimulated MCF7SH cells. Cells were treated for 5 days
with the different ligands, counted, and compared with untreated cells.
At concentrations up to 1 µM, both phytoestrogens stimulate the
proliferation of MCF7wt cells (Fig. 6A);
this can be inhibited by the antiestrogen hydroxytamoxifen (Fig. 6B),
confirming that the effect is ER
-mediated. At 10 µM and more,
genistein and quercetin addition leads to a severe drop in cell numbers
indicative of massive cell death (Fig. 6A), an inhibitory effect that
cannot be reversed by the addition of E2 (Fig. 6B). The results were
qualitatively similar to those of MCF7SH cells, except that only the
highest dose of genistein (100 µM) interferes with proliferation
(Fig. 6, A and B), whereas high levels of E2 (up to 100 µM) have no
cytotoxic effect (data not shown). Further tests with intermediate
concentrations indicate that there might be a rather sharp transition
from growth stimulatory to cytotoxic doses (data not shown).
|
| |
Discussion |
|---|
|
|
|---|
Our results provide mechanistic insights into the mode of action
of two very abundant dietary phytoestrogens. At relatively low
concentrations, genistein and quercetin are full agonists for ER
and
ER
as well as for the proliferation of ER-dependent breast cancer
cells. In the same cells, they are cytotoxic in an ER-independent
fashion at concentrations that are reached only in humans with a
soy-rich diet. In combination, these observations suggest an
explanation for the confusing state of the literature on the potential
role of dietary phytoestrogens in breast cancer (Ingram et al., 1997
;
Kurzer and Xu, 1997
; Messina et al., 1997
; Heaton and Lewis, 1998
;
Humfrey 1998
; Mangtani and Silva, 1998
; Tesarik and Mendoza, 1998
).
We have presented several lines of evidence that the flavonoids
genistein and quercetin are full agonists and ligands of both ER
isoforms: 1) They potently activate endogenous ER
in two different breast cancer cell lines, 2) they autoregulate ER
mRNA and protein levels, 3) they activate the agonist-dependent AF2
trans-activation functions of ER
and ER
in the context
of chimeric proteins with the Gal4 DNA binding domain, and this agonist
effect depends on an intact hormone binding pocket and AF2, 4) they
compete with E2 for binding to purified ER
and ER
. In all these
assays, they qualitatively behave like the physiological estrogenic
ligand E2. Quantitatively similar effects are typically achieved only at concentrations that are 2 to 3 orders of magnitude higher but can be
reached physiologically with a phytoestrogen-rich diet (see below).
It has previously been reported that structurally distinct
phytoestrogens, including the flavonoids genistein and quercetin, exert
their estrogenic effects through direct binding and activation of the
ERs (Kuiper et al., 1997
; Barkhem et al., 1998
). Genistein has been
recognized as an ER
-selective ligand because of its higher apparent
affinity for this isoform (Kuiper et al., 1997
, see also Fig. 5).
Moreover, the structure of a genistein-ER
HBD cocrystal has been
solved, establishing unambiguously that this flavonoid is an ER
ligand that is bound in the same cavity as E2 (Pike et al., 1999
). Our
data, although qualitatively consistent with these reports, extend them
in several important points. They demonstrate that these two
phytoestrogens are full and strong ER agonists. In our
trans-activation assays that monitor activation of
endogenous ER
in breast cancer cells, both genistein and quercetin are strong activators both for their potencies ("dose dependence of
response") and their efficacies ("fold induction"). Differences in experimental approaches (endogenous versus transfected ERs) and cell
type may explain why other authors (Kuiper et al., 1997
) have missed
the strong agonist activity of quercetin. Its only slightly lower
binding affinities for ERs compared with genistein (Fig. 5) may have
been overlooked in previous surveys (Kuiper et al., 1997
), perhaps
because it had not been tested in hormone binding assays with soluble
receptor. Based on our results with the Gal4 chimeras, it is clear that
genistein and quercetin are full ER agonists. Unlike partial agonists
such as the anti-estrogen OHT, they are able to activate AF2, which is
known to be associated with a characteristic repositioning of helix 12 of the ligand-binding domain. Unexpectedly, the ER
-genistein crystal
structure was found to resemble that of an antagonist-bound HBD (Pike
et al., 1999
). Our results lend further support to the speculation that a crystallization artifact may have affected this structure.
Most importantly, we show that both genistein and quercetin are full
ER
agonists in a more complex biological system. At concentrations
that are sufficient to elicit substantial transcriptional activity in
transfection experiments (
1 µM), they both stimulate the
proliferation of two breast cancer cell lines that are dependent on
ER
. This confirms previous reports on genistein (Hsieh et al., 1998
)
and extends them to quercetin. The potencies and efficacies of
genistein and quercetin are particularly striking with the MCF7 variant
cell line MCF7SH. It is hypersensitive for E2, but responds very
efficaciously to all ER agonists (see also Maggiolini et al., 1999a
).
Genistein or quercetin (10 nM) already induce reporter gene expression
10- to 20-fold and stimulate proliferation 4-fold. Because long-term
estrogen-deprived breast tumor cells, for which MCF7SH cells may be a
model, can be extremely sensitive to E2 (Kalkhoven et al., 1996
; Shim
et al., 2000
), these findings illustrate that even very low levels of
phytoestrogens may be able to stimulate the growth of certain breast tumors.
The proliferative responses of our breast cancer cell lines to the two
phytoestrogens are biphasic. At concentrations
10 µM, both
phytoestrogens become cytotoxic. Cell death becomes apparent by about
72 h (data not shown) whereas exposure to 10 µM for only 24 h is tolerated, resulting, for example, in maximal transcriptional stimulation in a trans-activation assay. Because this
treatment also kills ER-negative and independent HeLa cells, this
probably involves nonspecific inhibitory effects such as the well known inhibition of tyrosine kinases (Akiyama et al., 1987
, and references therein).
On the other hand, the consumption of soy products has been associated
with low rates of hormone-dependent and hormone-independent cancers,
and genistein has been shown to inhibit the growth of a wide variety of
tumor cell types in culture (Peterson, 1995
, and references therein).
Our work offers a framework for explaining the negative correlation
between a soy-rich diet and low incidence of breast cancer in some
Asian countries. Indeed, phytoestrogen concentrations can be above 5 µM in adults with a typical Japanese diet (Morton et al., 1994
) or in
infants fed exclusively with soy-based formula (Setchell et al., 1997
).
The maximal concentration that can be reached physiologically has been
reported to be 18.5 µM (Barnes, 1995
). At these concentrations, one
would expect phytoestrogens to be primarily antitumorigenic. They may
act directly by being cytotoxic through inhibition of tyrosine kinases
and topoisomerase II (Akiyama et al., 1987
; Markovits et al., 1989
)
and, in the case of quercetin, may also act as phosphoinositide
3-kinase inhibitors (Walker et al., 2000
), and/or indirectly through
their antiangiogenic and antioxidant effects (Fotsis et al., 1993
; Wei
et al., 1993
; Hansen et al., 1997
). In contrast, exposure to
phytoestrogen levels below 1 µM would be expected to have estrogenic
effects (Hsieh et al., 1998
). Upon long-term exposure to phytoestrogen
levels remaining below 1 µM, potentially they may promote breast
cancer development and stimulate the progression in breast cancer
patients with estrogen-dependent tumors. One may have to conclude that one should either eat a lot of phytoestrogen-rich food or as little as
possible. Advocating phytoestrogen-rich food or even phytoestrogen pills without medical follow-up for postmenopausal women should be
considered critically. Moreover, it also follows that the diet of
breast cancer patients should be matched carefully with their particular tumor types.
| |
Acknowledgments |
|---|
We are grateful to Drs. Raffaella Le Donne and Francesca Gigliotti for lab assistance. We thank Dr. Pasquale Cicirelli for technical support.
| |
Footnotes |
|---|
Received March 3, 2001; Accepted
This work was supported by grants from Regione Calabria and U.E. (P.O.P.), MURST-CNR (Biotechnology Program L. 95/95) and from the Swiss National Science Foundation, the Krebsforschung Schweiz and the Canton de Genève.
Prof. Sebastiano Andò, Dipartimento Farmaco-Biologico, Università della Calabria, 87036 Rende (CS), Italy. E-mail: sebando{at}tin.it
| |
Abbreviations |
|---|
ER, estrogen receptor; OHT, hydroxytamoxifen; OHF, hydroxyflutamide; ZK, ZK98299; HBD, hormone binding domain; PCR, polymerase chain reaction; wt, wild-type; FCS, fetal calf serum; DMEM, Dulbecco's modified Eagle's medium; CS, charcoal-stripped; RT, reverse transcription; AF, activation function.
| |
References |
|---|
|
|
|---|
and estrogen receptor
to partial estrogen agonists/antagonists.
Mol Pharmacol
54:
105-112
-resistant and -sensitive breast-tumor cells.
Int J Cancer
65:
682-687[Medline].
and
.
Endocrinology
138:
863-870
.
Cancer Res
59:
4864-4869
a review.
Food Addit Contam
2:
73-106[Medline].This article has been cited by other articles:
![]() |
N. Obi, J. Chang-Claude, J. Berger, W. Braendle, T. Slanger, M. Schmidt, K. Steindorf, W. Ahrens, and D. Flesch-Janys The Use of Herbal Preparations to Alleviate Climacteric Disorders and Risk of Postmenopausal Breast Cancer in a German Case-Control Study Cancer Epidemiol. Biomarkers Prev., August 1, 2009; 18(8): 2207 - 2213. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Korde, A. H. Wu, T. Fears, A. M.Y. Nomura, D. W. West, L. N. Kolonel, M. C. Pike, R. N. Hoover, and R. G. Ziegler Childhood Soy Intake and Breast Cancer Risk in Asian American Women Cancer Epidemiol. Biomarkers Prev., April 1, 2009; 18(4): 1050 - 1059. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Pugazhendhi, K A Watson, S Mills, N Botting, G S Pope, and P D Darbre Effect of sulphation on the oestrogen agonist activity of the phytoestrogens genistein and daidzein in MCF-7 human breast cancer cells J. Endocrinol., June 1, 2008; 197(3): 503 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.B. Moore, L. Castro, L. Yu, X. Zheng, X. Di, M.I. Sifre, G.E. Kissling, R.R. Newbold, C.D. Bortner, and D. Dixon Stimulatory and inhibitory effects of genistein on human uterine leiomyoma cell proliferation are influenced by the concentration Hum. Reprod., October 1, 2007; 22(10): 2623 - 2631. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Eliades, V Gioni, D Kletsas, A. Athanasiou, and G Eliades Oestrogenicity of orthodontic adhesive resins Eur J Orthod, August 1, 2007; 29(4): 404 - 407. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Rice and S. A Whitehead Phytoestrogens and breast cancer -promoters or protectors? Endocr. Relat. Cancer, December 1, 2006; 13(4): 995 - 1015. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gallo, C. Ferlini, M. Fabrizi, S. Prislei, and G. Scambia Lack of stimulatory activity of a Phytoestrogen-containing soy extract on the growth of breast cancer tumors in mice Carcinogenesis, July 1, 2006; 27(7): 1404 - 1409. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Vivacqua, D. Bonofiglio, A. G. Recchia, A. M. Musti, D. Picard, S. Ando, and M. Maggiolini The G Protein-Coupled Receptor GPR30 Mediates the Proliferative Effects Induced by 17{beta}-Estradiol and Hydroxytamoxifen in Endometrial Cancer Cells Mol. Endocrinol., March 1, 2006; 20(3): 631 - 646. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Totta, F. Acconcia, F. Virgili, A. Cassidy, P. D. Weinberg, G. Rimbach, and M. Marino Daidzein-Sulfate Metabolites Affect Transcriptional and Antiproliferative Activities of Estrogen Receptor-{beta} in Cultured Human Cancer Cells J. Nutr., November 1, 2005; 135(11): 2687 - 2693. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Bemis, J. L. Capodice, M. Desai, R. Buttyan, and A. E. Katz A Concentrated Aglycone Isoflavone Preparation (GCP) That Demonstrates Potent Anti-Prostate Cancer Activity In vitro and In vivo Clin. Cancer Res., August 1, 2004; 10(15): 5282 - 5292. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maggiolini, A. Vivacqua, G. Fasanella, A. G. Recchia, D. Sisci, V. Pezzi, D. Montanaro, A. M. Musti, D. Picard, and S. Ando The G Protein-coupled Receptor GPR30 Mediates c-fos Up-regulation by 17{beta}-Estradiol and Phytoestrogens in Breast Cancer Cells J. Biol. Chem., June 25, 2004; 279(26): 27008 - 27016. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Cross, E. Kallay, D. Lechner, W. Gerdenitsch, H. Adlercreutz, and H. J. Armbrecht Phytoestrogens and Vitamin D Metabolism: A New Concept for the Prevention and Therapy of Colorectal, Prostate, and Mammary Carcinomas J. Nutr., May 1, 2004; 134(5): 1207S - 1212S. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Pocar, R. Augustin, F. Gandolfi, and B. Fischer Toxic Effects of In Vitro Exposure to p-tert-Octylphenol on Bovine Oocyte Maturation and Developmental Competence Biol Reprod, August 1, 2003; 69(2): 462 - 468. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.A. Whitehead and M. Lacey Phytoestrogens inhibit aromatase but not 17{beta}-hydroxysteroid dehydrogenase (HSD) type 1 in human granulosa-luteal cells: evidence for FSH induction of 17{beta}-HSD Hum. Reprod., March 1, 2003; 18(3): 487 - 494. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maggiolini, A. Vivacqua, A. Carpino, D. Bonofiglio, G. Fasanella, M. Salerno, D. Picard, and S. Ando The Mutant Androgen Receptor T877A Mediates the Proliferative but Not the Cytotoxic Dose-Dependent Effects of Genistein and Quercetin on Human LNCaP Prostate Cancer Cells Mol. Pharmacol., November 1, 2002; 62(5): 1027 - 1035. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||