![]() |
|
|
Vol. 60, Issue 5, 1031-1039, November 2001
Forschungsinstitut für Molekulare Pharmakologie, Berlin, Germany
| |
Abstract |
|---|
|
|
|---|
Previous studies have shown that the G protein-coupled human vasopressin V2 receptor (V2 receptor) is expressed predominantly in the basolateral membrane of Madin Darby canine kidney type II (MDCKII) epithelial cells at steady state. Here we have assessed the influence of the individual cytoplasmic domains of the V2 receptor on polarized sorting in MDCKII cells. The second (ICL2) and third (ICL3) intracellular loops and the C-terminal tail were fused separately to a green fluorescent protein-tagged receptor fragment comprising the first transmembrane domain and flanking regions. We show that the ICL2 domain of the V2 receptor alone promotes basolateral cell surface expression and thus seems to contain the basolateral sorting signal of the V2 receptor. Fusion of the other cytoplasmic domains, however, does not lead to a randomized cell surface expression. The C-terminal tail of the V2 receptor promotes apical targeting. Fusion of ICL3 leads to a receptor fragment that is retained in the endoplasmic reticulum (ER). The results are consistent with a model in which the V2 receptor contains signals for both apical and basolateral cell surface expression, the latter being dominant. Furthermore, ICL3 may contain a retinoid X receptor ER retention signal, which is not accessible in the correctly folded full-length receptor but which is unmasked when ICL3 is fused alone.
| |
Introduction |
|---|
|
|
|---|
The
human V2 receptor belongs to the superfamily of
the G protein-coupled receptors (GPCRs) and is expressed in the
principal epithelial cells of the renal collecting duct (Klussmann et
al., 2000
). These cells have two different plasma membrane
compartments: the apical, which is in contact with the urine, and the
basolateral, which is accessible to the ligand in the circulation.
Activation of the V2 receptor in the basolateral
membrane leads to stimulation of the Gs/adenylyl
cyclase system. The subsequent rise in intracellular cAMP induces the
fusion of vesicles containing water channels (aquaporin 2) with the
apical membrane, which is thus rendered water permeable. Consequently,
water is reabsorbed from the lumen of the collecting duct. One of the
striking features of this cascade is its polarity (i.e., the signal
must be transduced from the basolateral to the apical side of the
epithelial cells). The function of such a polarized signal transduction
is thus dependent on the transport of the receptor to its "correct"
cell surface compartment.
A growing number of the heptahelical GPCRs have been shown to sort to
either the basolateral or apical membrane in epithelial cells. Stably
transfected MDCKII cells grown on permeable polycarbonate filter
supports have become the standard cell system in these studies.
Steady-state basolateral expression was demonstrated for the
2A- (Keefer and Limbird, 1993
),
2B-, and
2C-adrenergic receptors (Wozniak and Limbird,
1996
). A similar basolateral expression was observed for the receptors
of the luteinizing hormone, follicle stimulating hormone, thyroid
stimulating hormone (Beau et al., 1997
), and
P2Y11 purinergic receptors (Zambon et al., 2001
).
Apical expression was demonstrated for the A1
adenosine receptor (Saunders et al., 1996
) and the light receptor
rhodopsin (Chuang and Sung, 1998
). Transport signals that determine
polarized cell surface expression in epithelial cells have been
characterized in the cytoplasmic domains of unrelated membrane
proteins. In most cases, these signals were either of the tyrosine
type, such as that described originally for the low density lipoprotein
receptor (Matter et al., 1992
), or the dileucine type, as found in the
IgG Fc receptor (Hunziker and Fumey, 1994
). For the heptahelical GPCRs,
these signals are less well defined, but it was shown for the
follicle-stimulating hormone receptor that a tyrosine and a leucine
residue in its intracellular C terminus contribute to a motif that
directs basolateral sorting (Beau et al., 1998
). In the case of the
2A-adrenergic receptor, the large ICL3 domain
stabilizes the receptor in the basolateral membrane, and it was
proposed that basolateral localization in this instance is mediated by
the actual length of the ICL3 domain rather than by a defined transport
signal (Edwards and Limbird, 1999
).
Immunocytochemical studies of the V2 receptor in
rat kidneys (Nonoguchi et al., 1995
) as well as studies with
recombinant GFP- (Schülein et al., 1998b
) and
C-myc-tagged receptors in MDCKII epithelial cells
(Andersen-Beckh et al., 1999
) verified its predominantly basolateral
localization, which was expected, considering the direction of signal
transduction in epithelial cells. Minor amounts of receptor, however,
were also detected apically (Schülein et al., 1998b
;
Andersen-Beckh et al., 1999
).
To clarify which of the cytoplasmic domains of the V2 receptor is responsible for basolateral transport, we have assessed the sorting functions of the individual cytoplasmic receptor domains in MDCKII epithelial cells. Using fusions to a GFP-tagged receptor fragment (comprising the N terminus, first transmembrane domain, and part of ICL1; 71 residues), we show that ICL2 alone mediates basolateral sorting. In contrast, the C-terminal tail directs apical targeting, whereas the receptor fragment containing ICL3 is transport-defective and is retained via a RXR retention motif in the ER.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
Sulfo-NHS-Biotin and immobilized NeutrAvidin were
from Pierce Chemical (Rockford, IL). Benzamidine, phenylmethylsulfonyl
fluoride, Trasylol and Triton X-100 were from Sigma (Munich,
Germany). Permeable polycarbonate filter supports (24-mm diameter) were
from Costar (no. 3412; Bodenheim, Germany), Type IV collagen from BD
Biosciences (Erembodegem, Belgium), and Lipofectin from
Invitrogen (Karlsruhe, Germany). DNA modifying enzymes, EndoH
and PNGaseF were from New England Biolabs (Schwalbach, Germany). All
other reagents were from Merck (Darmstadt, Germany). Vector plasmid
pEGFP-N1, encoding the red-shifted variant of GFP, was purchased from
CLONTECH Laboratories (Heidelberg, Germany). The polyclonal
peptide-derived anti-GFP antibodies were described previously (Krause
et al., 2000
). Alkaline phosphatase antirabbit IgG was from Dianova
(Braunschweig, Germany). MDCKII epithelial cells were a gift from K. Simons (Max Planck Institute of Molecular Cell Biology and
Genetics, Dresden, Germany).
DNA Manipulations. Standard DNA manipulations were carried out according to the handbooks of Sambrook et al. (1989). Nucleotide sequences were verified using the FS Dye Terminator kit from PerkinElmer (Weiterstadt, Germany). Site-directed mutagenesis was carried out with the QuikChange site-directed mutagenesis kit from Stratagene (Heidelberg, Germany).
Construction of GFP-Tagged V2 Receptor Fragments
Containing Different Cytoplasmic Domains.
The plasmid pWT.GFP,
encoding a C-terminal GFP fusion to residue K367 of the
V2 receptor, was described previously
(Schülein et al., 1998a
). Plasmid pEU71.PhoA, encoding an
alkaline phosphatase fusion to residue W71 of the
V2 receptor (i.e., to a fragment consisting of
the N terminus, first transmembrane domain and ICL1; Schülein et
al., 1996b
), was the starting plasmid for the construction of the
corresponding GFP fusions. The receptor portion was cloned as a
SacI/BamHI fragment into the vector pEGFP-N1,
yielding plasmid p71.GFP. Plasmid p71CT/WT.GFP was described previously
(Krause et al., 2000
). Here, the C-terminal tail of the
V2 receptor is inserted between the first
cytoplasmic loop and the GFP moiety of p71.GFP (see Fig.
1 for the fused sequence). To introduce
the second intracellular loop (ICL2) of the V2
receptor between ICL1 and the GFP moiety in p71.GFP, the coding
sequence of ICL2 was PCR-amplified (5' primer, 5'
CTACATGATCCTGGATCCGACGCTGGACCGCC 3'; 3' primer, 5'
GCCCAAGCCACTGGATCCGGCCGGTTC 3'). The PCR primers introduced novel
BamHI sites into the flanking regions of ICL2 at positions
393 and 477 of the V2 receptor cDNA. The PCR
fragment was cut with BamHI and cloned into the
BamHI-cut p71.GFP, yielding plasmid p71/ICL2.GFP. The same
cloning strategy was used to introduce the third intracellular loop
(ICL3) between ICL1 and the GFP moiety of p71.GFP, but the
BamHI sites were introduced at positions 675 and 813 of the
V2 receptor cDNA (5' primer, 5'
CGCCGCCTGCCAGGATCCCATCTTCCGGG 3'; 3' primer, 5'
CCACAATCACTAGCGGATCCCTCACAGTCTTGG 3'). The resulting plasmid was
designated p71/ICL3.GFP.
|
Cell Culture and Transfection.
Lipofectin transfection of
MDCKII epithelial cells and selection of stable cell lines were
performed as described previously for
Ltk
cells (Schülein et al.,
1996a
). Stable cell clones expressing the GFP fusions were identified
using an inverted fluorescence microscope. Total cell lysates of the
stably transfected clones were assessed fluorometrically, and clones
with similar GFP fluorescence intensities were selected for the study.
Cell Surface Biotinylation Assay.
To specifically label
apical and basolateral membrane proteins, the method described by Okusa
et al. (1997)
was slightly modified. MDCKII cells (2 × 106) stably expressing the GFP-tagged
V2 receptor constructs (WT.GFP, 71.GFP,
71/ICL2.GFP, 71/ICL3.GFP, 71/CT.GFP) were plated on 24-mm diameter
polycarbonate filter supports and grown for 5 days to allow formation
of a tight epithelial monolayer. Cells were washed twice with ice-cold
PBS-CM buffer (PBS containing 0.1 mM CaCl2 and 1 mM MgCl2, pH 7.4). Apical or basolateral membrane
proteins were labeled with a solution of 0.5 mg/ml Sulfo-NHS-Biotin in PBS-CM buffer for 30 min at 4°C. Epithelial integrity was assessed as
described previously by the direct determination of biotin leakage to
the opposite side using an enzyme-linked immunosorbent assay (filters
were only used if the biotin leakage was less than 0.5%)
(Schülein et al., 1998b
). Labeling reactions were quenched by
replacing the biotin solution with 1 ml of NH4Cl
solution (50 mM in PBS-CM). After a 10-min incubation, the cells were
washed 3 times with ice-cold PBS-CM, and filters were excised and
transferred into a reaction tube. Labeled proteins were extracted for
1 h with 1 ml of ice-cold buffer (1% Triton X-100, 0.1% SDS, 50 mM Tris-HCl, 150 mM NaCl, 1 mM Na-EDTA, 40 mM phenylmethylsulphonyl fluoride, 1 µg/ml Trasylol, and 100 mM benzamidine, pH 8.0).
Insoluble debris was removed by centrifugation (20 min, 4°C,
47,000g), and biotinylated proteins were recovered from the
supernatant by 1.5 h incubation at 4°C with NeutrAvidin-agarose
beads. Beads were sedimented (3 min, 4°C, 17,000g), washed
twice with buffer (0.5% Triton X-100, 0.1% SDS, 50 mM Tris-HCl, 50 mM
NaCl, and 1 mM Na-EDTA, pH 7.4) and once with NaCl free buffer (0.5%
Triton X-100, 0.1% SDS, 50 mM Tris-HCl, 1 mM Na-EDTA, pH 7.4).
Proteins were solubilized in 50 µl of Laemmli buffer (60 mM Tris-HCl,
2% SDS, 10% glycerol, 5%
-mercaptoethanol, 0.01% bromophenol
blue, pH 6.8), separated by SDS-PAGE (10% acrylamide), and blotted
onto nitrocellulose as described previously (Khyse-Andersen, 1984
).
Biotinylated proteins were detected with a polyclonal anti-GFP
antiserum and alkaline phosphatase-conjugated antirabbit IgG. The
method was essentially the same as described previously for monoclonal
anti-GFP antibodies and alkaline phosphatase-conjugated antimouse IgG
(Schülein et al., 1998a
).
Isolation of Crude Membrane Fractions from Stably Transfected
MDCKII Cells Containing GFP-Tagged V2 Receptor Fragments
and EndoH/PNGaseF Treatment.
Crude membranes of stably transfected
MDCKII cells were isolated from confluent cells grown on a 60-mm
diameter dish as described previously for COS.M6 cells (Schülein
et al., 1996b
). Membranes (60 µg of total protein) were incubated
with or without EndoH or PNGaseF according to the supplier's
recommendations. For the detection of the GFP-tagged receptor
fragments, proteins were separated by SDS-PAGE (10% acrylamide) and
blotted onto nitrocellulose as described previously (Khyse-Andersen,
1984
). Receptor fragments were detected with polyclonal anti-GFP
antibodies and alkaline phosphatase-conjugated antirabbit IgG as
described previously (Schülein et al., 1998a
).
Localization of GFP Fusion Proteins by Confocal Laser Scanning Microscopy (LSM). To visualize GFP fusions in stably transfected MDCKII cells grown on permeable filter supports, 2×106 cells were spread on Type IV collagen coated filters and grown for 3 days to allow the formation of epithelial monolayers. Filters were washed three times with PBS, excised, and transferred cell side-down to a slide. A drop of PBS was added, and filters were covered with a coverslip. GFP fluorescence was visualized with a inverted laser scanning microscope (lexc = 488 nm, lem = >515 nm, Zeiss 410, Zeiss, Göttingen, Germany). Horizontal xy- and vertical z-scans were recorded.
| |
Results |
|---|
|
|
|---|
Construction of GFP-Tagged V2 Receptor Fragments
Containing Individual Cytoplasmic Domains.
The sorting functions
of the cytoplasmic domains of the V2 receptor in
polarized epithelial cells are difficult to assess using full-length
receptor chimeras, because exchange of the cytoplasmic domains easily
causes folding defects. For example, replacement of the intracellular C
terminus of the V2 receptor by that of the
2 adrenergic receptor led to nonfunctional
receptors, which were retained in the ER (Oksche et al., 1998
). The use
of full-length receptors for the identification of transport signals
may also be disadvantageous if more than one signal is present because signal superimposition may occur. We therefore decided to assess the
sorting functions of the cytoplasmic domains of the
V2 receptor with an experimental system that
allows transport studies that are independent both of the other
cytoplasmic domains and of full-length receptor folding. ICL2 and ICL3
were fused separately to a V2 receptor fragment
(71 residues) consisting of the N terminus, first transmembrane domain,
and ICL1 (71.GFP; Fig. 1). The resulting constructs were designated
71/ICL2.GFP and 71/ICL3.GFP. The short ICL1 domain of the
V2 receptor, which contains an excess of
positively charged residues, was retained throughout to ensure correct
and comparable membrane orientations according to the "charge
difference" rule (Hartmann et al., 1989
). This rule postulates that
the orientation of a membrane protein in the ER membrane is mediated by
the charge difference between the sequences flanking a transmembrane
domain and that a positive charge difference determines a cytoplasmic domain. The construction of an equivalent receptor fragment containing the C-terminal tail (71/CT.GFP) and of a GFP fusion to the
V2 receptor consisting of 367 residues (i.e., to
the entire receptor lacking only the four C-terminal residues)
(WT.GFP) were described previously (Schülein et al., 1998a
;
Krause et al., 2000
).
The ICL2 Domain and the C-Terminal Tail of the V2
Receptor Mediate Basolateral and Apical Sorting, Respectively, in
MDCKII Cells.
To assess the polarized sorting functions of the
different cytoplasmic domains, stably transfected MDCKII cell clones
expressing the GFP-tagged receptor fragments were grown on
polycarbonate filter supports, and the GFP fluorescence signals in the
cells were localized by LSM (Fig. 2). The
wild-type C-terminally GFP-tagged V2 receptor
(WT.GFP) was used as a control. The results described previously
(Schülein et al., 1998b
) for WT.GFP were confirmed. The
xy-scans revealed a honeycomb pattern, indicative of a
basolateral cell surface localization. The z-scans
demonstrated that the bulk of the receptor is confined to the lateral
subdomains within the basolateral compartment; only minor amounts are
located apically. For the receptor fragment 71.GFP, a substantial part
of the GFP fluorescence signals was detected in the cell's interior,
indicating a partial transport defect of this fusion. The weaker cell
surface signals together with the intracellular signals prevent
resolution by LSM of whether this fusion is sorted apically or
basolaterally [a nonpolarized expression, however, was demonstrated by
selective cell surface biotinylation (see below)]. The additional
fusion of ICL2 (71/ICL2.GFP) led to receptor fragments with a similar localization to that of the wild type (i.e., a honeycomb pattern of
fluorescence signals in xy-scans and a lateral location in z-scans). In contrast, the receptor fragment containing the
C-terminal tail (71/CT.GFP) was mainly located apically, as evidenced
from the z-scans. The xy-scans consistently
revealed a less sharp and weaker honeycomb pattern, superimposed by
extensive GFP fluorescence signals from those cells scanned
horizontally at the level of their apical membranes. Scans of cells
expressing the receptor fragment containing ICL3 (71/ICL3.GFP) revealed
diffuse GFP fluorescence signals filling the cells interior, although
not the nucleus, demonstrating a complete transport defect of this
fragment. These results show that the individual cytoplasmic domains of
the V2 receptor mediate differently polarized
sorting in MDCKII cells. Furthermore, they indicate that the
basolateral transport signal of the V2 receptor
lies within its ICL2 domain.
|
) representing the complex-glycosylated fusion protein was
detected predominantly in the basolateral sample (see Fig. 5 below for
the verification of complex glycosylation of the fusion proteins).
Minor amounts were detected apically as described previously
(Schülein et al., 1998b
) were detectable by cell surface biotinylation,
consistent with the partial transport defect of this fusion. The
protein bands were present in roughly equivalent amounts in the apical
and basolateral samples demonstrating that no signal for polarized
sorting is present in 71.GFP. The strong signals obtained for
71/ICL2.GFP and 71/CT.GFP demonstrate that these two receptor fragments
are efficiently transported to the cell surface. The
complex-glycosylated 50- to 55-kDa form of receptor fragment
71/ICL2.GFP (marked by
) was found mainly in the basolateral sample,
whereas the complex-glycosylated 55- to 60-kDa form of receptor
fragment 71/CT.GFP (marked by
) was detected apically. For receptor
fragment 71/ICL3.GFP, no specific immunoreactive protein band was
detectable, consistent with its complete intracellular retention. The
results of the biotin targeting assays were thus entirely consistent
with those from the LSM localization study.
|
Residue Y148 of the ICL2 Domain is Not Involved in Basolateral
Sorting of the V2 Receptor.
Tyrosine-based motifs were
previously shown to determine the basolateral localization of various
membrane proteins (Matter et al., 1992
). The ICL2 domain of the
V2 receptor contains a tyrosine residue at
position 148 (Y148), the only tyrosine residue throughout the
cytoplasmic domains. To address the question of whether this residue
might contribute to a basolateral sorting signal of the V2 receptor, alanine substitutions were
constructed for both the full-length GFP-tagged receptor (WT.GFP) and
for the receptor fragment 71/ICL2.GFP (mutants Y148A.GFP and
71/ICL2/Y148A.GFP, respectively). Stably transfected MDCKII cell clones
expressing the GFP fusions were grown on polycarbonate filter supports,
and the GFP fluorescence signals were localized by LSM (Fig.
4). For both the wild-type and mutant
full-length V2 receptors, the z-scans revealed a predominantly basolateral localization of the GFP
fluorescence signals. The same was true for the wild-type and mutant
receptor fragments. These results demonstrate that Y148 is not part of a basolateral sorting motif in the ICL2 domain of the
V2 receptor.
|
The ICL3 Domain of the V2 Receptor Mediates ER
Retention.
The receptor fragment 71/ICL3.GFP is retained within
the cell. The diffusely distributed GFP fluorescence signals obtained for this fusion (see Fig. 2) point to the ER as the retention site. To
verify this assumption, glycosylation state analyses were performed
with crude membranes of stably transfected MDCKII cells. EndoH was used
to remove high-mannose glycosylations from ER forms of the receptor
fragments and PNGaseF to remove all N-glycosylations (i.e.,
high-mannose and complex glycosylations from ER and post ER forms,
respectively). Receptor fragments 71.GFP, 71/ICL2.GFP, and 71/CT.GFP
were also analyzed to prove that the protein bands identified by the
biotin targeting assay (see Fig. 3) did indeed represent
complex-glycosylated forms. WT.GFP was used as a positive control
for complex glycosylations. All fusions were analyzed in Western blot
experiments using polyclonal anti-GFP antibodies (Fig.
5). In the case of WT.GFP, the complex
(75-85 kDa; marked by *) and high-mannose (60-65 kDa marked by
)
glycosylated forms previously described for human embryonic kidney 293 cells (Krause et al., 2000
) were detected in the untreated membranes.
|
| 1. | Broad bands (marked by *) with apparent molecular masses of 48 to 52 kDa (71.GFP), 50 to 55 kDa (71/ICL2.GFP), and 55 to 60 kDa (71/CT.GFP). These protein bands were resistant to EndoH but sensitive to PNGaseF and thus represent the complex-glycosylated forms that had left the ER. Protein bands with equivalent molecular masses were consistently detected at the cell surface by the biotin-targeting assay (see Fig. 3). For receptor fragment 71.GFP, the intensity of this complex-glycosylated protein band was much weaker than for 71/ICL2.GFP and 71/CT.GFP, consistent with the partial transport defect of this receptor fragment. |
| 2. | Protein bands (marked by ) with apparent molecular masses of
38 kDa (71.GFP), 40 kDa (71/ICL2.GFP), and 42 kDa (71/CT.GFP). These
protein bands were sensitive to both EndoH and PNGaseF and thus
represent the high-mannose glycosylated forms of the fusions.
|
| 3. | Sharp protein bands (marked by #) with apparent molecular
masses of 34 kDa (71.GFP), 38 kDa (71/ICL2.GFP), and 40 kDa
(71/CT.GFP), representing the nonglycosylated forms of the fusions,
because the high-mannose glycosylated forms shifted to these sizes upon EndoH and PNGaseF treatment (calculated molecular mass, 36.09, 39.05, and 39.88 kDa, respectively). The complex-glycosylated forms shifted to
larger sizes (marked by ) upon PNGaseF treatment because additional
PNGaseF-resistant O-glycosylations are added to the N
terminus of the V2 receptor in the Golgi
apparatus, increasing the molecular mass (Sadeghi and Birnbaumer,
1999 |
); this
shifted upon EndoH treatment to the 40-kDa nonglycosylated form (marked
by #; calculated molecular mass, 40.34 kDa). Thus only EndoH-sensitive,
high-mannose glycosylated forms are present in the case of 71/ICL3.GFP,
demonstrating that this fusion is indeed trapped in the ER. In contrast
to the transport-competent receptor fragments, the nonglycosylated form
of this fusion was not detected in the untreated membranes at steady
state. ER accumulation may induce a rapid proteolytic degradation of
this receptor fragment and thus prevent saturation of the glycosylation
machinery. Compared with the other GFP fusions, the total amount of
immunoreactive 71/ICL3.GFP protein is substantially lower. This is
consistent with an increased proteolytic degradation. The nevertheless
strong GFP fluorescence signals detectable for this receptor fragment in Fig. 2 (the cell clones were selected for similar GFP fluorescence intensities; see also Experimental Procedures) are
explicable if one assumes a C-terminal degradation of the receptor
fragment. The peptide derived anti-GFP antibodies are directed against
the extreme C terminus of the protein (Krause et al., 2000The Sequence 247RRRGRR252 of the ICL3
Domain May Contain an "RXR" ER Retention Signal.
Two
interpretations are plausible for the ER retention of fragment
71/ICL3.GFP. (1) in contrast to the ICL2 domain and the C-terminal
tail, the ICL3 domain contains no signals that may facilitate transport
from the ER to the Golgi apparatus. "ER to Golgi" transport signals
are not well understood at present. Diphenylalanine and diacidic
motifs, however, which were described as serving to concentrate
membrane proteins in ER to Golgi vesicles (Fiedler et al., 1996
;
Nishimura and Balch, 1997
), are present in neither the ICL2 domain nor
the C-terminal tail. (2) receptor fragment fusions containing ICL3 may
be recognized and retained by the quality control system of the ER,
whereas those containing ICL2 and the C-terminal tail are not. It was
recently shown that membrane proteins may contain arginine framed (RXR)
ER retention signals in their cytoplasmic domains (Zerangue et al.,
1999
). It was suggested that these signals may be masked when subunits
of multimeric proteins assemble correctly [ATP-sensitive
K+ channels (Zerangue et al., 1999
);
-aminobutyric acid receptor subtype B receptor (Margeta-Mitrovic et
al., 2000
)], or if a monomer folds correctly [cystic fibrosis
transmembrane conductance regulator (Chang et al., 1999
)], but remain
unmasked in unassembled or misfolded proteins. Unmasking leads to ER
retention via unknown receptors. The ICL3 domain of the
V2 receptor contains an arginine rich sequence (247RRRGRR252; see Fig. 1)
with two putative RXR motifs, which may thus function in a similar
manner; i.e., they may be masked in the full-length wild-type receptor
but exposed in the 71/ICL3.GFP receptor fusion in the absence of the
normal folded receptor structure.
) was detected in roughly
equal amounts in the apical and basolateral samples of receptor
fragment 71/ICL3/R247-R252K.GFP consistent with the results obtained
from LSM. These results demonstrate that the transport defect of
receptor fragment 71/ICL3.GFP can be rescued by the lysine
substitutions and that the
247RRRGRR252 sequence can
function as an ER retention signal. Furthermore, the nonpolarized
expression of the rescued receptor fragment fashion demonstrates that
the ICL3 has no further apical or basolateral sorting signal.
|
L62-R64 (deletion of residues 62LAR64 at the junction of
transmembrane domain 1 and ICL1), which was previously shown to be
retained in the ER (Krause et al., 2000| |
Discussion |
|---|
|
|
|---|
We have assessed the functions of the cytoplasmic domains of the V2 receptor for intracellular transport in MDCKII epithelial cells. We show that the C-terminal tail of the V2 receptor mediates apical and the second intracellular loop basolateral plasma membrane location, respectively. Fusion of the third intracellular loop led to a receptor fragment that was not transported to the cell surface but was retained in the ER.
We have shown previously that the V2 receptor is
expressed in MDCKII cells predominantly basolaterally at steady state,
although minor amounts are located apically (Schülein et al.,
1998b
; Andersen-Beckh et al., 1999
). The data presented here may
explain these results and are consistent with a model in which the
V2 receptor contains signals for both apical and
basolateral membrane expression, the latter being dominant. The
identity of the basolateral sorting signal in ICL2 remains elusive.
Previously described basolateral sorting signals found in unrelated
membrane proteins were in most cases either of the tyrosine or the
dileucine type (Matter et al., 1992
; Hunziker and Fumey, 1994
). A
tyrosine residue in the C-terminal tail of the G protein-coupled
follicle-stimulating hormone receptor was also shown to be important
for its basolateral localization (Beau et al., 1998
). Tyrosine residue
Y148 of ICL2 (the only tyrosine residue in the whole cytoplasmic face
of the V2 receptor) does not, however, contribute
to such a signal. Basolateral transport of the corresponding alanine
mutants of the full-length receptor and of 71/ICL2.GFP was not
affected. Further studies will be required to delineate the basolateral
sorting signal in the ICL2 domain. For the
2A-adrenergic receptor, it was proposed that
the third cytoplasmic loop in its entirety (157 residues), rather than
a small specific signal, is responsible for basolateral expression
(Edwards and Limbird, 1999
). Because of its relative shortness (24 residues), it seems unlikely that this applies to the ICL2 of the
V2 receptor.
Several arguments support the assumption that the apical transport of
receptor fragment 71/CT.GFP is mediated by a transport signal within
the C-terminal tail.
| 1. | Most importantly, in the absence of an apical transport signal, one would expect the receptor fragment 71/CT.GFP to be delivered in a nonpolar fashion to the cell surface [i.e., that similar amounts would be expressed apically and basolaterally (as for the starting construct 71.GFP and the rescued construct 71/ICL3/R247-R252K.GFP)]. However, this was not the case. |
| 2. | It was recently shown that the C-terminal tail of rhodopsin
contains an apical sorting signal (Chuang and Sung, 1998 |
Our data indicate that an RXR ER retention signal is contained
within the sequence
247RRRGRR252 of ICL3, which
is unmasked in the case of receptor fragment 71/ICL3.GFP. It is
possible that the same will happen to the full-length receptor if
mutations lead to misfolding and thereby to exposure of the signal. The
participation of such a signal in the ER quality control apparatus was
recently described for the cystic fibrosis causing
F508 mutant of
the cystic fibrosis transmembrane conductance regulator protein (Chang
et al., 1999
). Here, mutation of all putative RXR signals led to a
restoration of transport and also to functional rescue of the protein
(Chang et al., 1999
). The participation of a RXR retention signal was
also described for
-aminobutyric acid receptor subtype B receptor
heterodimerization (Margeta-Mitrovic et al., 2000
).
In the case of the NDI-causing V2 receptor mutant
L62-R64, however, we failed to restore cell surface delivery by an
additional R247-R252K mutation. Several explanations are possible.
| 1. | It is not known whether the L62-R64 mutation in
particular leads to the exposure of the putative retention signal in
ICL3. This may only be the case for a subset of mutants.
|
| 2. | More than one arginine framed retention signal may be present
in the full-length V2 receptor, and mutation of
the 247RRRGRR252 sequence
alone may not be sufficient to restore receptor transport. The sequence
65RGR67 immediately
C-terminal of the L62-R64 mutation may constitute another retention
signal, which may be exposed in this mutant receptor. The sequence may
also be exposed in the case of the 71.GFP construct and cause the
partial transport defect of this fusion. Interestingly, a receptor
fragment containing only the N-terminal 71 amino acid residues of the
V2 receptor without the GFP moiety is completely retained in the ER
(Morello et al., 2001 |
| 3. | More than one system may be involved in the ER retention of
misfolded V2 receptors. In addition to the
unknown proteins binding to exposed RXR retention signals, association
of the misfolded receptors with chaperones may also contribute. A
prolonged association with the calnexin/calreticulin system on the
luminal side of the ER was indeed shown recently for misfolded
V2 receptors (Morello et al., 2001 |
The introduction of the R247-R252K mutation into a large number of transport defective NDI-causing mutant V2 receptors together with inhibition of the chaperones involved in ER retention of misfolded forms of the V2 receptor will help clarify these points in the future.
| |
Acknowledgments |
|---|
We thank W. Rosenthal for helpful suggestions during the course of this study and critical reading of the manuscript and A. Oksche for useful discussions. We also thank Gisela Papsdorf and Renate Loose of the cell culture facilities of the Forschungsinstitut für Molekulare Pharmakologie (FMP) and Erhard Klauschenz and Barbara Mohs from the DNA sequencing service group for their contributions. We are also grateful to Burkhard Wiesner and Brunhilde Oczko from the laser scanning microscopy group of the FMP.
| |
Footnotes |
|---|
Received March 5, 2001; Accepted July 24, 2001
This work was supported by grants from the Deutsche Forschungsgemeinschaft Sonderforschungsbereichen (SFB449). R.H. is a recipient of a fellowship from the Deutscher Akademischer Austauschdienst.
Ralf Schülein, Forschungsinstitut für Molekulare Pharmakologie, Robert-Rössle-Str. 10, 13125 Berlin, Germany. E-mail: schuelein{at}fmp-berlin.de
| |
Abbreviations |
|---|
V2 receptor, human vasopressin V2 receptor; GPCR, G protein-coupled receptor; MDCKII, Madin Darby canine kidney cells type II; ICL, intracellular loop; GFP, green fluorescent protein; RXR, retinoid X receptor; PBS-CM, phosphate-buffered saline with calcium and magnesium; PAGE, polyacrylamide gel electrophoresis; EndoH, endoglycosidase H; PNGaseF, peptide N-glycosidase F; LSM, confocal laser scanning microscopy; ER, endoplasmic reticulum; NDI, nephrogenic diabetes insipidus; PCR, polymerase chain reaction.
| |
References |
|---|
|
|
|---|
2A-adrenergic receptor.
J Biol Chem
274:
16331-16336
2-adrenergic receptor subtypes achieve basolateral localization in Madin-Darby canine kidney II cells via different targeting mechanisms.
J Biol Chem
271:
5017-5024This article has been cited by other articles:
![]() |
N. F. Berbari, A. D. Johnson, J. S. Lewis, C. C. Askwith, and K. Mykytyn Identification of Ciliary Localization Sequences within the Third Intracellular Loop of G Protein-coupled Receptors Mol. Biol. Cell, April 1, 2008; 19(4): 1540 - 1547. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Conn, A. Ulloa-Aguirre, J. Ito, and J. A. Janovick G Protein-Coupled Receptor Trafficking in Health and Disease: Lessons Learned to Prepare for Therapeutic Mutant Rescue in Vivo Pharmacol. Rev., September 1, 2007; 59(3): 225 - 250. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Arniges, J. M. Fernandez-Fernandez, N. Albrecht, M. Schaefer, and M. A. Valverde Human TRPV4 Channel Splice Variants Revealed a Key Role of Ankyrin Domains in Multimerization and Trafficking J. Biol. Chem., January 20, 2006; 281(3): 1580 - 1586. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bouley, H. Y. Lin, M. K. Raychowdhury, V. Marshansky, D. Brown, and D. A. Ausiello Downregulation of the vasopressin type 2 receptor after vasopressin-induced internalization: involvement of a lysosomal degradation pathway Am J Physiol Cell Physiol, June 1, 2005; 288(6): C1390 - C1401. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wuller, B. Wiesner, A. Loffler, J. Furkert, G. Krause, R. Hermosilla, M. Schaefer, R. Schulein, W. Rosenthal, and A. Oksche Pharmacochaperones Post-translationally Enhance Cell Surface Expression by Increasing Conformational Stability of Wild-type and Mutant Vasopressin V2 Receptors J. Biol. Chem., November 5, 2004; 279(45): 47254 - 47263. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Beau, M.-T. Groyer-Picard, A. Desroches, E. Condamine, J. Leprince, J.-P. Tome, P. Dessen, H. Vaudry, and M. Misrahi The Basolateral Sorting Signals of the Thyrotropin and Luteinizing Hormone Receptors: An Unusual Family of Signals Sharing an Unusual Distal Intracellular Localization, but Unrelated in Their Structures Mol. Endocrinol., March 1, 2004; 18(3): 733 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Bouley, T.-X. Sun, M. Chenard, M. McLaughlin, M. McKee, H. Y. Lin, D. Brown, and D. A. Ausiello Functional role of the NPxxY motif in internalization of the type 2 vasopressin receptor in LLC-PK1 cells Am J Physiol Cell Physiol, October 1, 2003; 285(4): C750 - C762. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Oksche, G. Leder, S. Valet, M. Platzer, K. Hasse, S. Geist, G. Krause, A. Rosenthal, and W. Rosenthal Variant Amino Acids in the Extracellular Loops of Murine and Human Vasopressin V2 Receptors Account for Differences in Cell Surface Expression and Ligand Affinity Mol. Endocrinol., April 1, 2002; 16(4): 799 - 813. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||