![]() |
|
|
Vol. 60, Issue 4, 725-731, October 2001
Department of Molecular and Cellular Pharmacology (J.L.K., L.T.P.), Department of Physiology and Biophysics, and Neuroscience Program (I.M.D.), University of Miami School of Medicine, Miami, Florida
| |
Abstract |
|---|
|
|
|---|
m1-Toxin1 binds specifically and irreversibly to M1 muscarinic receptors and can slow the dissociation of [3H]N-methylscopolamine ([3H]NMS) from these receptors. Yet only 7 of its 65 amino acids are not conserved in six other mamba toxins that bind reversibly to M2-M5 muscarinic receptors. Two of these seven residues (Phe38, Lys65) were mutated to corresponding residues of the other toxins (Ile38, Glu65), to evaluate amino acids in m1-toxin1 that confer its remarkable affinity and specificity. The cDNA for m1-toxin1 was cloned from venom gland mRNA using polymerase chain reaction (PCR)-based techniques. Its nucleotide sequence is remarkably similar to those of other short-chain neurotoxins. The cDNAs for mutant toxins Phe38 to Ile38 (F38I) and Lys65 to Glu65 (K65E) were constructed by PCR-based techniques. Each cDNA was expressed in yeast, and the toxins were purified from yeast media by cation-exchange and reversed phase chromatography. Recoveries were 40 to 152 µg/l. Recombinant m1-toxin1 was identical to the native toxin (observed mass: 7471 Da; irreversible blockade of [3H]NMS binding to cloned M1 receptors at 25°C; no blockade of M2-M5 receptors; 6-fold slowing of [3H]NMS dissociation at 37°C). F38I also bound specifically to M1 receptors, but reversibly and without effect on NMS dissociation. Thus, Phe38 contributes to the stability of toxin-receptor complexes, but not to M1-selectivity. K65E bound selectively and irreversibly to unliganded M1 receptors but did not slow NMS dissociation. It is suggested that the C-terminal Lys65 of m1-toxin1 may contact an outer loop of the M1 receptor.
| |
Introduction |
|---|
|
|
|---|
The
venom of the green mamba, Dendroaspis angusticeps, contains
a number of trace isotoxins of m1-toxin (Max et al., 1993a
,b
,c
), of
which m1-toxin1 (Fig. 1; the renamed
original m1-toxin) is the most prevalent (Carsi and Potter, 2000
).
m1-Toxin1 is a remarkably useful ligand for studying genetically
defined M1 muscarinic receptors. It binds
specifically to otherwise unliganded M1 receptors
in vitro and in vivo (Max et al., 1993a
,c
; Liang et al., 1999
; Carsi and Potter, 2000
). Binding of the toxin completely blocks the subsequent binding of the antagonist
[3H]N-methylscopolamine
([3H]NMS) for several hours at 4-37°C (Max
et al., 1993b
; Carsi and Potter, 2000
), and prevents the action of
muscarinic agonists on M1 receptors (Max et al.,
1993c
; Cuevas et al., 1997
; Marino et al., 1998
; Rouse et al., 1999
,
2000
). When applied after [3H]NMS, the toxin
forms toxin-NMS-receptor complexes that are quite stable in membranes
and completely stable in digitonin-solution (Max et al., 1993b
). The
toxin must therefore bind allosterically to the unique extracellular
loops and/or N terminus of M1 receptors, which
are located outside the receptor pocket that contains the binding site
for NMS. 125I-m1-Toxin1 dissociates slowly from
toxin-receptor complexes at 37°C, indicating that toxin binding is
not covalent (Potter, 2001
).
|
The binding properties of m1-toxin1 indicate an exceptionally good
molecular fit between the loops and/or ends of the toxin, and the
extracellular loops and/or N terminus of M1
receptors (Max et al., 1993b
). The present studies are an initial step
toward characterizing this fit, using site-directed mutants of
m1-toxin1 to establish toxin residues that are essential for toxin
binding. Future studies of interactions between mutants of both
proteins should reveal a detailed picture of the toxin-receptor
complex, and a mirror image of the receptor may then emerge from
knowledge of the structure of the toxin. Several lines of information
facilitate this approach. First, m1-toxin1 belongs to a large family of
relatively rigid spoon-shaped short-chain toxins. NMR studies have
shown that muscarinic toxin MT2, like other members of this family, has
a dense core containing four disulfide bonds and four loops (Figs. 1
and 2; Ségalas et al., 1995
). Most
of the sequence diversity among short-chain toxins resides in their
three larger loops (Fig. 1). Several residues in the corresponding
loops of the similar toxin erabutoxin a have been mutated, yielding
information about residues that perform structural and functional roles
(Pillet et al., 1993
; Tremeau et al., 1995
). Second, the toxins that
bind to muscarinic receptors differ only modestly in their sequences (Fig. 1), despite large differences in their binding characteristics. Only seven of the amino acids of m1-toxin1 are not conserved between other toxins that bind to muscarinic receptors, although only the
m1-isotoxins bind specifically, irreversibly, and allosterically to
M1 receptors (Max et al., 1993a
,b
,c
; Carsi and
Potter, 2000
). Two of these seven residues
(Phe38, Lys65) were mutated
to the corresponding residue that is conserved in the other muscarinic
toxins (Ile38, Glu65; Fig.
1). The structural ramifications of making F38I and K65E were predicted
from computer modeling of the atomic coordinates of MT2 (Ségalas
et al., 1995
). Ile38 exhibits multiple
interactions with surrounding residues in the middle loop of MT2 (Fig.
2), so F38I is likely to have a slightly different conformation than
m1-toxin1, but still be a stable molecule. The C-terminal
Glu65 is exposed on the convex face of MT2 and
interacts minimally with surrounding residues. So K65E should have a
protruding C terminus with an opposite charge to that of the native
toxin, yet no change in conformation. Finally, only 13 of the 77 extramembranous amino acids of M1 receptors are
not conserved in M2-M5
receptors, so the most likely sites in M1
receptors for the specific binding of m1-toxin1 are limited (Hulme et
al., 1990
; Max et al., 1993b
).
|
Recombinant m1-toxin1 and F38I and K65E were tested for four properties: 1) the ability of each toxin to block the binding of [3H]NMS to cloned M1 receptors in membranes, 2) the selectivity of the toxin for M1 versus M2-M5 receptors, 3) the reversibility of M1-blockade, and 4) the ability of the toxin to slow the dissociation of [3H]NMS from M1 receptors.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials. An adult Dendroaspis angusticeps was obtained from Natural Selections (Miami, FL), guanidinium isothiocyanate and primers and a TA cloning kit from from Invitrogen (Carlsbad, CA), [3H]N-methylscopolamine (82 Ci/mmol) and [32P]ATP (3000 Ci/mmol) from PerkinElmer Life Science Products (Boston, MA), and restriction enzymes from New England Biolabs (Beverly, MA). Unless specified, all other reagents were from Sigma (St. Louis, MO). DNA sequencing was performed using a Thermal Cycling Sequencing kit (PerkinElmer). Sequences were aligned by the Clustal method (DNASTAR, Madison, WI). Protein assays were performed using a Micro-BCA kit from Pierce (Rockford, IL). Antiserum to m1-toxin1 was generated to a synthetic peptide (PKAEYRDVIN) by Tana Labs (Houston, TX).
Cloning the cDNA for m1-Toxin1.
An adult D. angusticeps was chilled in a freezer and decapitated. Its venom
glands were homogenized in 4.0 M guanidinium isothiocyanate, the
homogenate was centrifuged over 5.7 M cesium chloride for 16 h at
214,000gmax, and the RNA pellet was
resuspended in water treated with diethylpyrocarbamate (Chirgwin et
al., 1979
). Messenger RNA was isolated from total RNA using a
PolyATract mRNA isolation kit (Promega, Madison, WI). Two degenerate
oligonucleotides were designed to amino acid sequences unique to
m1-isotoxins (Max et al., 1993a
; Carsi and Potter, 2000
). Reverse
transcription was performed using a downstream primer, DEG2
(5'CAYTTRTCIGTICCRCARCARTTIATIAC3'), and 250 ng of venom gland mRNA.
The resultant first strand cDNA was then used as a template for PCR,
using an upstream primer, DEG1 (5'GARGAYTGYCCIGAYGGICARAAY3'), in
combination with DEG2. PCR was performed with 25 cycles of 1 min at
95°C, 1 min at 65°C, and 1 min at 72°C. An adapter-ligated cDNA
library was prepared from 1 µg of venom gland mRNA using a Marathon
RACE kit (CLONTECH, Palo Alto, CA). RACE was initiated using 10 µl of
a 1:25 dilution of the adaptor-ligated cDNA mix. The 50-µl reaction
mixture contained 2.0 mM Mg, 0.3 mM dNTP, 0.5 µM each of primer AP1
(CLONTECH) and GSP-1 (5'AACAGTTAATGACGTCACGGTATTCC3'), and 2.5 units of
Primezyme (Biometra, Inc., Tampa, FL). PCR was performed with 30 cycles of 30 s at 94°C, 2.5 min at 68°C, and a final 15-min
incubation at 68°C. Identical conditions were used for 3'-RACE,
except that GSP-2 (5'TTCTCCAAGAATGTATGACTTCACCAGG3') replaced GSP-1.
Both RACE products were purified on a 1% agarose gel, ligated into pCRII (Invitrogen) and used to transform DH5
cells (Invitrogen). Plasmids were purified using a Wizard Mini-Prep kit (Promega). Both
strands were sequenced to check their fidelity. Restriction mapping of
both PCR products identified a unique AatII site present in the region
of overlap between the 5' and 3' RACE clones. This site was used to
ligate the RACE products into pCRII to reconstruct the full-length
cDNA. Two primers were designed to remove the untranslated region and
to add restriction sites, 5'BamHI
(5'GCGGATCCGCCACCATGAAAACTCTGC3') and 3'EcoRI
(5'CGCGCGAATTCGAGCTATTTGTTGC3'); the underlined regions indicate the restriction sites. These facilitated cloning of the cDNA
into a Pichia pastoris expression vector pPIC3.5
(Invitrogen), resulting in the m1-toxin1 expression plasmid pm1tx1. The
GenBank accession number for m1-toxin1 cDNA is AF241871.
Site-Directed Mutagenesis. Site-directed mutants of m1-toxin1 were prepared by primer mismatch PCR. The primers for F38I were F38Iup (5'ACATCCCCTGGTGATGTCATACATTCTTGGAGAAATGTACTG3') and F38Idown (5'AGAATGTATGACATCACCAGGGGATGTGCTGC3'); the underlined portions include the mismatch. Because K65 is a C-terminal amino acid, only one primer was designed for K65E, (5'TATATATGAATTCTGGAGCTATTCGTTGCATTTGTCTGTTCCGC3'). F38I was created using two separate PCR reactions and an outside primer, in this case the AOX1 primer to the pPIC3.5 vector, F38Iup for the 5' side of the cDNA, and F38Idown for the 3' side of the cDNA. The reaction conditions were a 2-min incubation at 94°C followed by 30 cycles of 1 min at 94°C, 1 min at 50°C, and 30 s at 72°C. Each PCR product was purified and used as a template in a third PCR reaction with only the AOX1 primers. The conditions for the PCR extension were a 2-min incubation at 94°C, followed by five cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C. Then the PCR reaction incubation was changed to 25 cycles of 1 min at 94°C, 1 min at 65°C, and 1 min at 72°C. The PCR product was subcloned into the pPIC3.5 vector and sequenced to ensure PCR fidelity. The expression vector with the F38I mutant cDNA cloned downstream of the AOX1 promoter was called pF38I. K65E was generated by primer mismatch. Using the upstream primer AOX1 and the K65E primer, the PCR product was generated with the following protocol: 2 min at 94°C followed by 30 cycles of 1 min at 94°C, 1 min at 50°C, and 1 min at 72°C with a 10-min extension at 72°C. The K65E PCR product was subcloned into the pPIC3.5 vector downstream the AOX1 promoter, and named pK65E.
Pichia Growth Media. Minimal media contained 1.5% yeast nitrogen base, 75 mM ammonium sulfate, and 0.005% d-biotin. Minimal glycerol media (MG) was minimal media plus 5% glycerol. Minimal methanol media (MM) was minimal media plus 0.5% methanol. Buffered minimal glycerol media was MG plus 100 mM potassium phosphate at pH 6.0. Buffered glycerol complex media was buffered minimal glycerol media plus 2% peptone and 1% yeast extract. Buffered minimal methanol media was MM plus 0.5% methanol and 100 mM potassium phosphate at pH 6.0.
Expression and Purification of Recombinant m1-Toxin1.
Ten
micrograms of the expression vector with the cDNA for m1-toxin1 was
linearized with SacI and used to transform P. pastoris GS115 cells, using the Easy-Comp kit (Invitrogen).
Recombinant cells were screened for their ability to grow on
histidine-deficient media. An immunoblot method was used for the
initial screening of recombinant toxin production (Wung and Gascoigne,
1996
). Recombinant cells were grown on a nitrocellulose disk placed on
MG agar plates for 2 days at 30°C. The disk was transferred to a
fresh plate containing MM agar and incubated at 30°C. Fresh methanol
was added to the lid every 24 h to replenish that lost by
metabolism and evaporation. After 48 h a fresh nitrocellulose disk
was placed on top of the cells for 3 h at 30°C. The top disk was
removed and the cells were washed off with phosphate-buffered saline. The nitrocellulose was blocked with 5% dry milk in 0.1% Tween 20 for
1 h, treated with rabbit antiserum to m1-toxin1 (1:100), and then
exposed to a secondary anti-rabbit antibody coupled to horseradish
peroxidase (Sigma) at a dilution of 1:20,000. Detection of recombinant
expression was performed with an ECL-Plus kit (Amersham Pharmacia
Biotech, Inc., Piscataway, NJ). Recombinant P. pastoris clones were grown in buffered glycerol complex media overnight at
30°C at 300 rpm to an A600 of 2.0 to 6.0. Cells were pelleted at 4000gmax for 10 min
at room temperature, resuspended in buffered minimal methanol media to
an A600 of 2.0, and incubated at
30°C and 300 rpm. The level of expression was assessed after 24 to 72 h. Media from expressing cells were clarified by centrifugation at 10,000gmax for 10 min. The media were
then filtered through a 0.45-µm cellulose acetate filter (Corning,
Palo Alto, CA) and diluted 10-fold with sodium acetate buffer at pH 4.5 (buffer A) to a final concentration of 25 mM. The sample was pumped
onto a 5.0-ml cation-exchange column (SP Hi-Trap; Amersham Pharmacia Biotech) at a flow rate of 5.0 ml/min. The column was washed with buffer A and then eluted with 100 mM sodium chloride. The
anti-M1 activity of fractions was determined with
a radioligand binding assay (see below). The most active fractions were
pooled, the pH was adjusted to 6.0 with NaOH, BSA was added to 0.5%,
and the sample was lyophilized. The dry sample was dissolved in 10%
acetonitrile-0.1% trifluroacetic acid and loaded on a
C18 reversed phase column (10 × 250 mm;
Vydac). The toxin was eluted with a gradient of 10 to 90% acetonitrile
at 5.0 ml/min over 80 min, and fractions were assayed for activity. The
active peak was lyophilized with 0.5% BSA at pH 6.0. The sample was
resuspended in buffer A plus 20% acetonitrile, loaded on a
cation-exchange HPLC column (7.5 by 50 mm; Vydac) and eluted with
0-500 mM NaCl at 1.0 ml/min during one hour. The pure toxin was
desalted on a reversed-phase column (4.5 × 250 mm, Vydac), and
samples of the single peak of toxin protein were taken for a Western
immunoblot and for mass spectrometry. The remainder was lyophilized
with 0.5% BSA at pH 6.0, resuspended in 50 mM sodium phosphate-1.0 mM
EDTA at pH 7.41, and stored at 4°C.
Western Blot of Recombinant m1-Toxin1. One hundred nanograms of native and recombinant m1-toxin1 was loaded on a 10 to 20% Tricine gel and subjected to electrophoresis under denaturing conditions. The proteins were transferred to nitrocellulose, probed with antiserum to m1-toxin1, and detected using the ECL-Plus kit (Amersham Pharmacia Biotech).
Mass Spectrometry of Recombinant m1-Toxin1. Matrix-assisted laser desorption ionization/time of flight mass spectral analysis was performed at the Macromolecular Resources Center at the University of Colorado.
Expression and Purification of F38I and K65E. Ten micrograms of pF38I and pK65E was linearized with SacI and used to transfect competent P. pastoris GS115 cells. Colonies were screened for mutant toxin production using the same immunoblot method as for wild-type toxin. The clones that secreted the most toxin were chosen for further studies. The purification procedures for F38I and K65E were identical to those for m1-toxin1, except that the sodium acetate buffer used for cation-exchange steps had a pH of 4.0.
Radioligand Binding Assays.
The antimuscarinic activity of
recombinant toxins was determined by measuring their ability to block
the binding of 1.0 nM [3H]NMS to membranes from
CHO cells transfected with the cDNA for human
M1-M5 receptors (Max et
al., 1993a
). Membranes were first incubated in 0.2 ml of 50 mM
phosphate/1.0 mM EDTA buffer at pH 7.4 (phosphate-EDTA) and various
concentrations of each toxin for 30 min at 25°C.
[3H]NMS was added to 1.0 nM and a final volume
of 1.0 ml (0.25 ml for F38I), and incubation was continued for 1 h. Membranes were collected on filters, dried, and radioactivity was
counted. Nonspecific binding was determined by including 1 µM
(±)quinuclidinyl benzilate and omitting the toxin during the
preincubation step. The amount of membranes used was adjusted so that
the amount of specific [3H]NMS binding was 1900 to 2800 cpm in each assay. Binding curves were analyzed with Prism 3.0 (GraphPad, San Diego, CA).
Measurement of Toxin Dissociation. Membranes from CHO cells expressing M1 receptors were incubated in 0.1 ml of phosphate-EDTA buffer for 30 min at 25°C with sufficient amounts of each toxin to occupy 90% of M1 receptors, as determined from competition assays. One nanomolar [3H]NMS was added to a final volume of 5.0 ml (50-fold dilution) and incubation was continued for 5 to 180 min. The rate of association of [3H]NMS to M1 receptors was used to indicate the rate of dissociation of each toxin. Nonlinear regression was analyzed with Prism 3.0. The dissociation time given is the mean from three experiments ± S.E.M.
Allosteric Binding of Toxins. Membranes from CHO cells expressing M1 receptors were incubated in phosphate-EDTA buffer with 1 nM [3H]NMS for 1 h at 25°C to saturate all M1 receptors with NMS as determined by competition assays. The rate of dissociation of [3H]NMS from M1 receptors was then determined after the addition of 1 µM atropine. To measure the effects of toxins on the dissociation of [3H]NMS, 250 to 1000 nM toxin was added with 1 µM atropine. Nonlinear regression was analyzed with Prism 3.0.
NMR Structure of MT2.
The atomic coordinates of the solution
NMR structure of MT2 (Ségalas et al., 1995
) were kindly provided
by Isabelle Ségalas (C.E. Saclay, Gif-Sur-Yvette, France).
The molecule was modeled using an Insight II program on a Silicon
Graphics Indigo2 computer.
| |
Results |
|---|
|
|
|---|
Cloning of cDNA for m1-Toxin1.
Reverse transcription-PCR was
carried out with mRNA purified from venom glands, using primers
degenerate to portions of the m1-toxin1 protein sequence. These
experiments yielded a PCR product of 93 base pairs, which was used to
design primers specific to m1-toxin1 for use in RACE. The 5'- and
3'-RACE products were ligated together to form the full-length cDNA for
m1-toxin1 (Fig. 3). This cDNA has 518 base pairs, of which 258 are the open reading frame. The deduced amino
acid sequence of the open reading frame has a 21 amino acid signal
peptide upstream of the mature amino acid sequence of m1-toxin1. The
coding region of the cDNA for m1-toxin1, including its signal peptide,
was subcloned into the expression vector pPIC3.5, placing it under
control of the yeast alcohol oxidase 1 promotor.
|
Expression and Purification of Recombinant m1-Toxin1, F38I, and
K65E.
Recombinant clones were screened on MG agar deficient in
histidine, and screened for toxin production using a modified
immunoblot assay. Once a suitable clone was selected, the time course
for toxin expression was examined. Maximal expression of m1-toxin1 was
achieved in 48 to 60 h (Fig. 4).
Similar results were observed for F38I and K65E (data not shown).
|
|
|
|
Binding of Recombinant m1-toxin1, F38I, and K65E to Muscarinic
Receptors.
Preincubation of M1 receptors
with recombinant m1-toxin1, F38I, and K65E all blocked the binding of
1.0 nM [3H]NMS to cloned
M1 receptors (Fig.
8). Similar amounts of m1-toxin1 and K65E
were required to block similar amounts of M1
receptors, indicating the presence of similar amounts of the active
toxins. Nonetheless, the molar ratio of each toxin to receptor protein far exceeded a stoichiometric ratio (see Discussion). No
blockade of binding was observed with
M2-M5 receptors at toxin
concentrations up to 2.2 µM for m1-toxin1 and K65E, and up to 5.0 µM for F38I (data not shown).
|
Duration of Binding of m1-Toxin1, K65E, and F38I to M1
Receptors.
The stability of M1
receptor-toxin complexes was examined by observing the ability of
[3H]NMS (1.0 nM) to bind to receptors
preincubated with a saturating amount of each toxin. Figure
9 shows that M1
receptors preincubated with m1-toxin1 or K65E did not bind
[3H]NMS in 3 h at 25°C. However,
M1 receptors preincubated with F38I showed a
rapid increase in [3H]NMS binding sites (Fig.
9). Thus, recombinant m1-toxin1 and K65E bound irreversibly, whereas
F38I bound reversibly. Because F38I bound reversibly, its affinity for
M1 receptors must be lower than that of m1-toxin1
and K65E.
|
Allosteric Binding of Toxins to M1 Receptors.
The
ability of recombinant toxins to stabilize the binding of
[3H]NMS to M1 receptors
was tested by measuring the rate of dissociation of
[3H]NMS from toxin-NMS-receptor complexes.
[3H]NMS had a half-life of 2.74 ± 0.14 min with no toxin (Fig. 10). In the
presence of m1-toxin1 the half-life increased 6-fold to 15.98 ± 0.31 min, in keeping with prior results for the native toxin (Max et
al., 1993b
; Carsi and Potter, 2000
). In contrast, neither F38I nor K65E
had an observable effect on the dissociation of NMS (Fig. 10). These
results indicate that K65E and F38I do not bind to
NMS-M1 receptor complexes with the same affinity
as m1-toxin1.
|
| |
Discussion |
|---|
|
|
|---|
The amino acid sequence of m1-toxin1 is highly homologous to those
of cloned cDNAs for more than 100 short-chain toxins from members of
families Elapidae and Hydrophiidae (GenBank),
despite the fact that the snakes live in environments as diverse as
trees and oceans, and the toxins bind to targets as diverse as
nicotinic and muscarinic receptors, acetylcholinesterase, calcium
channels, and voltage-gated potassium channels (Harvey, 1991
). The
signal peptide sequences of these toxins are 100% conserved at the
amino acid level and 98% identical at the nucleotide level, implying a
common ancestral origin for their genes (Ohno et al., 1998
). The coding
sequence of cloned m1-toxin1 established the correct full sequence of
this toxin for the first time (Potter et al., 1996
), because the
original sequence for m1-toxin contained two errors
(His28 and Trp29; Max et
al., 1993a
). Trp28 and
Gln29 have since been found in all the
m1-isotoxins (Carsi and Potter, 2000
). We did not obtain any
full-length cDNAs corresponding to other m1-toxins. The full sequence
of MT7 has been determined recently and was found to be the same as
that of m1-toxin1 (Näsman et al., 2000
).
The cDNAs for m1-toxin1, F38I, and K65E were expressed in P. pastoris so that the toxins would be correctly folded, processed, and secreted. The use of methylotropic yeast also meant that each toxin was secreted into media containing only salts and methanol, simplifying the purification of each toxin. Recombinant m1-toxin1 had the same linear mass as native m1-toxin1, and it bound specifically, irreversibly, and allosterically like the native toxin, demonstrating that our yeast expression system was satisfactory for producing m1-toxin1. The yeast also produced useful amounts of F38I and K65E.
Given the remarkable selectivity of m1-toxin1 for
M1 receptors, it was anticipated that any
mutation of this toxin would alter its selectivity for
M1-M5 receptors. To our
surprise, we found that recombinant m1-toxin1, F38I, and K65E were all
selective for M1 versus
M2-M5 receptors. So,
positions 38 and 65 do not play a critical role in determining
selective binding, and further experiments are necessary to determine
which amino acids do confer subtype selectivity. Jolkkonen (1996)
suggested that the amino acids at the tip of loop 2 might be critical,
because MT4 and MT
are identical except for three amino acids at the
tip of this loop (Fig. 1), and these two toxins differ dramatically in
their specificity (Fig. 1). But the corresponding three amino acids in
m1-toxin1 and m4-toxin differ relatively little, despite the markedly
different specificities of these toxins.
m1-Toxin1 is also unique because of its irreversible binding to
M1 receptors (Max et al., 1993a
,b
,c
; Carsi and
Potter, 2000
; Näsman et al., 2000
; Olianas et al., 2000
).
Recombinant m1-toxin1 bound irreversibly as expected. K65E also bound
irreversibly, showing that position 65 is not critical for irreversible
binding. Because recombinant m1-toxin1 and K65E each bound irreversibly to unoccupied M1 receptors, it is not possible to
calculate an affinity for either toxin. F38I dissociated rapidly from
M1 receptors, so the Phe38
of m1-toxin1 must be important for irreversible binding. F38I may prove
useful for functional studies when reversible
M1-blockade is desirable. We cannot calculate a
reliable Kd for F38I at this time because
of evidence of major losses of toxins during their lyophilization (see
last paragraph).
Some inferences can be made about the role of
Phe38 in m1-toxin1, based on the present results
with F38I and the solution NMR structure of MT2 (Ségalas et al.,
1995
). The homologous residue to Phe38 in MT2 is
Ile38. Ile38 is in the
middle of a
-sheet in loop 2 of MT2 (Fig. 2), and it has the second
highest number of contacts with adjacent residues of any amino acid in
the entire MT2 sequence. Assuming that m1-toxin1 and MT2 have a similar
overall structure, mutation of Phe38 to
Ile38 in m1-toxin1 should significantly alter the
structure of the toxin in loop 2. The altered binding characteristics
of F38I thus indicate that the structure of loop 2 is important for a
tight molecular fit between m1-toxin1 and M1 receptors.
Both native m1-toxin1 (Max et al., 1993b
) and recombinant m1-toxin1
slow the dissociation of [3H]NMS from
M1 receptors 6-fold. F38I did not slow the
dissociation of [3H]NMS, which is not
surprising given its reversible binding to unliganded
M1 receptors. However, K65E also did not slow the
dissociation of [3H]NMS, even though K65E bound
irreversibly to unliganded M1 receptors. Thus,
the positive C-terminal Lys65 of m1-toxin1 seems
to be critical for the formation of ternary complexes of toxin,
[3H]NMS and M1 receptors.
Again, some inferences can be made about the role of
Lys65 in m1-toxin1 for its binding to
M1 receptors, based on the solution structure of
MT2. The homologous C-terminal residue to Lys65
in m1-toxin1 is Glu65 in MT2.
Glu65 protrudes from the convex face of MT2 and
makes few contacts with its adjacent residues (Fig. 2). The C-terminal
regions of all the toxins shown in Fig. 1 are nearly identical, so it
is unlikely that the C-terminal residue of any of these toxins
(including Lys65 in m1-toxin1) is important for
their structural integrity. Nonetheless, and despite its irreversible
binding to unliganded M1 receptors, K65E did not
block the dissociation of [3H]NMS from
M1 receptors. Our interpretation of this result
is that there is an interaction between Lys65 on
the convex face of m1-toxin1, and an extracellular part of M1 receptors. Because the only difference between
m1-toxin1 and K65E is a negative C-terminal, it is possible that the
highly basic C-terminal Lys of m1-toxin1 interacts with an acidic
residue in one of the outer loops or the N terminus of
M1 receptors. Although any of the acidic residues
on M1 receptors might be involved, Glu170 in the middle of outer loop 2, Asp393 in the middle of loop 3, and
Glu401 are of particular interest, because they
are not found in M2-M5 receptors (Hulme et al., 1990
). Glu401 is
especially intriguing because it lies just outside the membrane surface
next to Trp400, which is essential for the
allosteric effect of gallamine, and Glu401 just
overlies Tyr404 and Tyr408
in transmembrane segment 7, which are important for the binding of NMS
(Matsui et al., 1995
). Site-directed mutagenesis of
Glu401 in the M1 receptor
is therefore in progress, to evaluate whether Lys65 on the toxin, and
Glu401 on the receptor, may interact.
It is well known that native m1-toxin1 (Max et al., 1993b
) and
synthetic MT7 (synthetic m1-toxin1; Olianas et al., 2000
) do not block
the specific binding of [3H]NMS to
M1 receptors completely, and recombinant
m1-toxin1 showed the same effect (Fig. 8). There are a number of
possible explanations for this effect, including negative cooperativity
between the binding of toxin and NMS at different sites (Olianas et
al., 2000
), reversible blockade of NMS by partly denatured toxin, and
different access of NMS and toxin to intravesicular sites in membrane preparations.
We experienced two significant problems with the amounts of
recombinant toxins that were recovered after expression. The first was
that the levels of expression were inadequate for structural studies by
NMR or circular dichroism. This problem might be ameliorated in future
studies by using synthetic yeast codons instead of native cDNA codons
for expression. The second problem was that it was necessary to use
much larger quantities of recombinant m1-toxin1 and K65E for
irreversible blockade (by a factor of 100 or more) than should be
required for stoichiometric blockade. By comparison, M1 receptors can be irreversibly blocked with
synthetic m1-toxin1 or radioiodinated synthetic m1-toxin1 using only a
slight molar excess of toxin over receptor (Potter, 2001
). This second
problem could have appeared in the present studies because of incorrect folding of m1-toxin1 and K65E. However, the fact that we obtained a
single toxin protein by HPLC and by mass spectrography makes it
unlikely that there was variable folding or impure protein. Moreover,
the problem of nonstoichiometric binding has been present in every
study in this laboratory with native m1-toxin1 (Max et al.,
1993a
; Liang et al., 1996
; Carsi and Potter, 2000
; Potter, 2001
), and
we think it is due to extensive surface denaturation of toxins when
they are lyophilized. We attempted to avoid the inactivation of
recombinant toxins by adding BSA before lyophilizations, but were
unable to prevent major losses of the active toxins. We now know that
losses can be avoided by concentrating each toxin by centrifugation
over molecular cutoff filters, but this was not done in the present
studies. It may be noted that the partial denaturation of K65E does not
explain the inability of the active toxin to bind to
[3H]NMS-receptor complexes and to slow the
dissociation of [3H]NMS, because we used
concentrations of this toxin for dissociation rate experiments (Fig.
10) that were capable of causing full blockade of unoccupied
M1 receptors.
| |
Footnotes |
|---|
Received February 23, 2001; Accepted June 22, 2001
This work was supported by AG06170 and AG12976.
Lincoln T. Potter, Molecular and Cellular Pharmacology, University of Miami School of Medicine, P.O. Box 016189, Miami, FL 33101. E-mail: lpotter{at}miami.edu
| |
Abbreviations |
|---|
[3H]NMS, [3H]N-methylscopolamine; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; MG, minimal glycerol media; MM, minimal methanol media; BSA, bovine serum albumin; CHO, Chinese hamster ovary; HPLC, high-performance liquid chromatography.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Pawlak, S. P. Mackessy, B. G. Fry, M. Bhatia, G. Mourier, C. Fruchart-Gaillard, D. Servent, R. Menez, E. Stura, A. Menez, et al. Denmotoxin, a Three-finger Toxin from the Colubrid Snake Boiga dendrophila (Mangrove Catsnake) with Bird-specific Activity J. Biol. Chem., September 29, 2006; 281(39): 29030 - 29041. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Fruchart-Gaillard, G. Mourier, C. Marquer, A. Menez, and D. Servent Identification of Various Allosteric Interaction Sites on M1 Muscarinic Receptor Using 125I-Met35-Oxidized Muscarinic Toxin 7 Mol. Pharmacol., May 1, 2006; 69(5): 1641 - 1651. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kukkonen, M. Perakyla, K. E. O. Akerman, and J. Nasman Muscarinic Toxin 7 Selectivity Is Dictated by Extracellular Receptor Loops J. Biol. Chem., December 3, 2004; 279(49): 50923 - 50929. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. R. Ramos, R. C. R. Figueredo, T. A. Pertinhez, M. M. Vilar, A. L. T. Oller do Nascimento, M. Tendler, I. Raw, A. Spisni, and P. L. Ho Gene Structure and M20T Polymorphism of the Schistosoma mansoni Sm14 Fatty Acid-binding Protein. MOLECULAR, FUNCTIONAL, AND IMMUNOPROTECTION ANALYSIS J. Biol. Chem., April 4, 2003; 278(15): 12745 - 12751. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Mourier, S. Dutertre, C. Fruchart-Gaillard, A. Menez, and D. Servent Chemical Synthesis of MT1 and MT7 Muscarinic Toxins: Critical Role of Arg-34 in Their Interaction with M1 Muscarinic Receptor Mol. Pharmacol., January 1, 2003; 63(1): 26 - 35. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||