Sanofi-Synthélabo, Department of Molecular and Functional
Genomics, Rueil-Malmaison, France (F.S., E.C., N.W., D.C., D.G., F.B.);
and Department of Physiology, Centre Médical Universitaire,
Geneva, Switzerland (E.C., S.B., D.B.)
 |
Introduction |
Nicotinic
acetylcholine receptors are members of the ligand-gated ion channel
superfamily that are formed by the pentameric association of multiple
subunits (Galzi and Changeux, 1995
). In vertebrates, neuronal nAChR
subunits are encoded by a large family of genes and many of them have
already been identified in humans (Boyd, 1997). Special interest has
been devoted to the 
7- to 9-subunits that have the unique
capacity of forming functional homomeric receptors (Couturier et al.,
1990; Anand et al., 1993; Elgoyhen et al., 1994; Gotti et al., 1994).
Expression of the most recently cloned subunit in this subfamily, 9,
has been described in only very restricted areas such as the pituitary
pars tuberalis, the olfactory epithelium and in the cochlea (Elgoyhen
et al., 1994). In particular, this subunit has been shown to be
expressed on the cochlear outer hair cells (OHCs), where it is supposed to mediate the cholinergic efferent transmission (Puel, 1995), which
activates hyperpolarizing current mediated by small conductance calcium-activated potassium channels (Oliver et al., 2000). Functional properties of the receptors obtained by expression of the 9-subunit closely resemble those of native nAChRs from OHC that display very
original pharmacological features (Erostegui et al., 1994; Guth and
Norris, 1996). However, the amplitude of the acetylcholine-evoked currents generated by the expression of the 9-subunit in
Xenopus laevis oocyte remains unusually small and the
fraction of positive cells very low. These data suggest that although
able to reconstitute homomeric receptors, the 9-subunit may require
another subunit to be fully functional, although attempts to coexpress
9 with other known nAChR subunits failed to generate functional
receptors (Elgoyhen et al., 1994). Because other genes coding for
neuronal nAChRs could well exist in the human genome, we have sought to clone the human 9-subunit and examined the possibility of
identifying the missing 9-partner.
| |
Materials and Methods |
Cloning of the Human 9- and 10-cDNAs
The rat 9-nAChR amino acid sequence (Swissprot accession number
P43144) was used to perform a TblastN search against an expressed
sequence tag (EST) database. A single EST was identified which
presented a high degree of homology with the rat 9-sequence and the
corresponding cDNA clone originating from a human whole embryo
(8-week-old) cDNA library was retrieved. This cDNA clone was found to
contain a nearly complete open reading frame (ORF) coding for the human
9 nAChR subunit. An unspliced intron was present which was removed
by PCR. The sequence corresponding to the missing 5' end of the ORF and
a portion of the 5'-untranslated region was obtained from human genomic
DNA using the Genome Walker system (CLONTECH, Palo Alto, CA). An
oligonucleotide containing 16 nucleotides of the 5'-untranslated region
and the first 18 nucleotides of the ORF was then synthesized to
complete the original cDNA by PCR. The resulting full-length cDNA clone
(GenBank accession number AJ243342) was sequenced and inserted into the
pTracer-EF eukaryotic expression vector (Invitrogen, Carlsbad, CA) for
further use.
The TblastN search also resulted in the identification of an EST from
the GenBank database (accession number AA243627) that had been
identified as a putative homolog of the rat 9-subunit but whose
sequence identity was lower than that expected for the 9-ortholog.
The clone was obtained from the IMAGE Consortium (685357;
http://image.llnl.gov/) and its sequencing showed that it contained a
partial ORF corresponding to a novel nAChR -subunit. A 700-bp
fragment of the 10-cDNA was used as a probe to analyze 10-mRNA
expression in human tissues to obtain the missing coding sequence.
Strong hybridization was observed in skeletal muscle and human Marathon
(CLONTECH) skeletal muscle cDNA was used to clone the 5' coding region
of the 10-cDNA by 5' RACE. Those experiments showed the presence of
two unspliced introns in this 5' region. Total coding sequence (GenBank
accession number AJ278118) was obtained from several RACE-PCR products
and a full-length cDNA clone containing the entire coding sequence was
then obtained by RT-PCR from human pituitary mRNA and inserted in
pTracer-EF vector. Detailed intron-exon boundaries were analyzed by
sequencing PCR products obtained from human genomic DNA.
Chromosomal Localization of 10-Gene.
A PAC
containing the sequence of 10 was isolated by PCR using
oligonucleotide primers flanking an intron. It was then used to
localize the 10 gene to 11p15.5 using fluorescence in situ hybridization (Incyte Genomics, Palo Alto, CA).
Northern Blot Analysis.
Multiple human tissue Northern blots
(2 µg/lane; CLONTECH) were hybridized with a BspHI 360-bp
fragment of the 10-cDNA. The probe was radiolabeled with
[32P]dCTP (PerkinElmer Life Sciences,
Boston, MA) using the random priming technique (Megaprime labeling kit;
Amersham Biosciences, Little Chalfont, Buckinghamshire, UK). Stringent
washing conditions (65°C; 0.1× standard saline citrate/0.1% SDS)
were used. The blots were scanned using an STORM 860 Imager (Molecular
Dynamics, Sunnyvale, CA).
Analysis of 9- and 10-mRNA Expression by RT-PCR.
Human
pituitary gland mRNA was obtained from CLONTECH. Rat total RNA from
pituitary gland, tongue, nasal epithelium, and cochlea was isolated
from frozen tissues dissected from adult Sprague-Dawley rats using
RNeasy silica-gel membrane spin columns (QIAGEN, Hilden, Germany).
First strand cDNA synthesis was carried out using 50 ng of mRNA or
about 1 µg of total RNA with the SuperScript reverse transcriptase
(Invitrogen). Specific human and mouse 9- and 10- and rat
10-primers were designed for PCR amplification: human 9,
ctacaatggcaatcaggtgg and atgatggtcaacgcagtgg (predicted amplified fragment length, 425 bp); human 10, tctcaagctgttccgtgacc and aaggctgctacatccacgc (predicted amplified fragment length, 391 bp);
mouse 9, ccttacccagatgtcaccttcactc and aacaccatagcaaagaaaatccaca (predicted amplified fragment length, 177 bp); mouse 10,
aatgtgaccctggaggtgac and gtaggcatctgtccacacytg (predicted amplified
fragment length, 108 bp); and rat 10, tgagaccagtggcagatacag and
ccattcaacgttctccacg (predicted amplified fragment length, 472 bp). The
predicted amplified fragments contain either one or two intron
positions, those in 10-segments being known to correspond to
unspliced introns in human skeletal muscle. PCRs were performed on 5 µl of the 20 µl of cDNA synthesis volume using the Expand long
template polymerase mix (Roche Diagnostics, Mannheim, Germany) and
buffer, 0.5 mM dNTP, 0.5 µM each primer in the following cycling
conditions: 3 min at 94°C followed by 35 cycles of 30 s at
94°C, 30 s at 58°C (rat 10 primers) or 64°C (human 9
and 10 primers), and 1 min at 68°C, followed by 5 to 10 cycles of
30 s at 94°C, 30 s at 58 or 64°C, and 1 min at 68°C
with an auto-extension step of 20 s per cycle, followed by 4 min
at 68°C. All PCR products were subcloned into pCR-II Topo
(Invitrogen) vector and sequenced.
Full-length 10-cDNA containing the entire open reading frame used
for expression analysis was obtained using the following primers:
tcacatccagagacctgcc and tgagagctccaatacccagc. PCR conditions were as
described above with the following cycling conditions; 3 min at 94°C
followed by 25 cycles of 30 s at 94°C, 30 s at 61°C, and
1.5 min at 68°C, followed by 10 cycles of 30 s at 94°C,
30 s at 58 or 64°C, and 1.5 min at 68°C with an autoextension
step of 10 s per cycle, followed by 4 min at 68°C.
Western Blot Experiments
Human epidermal
keratinocytes were obtained from BioWhittaker Inc. (Walkersville, MD)
and grown as recommended by the supplier. COS cells were transfected
using FuGene (Roche Diagnostics) according to the manufacturer's
instructions using 2 µg of vector. Protein extracts were obtained by
recovering cell monolayers in lysate buffer [100 µl of Laemmli
buffer (Bio-Rad, Hercules, CA)/5% (v/v) 
-mercaptoethanol and 50 µl of PBS were used for 4 × 105 cells]. Twenty
microliters of cell lysate per lane was loaded onto SDS-polyacrylamide
gel electrophoresis 4 to 15% gradient acrylamide gel (Bio-Rad) and
proteins separated by electrophoresis. The gels were electroblotted
onto a nitrocellulose membrane (Amersham Biosciecnes). The membranes
were blocked with 5% nonfat milk/0.1% Tween 20 (Sigma, St Louis, MO)
in PBS buffer for 1 h. Each membrane was incubated with a primary
anti-10 antibody (Eurogentech, Seraing, Belgium) diluted to 10 µg/ml in PBS supplemented with 0.1% Tween 20, 5% nonfat milk,
washed three times in PBS-Tween 20 0.1%, and incubated 1 h with a
secondary goat anti-rabbit antibody conjugated to horseradish
peroxidase (Sigma) diluted 1:10,000. Binding was visualized with the
ECL Western blot detection system (Amersham Biosciecnes).
For control experiments in which the specificity of binding was tested,
the primary anti-10 serum was preincubated for 1 h with 200 µg/ml of the immunizing peptide (CGQSRPPELSPSPQSPE) in PBS-0.5%
Tween 20.
In Situ Hybridization.
RT-PCR was used to amplify a 494-base
pair cDNA (corresponding to nucleotide 180-674 of the GenBank sequence
AF196344) from rat pituitary mRNA. The T7 promoter was added by a
second PCR and then the cDNA was purified after gel electrophoresis and sequenced. The riboprobe was transcribed with
35S-labeled UTP, purified by phenol/chloroform
extraction, and precipitated.
Brains from Sprague-Dawley male rats (180-200 g) and E18 rat embryos
were frozen. Fifteen-micrometer-thick cryostat sections were defrosted,
rehydrated, and fixed with 4% paraformaldehyde. After proteinase K
treatment, acetylation, and prehybridization, the slides were
hybridized overnight at 55°C with 5 × 104
cpm/µl of probe in a hybridization solution (60% formamide, 300 mM
NaCl, 20 mM Tris, pH 7.4, 5 mM EDTA, pH 8, 10% dextran sulfate, 0.4 ng/µl tRNA, 1× Denhardt's solution, and 200 mM dithiothreitol). After high stringency washes, slides were dehydrated and dipped in
Kodak NBT2 emulsion and stored for 1 month in the dark at 4°C. After
development the slides were lightly colored with Hemalun, mounted, and
examined with light- and dark-phase microscopy.
Oocyte Preparation and Injection.
X. laevis
oocytes were isolated and prepared as described previously (Bertrand et
al., 1991). The oocytes were intranuclearly injected with 2 ng of
expression vector cDNA. They were kept in a separate well of a 96-well
microtiter plate at 18°C. OR2 control medium consisted of 88 mM NaCl,
2.5 mM KCl, 10 mM HEPES, 1 mM MgCl2, and 2 mM
CaCl2, pH 7.4, adjusted with NaOH.
Electrophysiology.
Throughout each experiment, oocytes were
continuously superfused with control medium and fluid exchanges were
controlled by electromagnetic valves. Gravity-feed solution was flowing
at an approximate rate of 6 ml/min. Oocytes were measured 2 to 4 days after cDNA injections. Electrophysiological recordings were performed using a two-electrode voltage-clamp (GeneClamp amplifier; Axon Instruments, Union City, CA). Electrodes were made of borosilicate glass, pulled with a BB-CH-PC puller (Mecanex, Nyon, Switzerland), and
filled with a filtered 3 M KCl. Unless specified, the holding potential
was 
75 mV. Oocytes were continuously maintained at 18°C during
preparation and experiments. Calcium permeability measurements were
effectuated using N-methyl-D-glucamine
and oocytes were incubated for at least 6 h with the calcium
chelator
1,2-bis(2-aminophenoxy)ethane-N',N,N',N'-tetraacetic acid-acetoxymethyl ester (BAPTA-AM) to prevent activation of the endogenously expressed calcium activated chloride currents (Boton et
al., 1989). Data from the reversal potential were fitted using a
Hodgkin-Goldman-Katz constant field equation appropriately adapted (Jagger et al., 2000; Katz et al., 2000). Calcium blockade was simulated using the empirical Hill equation (see Katz et al., 2000).
Binding Experiments.
Measure of receptor expression on the
oocyte surface was carried out using 125I--bgt
(2000 Ci/mmol, Amersham). Oocytes were incubated for 2 h in 200 µl of a 50 nM solution of 125I--bgt in OR2
buffer and briefly washed four times with OR2, and the amount of
radioactivity determined by 
-counting. Electrophysiological recordings were carried out to verify proper expression of 9- or
9-10-expression.
| |
Results |
Cloning of the Human 9-Subunit.
A search by homology was
performed against human EST databases using the rat 9 nAChR amino
acid sequence. A single EST was found with very high homology and the
relevant cDNA clone was fully sequenced. The results showed that this
clone encoded a protein displaying more than 90% identity to the rat
9 sequence. A full-length cDNA clone was then constructed and
inserted into an expression vector (see Materials and
Methods).
The resulting clone encodes a 479-amino acid polypeptide with a
predicted molecular mass of 54.7 kDa. The human 9-deduced amino acid
sequence exhibits 90.8% identity with its rat homolog (Fig.
1A).
View larger version (54K):
[in this window]
[in a new window]
|
Fig. 1.
Comparison of the deduced amino acid sequences from
the human 9- and 10-subunits together with sequences of other
nAChR subunits. A, alignment of the deduced human 9- and
10-subunit with the rat 9-subunit. Identical residues between the
three subunit sequences are boxed. The predicted signal peptides are
underlined in dotted line while predicted transmembrane domains (TM)
are underlined in bold line. *, characteristic cysteine residues
found in all nAChR -subunits. Arrows indicate the positions of the
four introns detected within the coding sequences of both 9- and
10-genes. B, dendrogram illustrating the relationship between the
novel 10-subunit (boxed) and the other known nAChR subunits. This
tree was generated from the alignment (Clustal W software) of all known
human nAChR subunit amino acid sequences together with the chick
8-subunit. Square bracket highlights the closer similarity between
10 and the other subunits known to form functional homo-oligomeric
receptors.
|
|
Identification and Isolation of a Novel Human nAChR
-Subunit.
The homology search carried out in the human
databases with the rat 9-nAChR amino acid sequence also identified a
different EST that showed relatively high homology to the 9-subunit
sequence. The missing 5' extremity of the corresponding partial cDNA
clone was then obtained by 5' RACE and a continuous cDNA containing the
entire open reading frame was generated by RT-PCR from human pituitary
mRNA. This ORF encoded for a 450-amino acid polypeptide (Fig. 1A) and
classified as the nAChR 10-subunit. Amino acid comparison with the
other known nAChR subunit (Fig. 1B) indicates that this novel
10-subunit is more closely related to the subunits that are able to
form functional homomeric receptors (7, 8, and 9) rather than
to those requiring a -subunit for functional expression.
Using fluorescence in situ hybridization to human chromosomes, the
10 gene was mapped to 11p15.5. This region contains a number of
genetic diseases loci and most noticeably a locus linked to a deficit
in inhibitory gating phenotype related to the brain's response to
auditory stimuli (Freedman et al., 1994), although more precise genetic
mapping would be required to link 10 to this locus.
Analysis of 10-Expression.
Because 10 presents
relatively high amino acid sequence similarity with 9, mRNA
expression of 10 was investigated in tissues known to express the
9-subunit. The presence of both 9- and 10-transcripts was
detected by RT-PCR in human pituitary gland (Fig.
2A) from which a cDNA encoding the
complete coding sequence was isolated and in keratinocytes (not shown).
In addition, the presence of partially spliced 10-transcript was
also detected in these tissues. Northern blot analysis showed a strong
expression of a single 6.4-kilobase transcript in skeletal muscle and a
faint signal in heart (not shown). However, RT-PCR experiments showed that this transcript is not completely spliced in these tissues, and as
such would not be translated into a full-length 10-protein. Further
analysis showed that the position of introns within the gene structure
(Fig. 1A) is similar to that described for the rat 9-gene (Elgoyhen
et al., 1994).
View larger version (48K):
[in this window]
[in a new window]
|
Fig. 2.
Analysis of 9- and 10-expression by RT-PCR (A)
and western blot (B). A, RT-PCR results obtained from human and rat
tissue RNAs using 9- and 10-specific primers. A sample of 5 µl
of each reaction was loaded on ethidium bromide-stained agarose gels.
The two 10-fragments seen for human pituitary correspond to fully
spliced transcript (391 bp) and transcript with a partially spliced
intron 2 (453 bp). B, visualization of 10-subunit expression in
human keratinocytes by western blot. A 55-kDa band is specifically
recognized. A band of slightly higher molecular mass (about 58 kDa,
possibly due to different glycosylation) is recognized for
10-transfected COS cells. Preincubation of the anti-10 antibody
with 200 nmol of immunizing peptide abolishes the detection of the
protein. No staining was detected for COS or 9-transfected COS cell
protein extracts.
|
|
To verify that correctly processed 10-mRNA leads to the expression
of 10-protein, a Western blot analysis was carried out on human
keratinocyte protein extract. The results (Fig. 2B) show that an
affinity-purified anti-10 antibody recognized a major protein band
of about 55 kDa. The specificity of the antibody was confirmed in
control experiments showing that the staining of this band could be
eliminated by preincubating the antibody solution with the
10-peptide used for immunization and that a band of similar size
could be labeled with protein extract from 10-transfected but not
from 9-transfected COS cells (Fig. 2B).
RT-PCR analysis was also carried out on rat for tissues that were not
available from human, the rat 10 ortholog sequence having recently
been deposited in GenBank (accession number AF196344). A PCR product
corresponding to 10-mRNA with properly spliced introns 2 and 3 was
also detected in the rat pituitary gland and in the cochlea, although,
in contrast, no 10- signal was detected in rat tongue or whole brain
(Fig. 2A). Similarly, both 9- and 10-transcripts were found (not
shown) in the UB/OC-2 mouse cochlear cell line known to express
9-containing nAChRs (Jagger et al., 2000). A cRNA rat 10-probe
was also hybridized onto sections of adult rat brain. 10-mRNA
expression was found in the pars tuberalis region of the pituitary
gland (Fig. 3), exactly as described previously for the rat 9-transcript (Elgoyhen et al., 1994).
View larger version (67K):
[in this window]
[in a new window]
|
Fig. 3.
In situ hybridization of 10-mRNA in rat pituitary.
Bright (A) and dark (B) field pair photomicrographs of adult rat brain
section through the third ventricule (3V) hybridized with 10-cRNA.
Hybridization is apparent in the pars tuberalis (PT) of the
pituitary.
|
|
Functional Expression of 9 and 10 in X. laevis
Oocytes.
Reconstitution experiments of the human 9- and
10-subunits were carried out by intranuclear cDNA injections in
X. laevis oocytes. Expression of the human 9-cDNA yielded
functional receptors that can be
activated by acetylcholine with an EC50 of
30 ± 6 µM (Fig. 4A; Table 1).
However, the amplitude of this acetylcholine-evoked current was small
by comparison with current recorded in sibling oocytes expressing the
homomeric human 7 receptor (not shown). The human 9-receptor also
exhibited a peculiar pharmacological profile similar to that displayed
by the rat ortholog. For example, nicotine evoked no detectable
currents but acted as an antagonist with an IC50
of 41.2 ± 5.4 µM (not shown).
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 4.
Properties of 9- and 9-10-expressing
oocytes. A, acetylcholine and choline evoked currents in oocytes
expressing the human 9-receptor. Left illustrates typical currents
evoked by three concentrations of these two agonists.
Concentration-response curves to acetylcholine and choline are
represented in the right. B, oocytes expressing the 9- and
10-subunits display robust currents in response to acetylcholine,
carbachol or choline. Typical currents are presented in the left and
concentration-response relationships in the right. Lines through the
data points are best fit obtained with the Hill equation. Corresponding
values are given in Table 1.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1
Comparison of responses of 9 and 9-10 expressing oocytes to
different nicotinic ligands. Values are indicated with their respective
S.E.M. The number of cells tested in each condition is indicated in
parenthesis.
|
|
Surprisingly, despite its homology with 9, 10-cDNA failed to
reconstitute functional homomeric receptors in X. laevis
oocytes. Application of acetylcholine concentrations up to 1 mM
elicited no currents in cells injected with this subunit alone (not
shown). Coinjection of the available -subunits (2 and 4)
remained ineffective, and no current could be detected in any of the
configurations tested (not shown). In contrast, robust ACh-evoked
currents were recorded in oocytes injected with equivalent amounts of
both the 9- and 10-cDNAs (Fig. 4B). Comparison of the amplitudes
of the ACh-evoked currents in oocytes injected with the 9-10
mixture or 9 alone confirmed that presence of the 10-subunit
markedly influences the amplitude of the acetylcholine evoked currents, suggesting that this protein is probably integrated in the
9-receptor complexes.
To examine further this phenomenon, the physiological and
pharmacological profiles of receptors reconstituted in oocytes injected with the 9-10 mixture or 9 alone were compared. Although it is
known that acetylcholine is the natural agonist of 9-containing receptors and that these receptors are inhibited by nicotine (Elgoyhen et al., 1994), little information is available regarding other agonists. Choline in the millimolar range is a powerful agonist of the
homomeric 7-receptors (Papke et al., 1996). As shown in Fig. 4A,
choline behaves as a partial agonist at 9-expressing oocytes with an
EC50 in the high micromolar range (Table 1). Comparison of the concentration-response curves evoked by either acetylcholine or choline reveals no significant differences between oocytes injected with 9 alone or the 9-10 mixture (Fig. 4). Concentration-response curves obtained with carbachol illustrate that
this substance also acts as a partial agonist that evokes about 76% ± 4 (n = 6; Table 1) of the maximal acetylcholine-evoked current in oocytes injected with the 9-10 mixture. No differences in response time-courses could be observed between 9 and 9-10 expressing oocytes for the agonists tested. Other typical nicotinic receptor agonists such as epibatidine or
1,1-dimethyl-4-phenylpiperazinium only elicited very small responses on
9-10 expressing oocytes (Table 1). Moreover, as predicted on the
basis of the 9 properties, nicotine acted as an antagonist at the
9-10 receptor (not shown).
As complementary characterization, we then examined the effects of
competitive and noncompetitive inhibitors. It has been widely
documented that the snake toxin -bgt is a potent competitive inhibitor of homomeric 7- and 9-receptors (Couturier et al., 1990; Elgoyhen et al., 1994). Although this toxin blocks in a quasi-irreversible manner homomeric chick 7 nAChRs (Couturier et
al., 1990), reversibility has been described on nicotinic receptors from guinea pig OHC (Lawoko et al., 1995). In agreement with these previous observations, exposures to -bgt (100 nM, 30 min) caused almost a complete inhibition of the acetylcholine-evoked current (Fig.
5A, upper). Reversibility of this
blockade was, however, observed within 15 to 40 min after the toxin had
been removed. Homomeric 9 receptors displayed an
IC50 to -bgt of about 2.1 nM (n =
5), whereas half -blockade was observed only at 14 nM (mean of two to
six cells for each data point) in oocytes expressing 9-10 (Fig.
5B). The 7-fold difference in sensitivity to -bgt suggests that
10 must participate in the formation of the receptor binding site
and therefore that both 9 and 10 can assemble in the same
receptor complex. Challenge with the antagonist
d-tubocurarine revealed that this compound inhibits the
homomeric 9 receptors with an IC50 of roughly
2 µM, whereas half-inhibition of 9-10-expressing oocytes was
already observed at 0.73 µM (Figs. 5, C and D). Both the low Hill
coefficient and the increase in the response decay caused by
d-tubocurarine on 9-10-expressing oocytes suggest that
this compound may act as an open channel blocker at this receptor
subtype. The higher Hill coefficient of d-tubocurarine concentration-response curve at 9-receptors indicates that this compound may preponderantly act as a competitive inhibitor at the
homomeric form of this receptor. In addition, the lower
IC50 value of these receptors for
d-tubocurarine indicates an interaction with different amino
acid residues.
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 5.
Sensitivity of 9 and 9-10 to nicotinic
receptor antagonists, -Bgt and d-tubocurarine. A, the
9 and 9-10 acetylcholine-evoked currents are reversibly
blocked by -Bgt. Time course of the recoveries from blockade for two
typical recordings are illustrated. B, concentration response
inhibition relationship for 9 (squares) and 9-10 (diamonds).
Lines through the data points are the best fit obtained with a Hill
equation with respective IC50 values of 2.1 and 14 nM and
nH of 1.3 and 1.3 for 9 and 9-10. C, effects of
d-tubocurarine on the amplitude and time course of
acetylcholine evoked currents. d-Tubocurarine was both
pre- (20 s) and coapplied with a fixed concentration of acetylcholine
(40 µM, 5 s). D, dose-response inhibition profile, measured at
the peak current, for the 9 (squares) and 9-10 (diamonds).
Lines correspond to the best fits obtained with the Hill equation with
respective IC50 values of 2 and 0.73 µM and
nH of 1.6 and 0.9 for 9 and 9-10 (n
= 4).
|
|
Whether the difference between current amplitude obtained with 9
alone or 9-10-subunits was due to either a low level of 9-surface expression or the fact that functional receptors require the assembly of the two subunits was analyzed by measuring -bgt binding on oocyte surface. Interestingly, a significant amount of
-bgt binding was observed in oocytes injected with the 9-subunit alone (Table 2). Significant amount of
-bgt binding was also observed in 9-10 oocytes but for
technical difficulties, no attempt was made to correlate the current
amplitude and amount of binding.
View this table:
[in this window]
[in a new window]
|
TABLE 2
Determination of [125I]-Bgt binding to the surface of
9- or 9+10-injected oocytes.
Values are indicated in femtomoles/oocyte with their respective
standard error, with the number of cells tested in parenthesis.
|
|
One of the common biophysical properties of all the neuronal nicotinic
acetylcholine receptors is their strong inward rectification (Couturier
et al., 1990; Mathie et al., 1990; Elgoyhen et al., 1994). Highly
nonlinear current-voltage (I-V) relationships were also reported for
the 9-receptor (Katz et al., 2000), indicating that these receptors
may be more complex than more classical nAChRs. A typical rectification
was observed when voltage ramps protocols were performed from positive
to negative, whereas an outward rectification was observed when the
ramp was effectuated in the opposite direction (Fig.
6A). The comparable inward rectification
observed with different steady holding current (Fig. 6B) suggests that
the difference between positive to negative ramp is attributable to a
slowly appearing channel blockade. Because of the time persistence of this blockade, negative to positive ramps failed to relieve the block,
and only the outward rectification is observed. Thus, coexpression of
the 10-subunit causes no detectable modification of the receptor I-V
curve. Because a negative reversal potential was observed both in
BAPTA-AM treated cells and in absence of extracellular calcium (data
not shown), it must be attributed to a permeability ratio of sodium
versus potassium slightly lower than unity (best fit was obtained with
a pNa/pK of 0.65).
View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6.
Reversal potential of the ACh-evoked currents at
9-10 receptors. A, current-voltage (I-V) was measured using a
sawtooth voltage protocol (ranging from 40 to 75 mV, 1800 ms, thick
trace) at the peak of the ACh-evoked current. Subtraction of the
passive cell properties was obtained by repeating the same measure in
absence of ACh. The thin line illustrates the I-V curve recorded in the
same condition for a ramp starting at 75 mV and ending at +40 mV. To
minimize chloride contamination, oocytes were incubated for at least
6 h in BAPTA-AM (100 µM). B, I-V relationship measured at steady
holding potentials. To support the eye, data points have been connected
by straight line. Inset, superposition of the current traces measured
in B (ACh 1 mM, 3s).
|
|
Chimeric 9-10-Subunits Form Fully Functional Acetylcholine
Receptors.
Considering the relatively high homology between 9-
and 10-amino acid sequences, it was surprising to find that
homomeric 10-receptors could not form functional ligand-gated
channels. To get a better understanding of the structural features
behind this difference we constructed and analyzed the properties of a
chimeric 9:10-subunit. The chimeric 9:10-cDNA was obtained by fusing the amino-terminal region of 9 up to the first predicted membrane-spanning domain with from this point the remaining 3' sequence
coding for the 10-subunit (Fig. 7A).
The resulting construct was injected into X. laevis oocytes
and the electrophysiological responses to acetylcholine analyzed. As
shown in Fig. 7B, robust currents were evoked in response to
acetylcholine in oocytes expressing the 9:10-chimera with an
average of 12.6 µA ± 1.5 (n = 12). The
concentration-response relationship for acetylcholine further revealed
an enhanced sensitivity of the chimera to this agonist accompanied by a
higher Hill coefficient. On the basis of our current structure function
relationship knowledge, it would be predicted that the chimera should
display the ligand-binding properties of the 9-receptor and the
ionic pore properties of 10-containing receptors. Determination of
the concentration-response inhibition by d-tubocurarine
illustrates that indeed the 9:10-chimera displays a higher
sensitivity than oocytes expressing the 9:10-mixture (Fig. 7C).
Moreover, the chimera sensitivity to -bgt is closer to
9-homomeric than 10-containing receptors with a lower
IC50 and faster recovery (Fig. 7D).
View larger version (24K):
[in this window]
[in a new window]
|
Fig. 7.
The 9:10-chimera reveals properties of the
ligand binding site and the ionic pore. A, schematic representation of
the 9:10-chimera (dark area = 9-segment). The arrow
indicates the point of fusion between the two proteins. B,
acetylcholine sensitivity of the 9:10-chimera is compared with
those of oocytes expressing either 9- or 9-10-receptors
(left). Lines are the best fit obtained with the empirical Hill
equation with an EC50 of 10 µM and nH of
1.5. Average currents evoked by saturating acetylcholine concentrations
are represented for the different cDNA expression (right). Numbers of
cells tested in each condition were, respectively, of 18 for 9, 29 for 9-10, 12 for 9:10, and 24 for 10. C, differential
sensitivity of 9:10 to d-tubocurarine. Lines
through the data points are the best fits obtained with the empirical
Hill equation an IC50 of 0.3 µM ± 0.04 and
nH of and 1.16 (n = 7). Typical
acetylcholine evoked currents recorded in control and presence of
d-tubocurarine are shown in the right. D,
concentration-response inhibition profile of -Bgt reveals a higher
sensitivity of the 9:10-chimera. Best fit of the data points
(continuous line) was obtained with the Hill equation with an
IC50 of 3 nM and nH of 1.3. Typical recovery
from blockade are represented by the successive acetylcholine evoked
currents presented in the right.
|
|
A high calcium permeability of acetylcholine receptors expressed at the
outer hair cells has been shown to be one of the key features of the
efferent control of the cochlea (Housley and Ashmore, 1992). We have
examined the calcium permeability of the 9-10-heteromer and
9:10-chimera. In agreement with previous observation (Katz et
al., 2000), reduction of the calcium concentration caused a significant
increase of the ACh-evoked current of the three receptor subtypes (Fig.
8A) and a voltage-dependent blockade
caused by calcium was also detected (not shown). When calcium was
omitted from the extracellular medium a reduction of the responses was observed. As seen from data presented in Fig. 8, B and C, the three
receptors each display a marked permeability to calcium.
View larger version (28K):
[in this window]
[in a new window]
|
Fig. 8.
Effects of extracellular calcium and calcium
permeability of 9, 9-10, and 9:10 receptors. A, Typical
ACh-evoked currents recorded in 9 (top traces), 9-10 (middle
traces), and 9: 10 (lower traces) expressing oocytes. Cells were
held at 70 mV and challenged with 300 µM ACh (indicated by the
bars) in different external calcium concentrations, values indicated
above the traces. B, current voltage relationships recorded in
different external calcium concentration in
N-methyl-D-glucamine medium and BAPTA-AM. C,
plot of the reversal potential, measured in C, as a function of the
extracellular calcium concentration. Dashed lines indicate the best fit
obtained with eq. 1, derived from the Goldman-Hodgkin-Katz equation
with a pNa/pK of 0.65. Continuous lines
were obtained using the same equation multiplied by an empirical Hill
equation to take into account the calcium blockade. Relative calcium
permeability for the three receptor types are indicated.
|
|
| |
Discussion |
Although a fair number of genes coding for neuronal nAChRs have
already been identified it is clear that reconstitution experiments have failed to describe all the subtypes observed in native cells (Pugh
et al., 1995; Sorenson and Gallagher, 1996; Cuevas and Berg, 1998). The
sequencing of the full genome of the nematode Caenorhabditis elegans has revealed the existence of over 40 potential genes encoding nicotinic acetylcholine receptor subunits in this organism (Littleton and Ganetzky, 2000), whereas to date only 16 nAChR subunits
have been cloned in vertebrates (Lindstrom, 1997). Thus, yet
undiscovered subunit could account for the existence of novel receptor
proteins. In this work, we present evidence for the existence of a new
nAChR subtype that would be composed by the association of 9 with a
novel 10-subunit.
When expressed in X. laevis oocytes, the human 9-subunit
was able to form recombinant homomeric channels activated by
acetylcholine with properties similar to those reported for the rat
9 (Elgoyhen et al., 1994). As for the rat 9, the currents
recorded were small (rarely over 100 nA), compared with those obtained
with other nicotinic subunits that can form functional homomeric
receptors, such as 7 or 8 (Couturier et al., 1990; Bertrand et
al., 1993; Gerzanich et al., 1994; Gotti et al., 1994).
Despite its sequence homology with 9, the 10-subunit failed to
reconstitute a functional receptor alone or in combination with other
nAChR subunits. However, the coexpression of human 9- and
10-subunits resulted in a dramatic increase (about 100-fold) of the
amplitude of the acetylcholine-evoked currents compared with that
obtained with 9 alone. The binding experiments carried out with the
125I--bgt on oocytes injected either with 9
alone or the mixture 9-10 yielded surprising results. First,
oocytes injected with 9 alone displayed a significant amount of
-bgt binding, whereas very small or no detectable currents could be
measured in sibling oocytes. This suggests that 9-subunits are
properly synthesized by the oocyte machinery and inserted in the plasma
membrane where they form high-affinity -Bgt binding sites. For some
unknown reasons, however, these proteins lack functionality. Second,
coinjection of 9 and 10 yielded functional nAChRs and robust
currents could be recorded without displaying a significant difference
in -bgt labeling than oocytes injected with 9 alone. These data
illustrate that failure of 9-subunit to produce functional receptors
must be attributed to the assembly and formation of an activatable receptor but not to the transport and insertion of 9 in the
membrane. To challenge this hypothesis further we have compared the
pharmacological profile of 9-expressing oocytes versus sibling cells
injected with the 9-10-mixture. Experiments carried out with
antagonists such as -bgt or d-tubocurarine revealed that
addition of 10 significantly modified the 9 pharmacological
profile. Because it is known that the ligand binding site resides at
the interface between the - and the adjacent subunit (Corringer et
al., 1998; Sine et al., 1998), this result indicates that the
10-subunit must contribute to the formation of the agonist binding site.
The 9- and 10-subunits are clearly structurally related and
display important differences with the other known nAChR -subunits. The discovery that both subunits needed to be associated to form a
functional receptor contrasts with the supposed homomeric assembly of
9. The only other example of functional heteromeric nAChR resulting
from assembly of -subunits is the 7-8 found in chick retina
(Gotti et al., 1994), although in this case both subunits are able to
form a functional homomeric receptor. We thus sought to understand the
structural features behind the impossibility for 10 to form a
functional homomeric receptor and the poor functional expression of
9 alone by studying an 9:10-chimera in which the extracellular
domain of the 9-subunit was maintained, whereas all the rest of the
protein was substituted by the 10-sequence. The very large
acetylcholine-evoked currents recorded in oocytes injected with this
9:10-chimera alone indicate that exchange of the 10 N-terminal
domain was enough to restore its functionality. This finding can be
interpreted either by the lack of homomerization of the unmodified
10-subunit or its incapacity to form a functional acetylcholine-binding site. In addition, these data illustrate that the
ionic pore and gating properties are maintained in the 10-subunit.
The exchange of functional domain implies, as demonstrated with the
serotoninergic receptor (Eiselé et al., 1993), that
ligand-binding properties belong to the protein constituting the
N-terminal domain, whereas the ionic pore characteristics are defined
by the fusing protein segment. In agreement with this prediction, the
difference between 9 and 10 for the competitive antagonist
-bgt was conserved in the chimera as similar to that of 9,
whereas the blockade by d-TC was closer to that of
10-containing receptors suggesting again the heteromeric nature of
9-10-receptors.
This 9-10-receptor is a peculiar nicotinic receptor, both in
terms of structure and functional property. One of the main issue is
the functional significance of this novel nAChR. Efferent modulation of
the cochlea OHCs is mediated by acetylcholine through a nicotinic
receptor that exhibits a pharmacological profile resembling that
described for 9- and 9-10-receptors (Guth and Norris, 1996).
Activation of this nAChR causes a transient influx of calcium that in
turn activates hyperpolarizing calcium-dependent potassium channels
(Blanchet et al., 1996). The pharmacology of 9-subunit reconstituted in oocytes (Elgoyhen et al., 1994) corresponds to that of
native receptors expressed by vertebrate hair cells. Moreover, 9-null mice were shown to exhibit an absence of suppression of cochlear responses during efferent fiber activation (Vetter et al.,
1999), thus demonstrating the role of 9-containing nAChR in the
modulation of the cochlear response. The poor functional response of
homomeric 9-receptor in oocyte suggests that additional subunit(s)
might be required to obtain the calcium influx required to produce the
activation of the calcium-dependent potassium conductance observed in
vitro. Correctly processed 10-mRNA was found in the cochlea and we
showed that the presence of 10-subunit together with 9 not only
dramatically increased ACh-evoked currents but also preserved the
receptor pharmacology similar to that observed in OHCs. In addition,
affinity of -bgt reported for isolated guinea pig OHCs
(Kd = 62 nM; Lawoko et al., 1995) further
illustrates a closer match to 9-10 than 9 alone. This evidence
supports the hypothesis that the 10-subunit must be contained in
functional receptor complexes expressed by these sensory cells.
The coexpression of both subunits in the same region of the pituitary
gland, the pars tuberalis, suggests another role for 9-10-receptor. This region is in rat and in other mammals a major
neuroendocrine target for melatonin, which regulates photoperiodical changes in prolactin secretion. Activation of pars tuberalis-specific cells is thought to trigger the release of a yet uncharacterized peptide, "tuberalin," which would in turn provoke the liberation of
prolactin hormone from the pars distalis region (Morgan, 2000). Nicotinic receptors have been shown to modulate hormonal secretion in
pituitary and adrenal gland (Gu et al., 1996; Matta et al., 1998).
9-10-receptors could thus be involved in the control of a
specific pars tuberalis endocrine system.
Recently, studies have suggested a role for 9-containing nAChRs in
regulating keratinocyte adhesion (Grando, 1997). In particular, Nguyen
et al. (2000) have shown that anti-9 antibodies were present in the
serum of patients affected by the autoimmune disease Pemphigus vulgaris and that the acantholysis resulting from this disease could be linked to a block of 9-containing receptors. Interestingly, this antibody effect could be reversed by the addition of carbachol, a
cholinergic agonist that we have demonstrated to be active on 9-10-receptors. We have shown that 10-subunit is also
expressed in these cells and therefore that 9-10-receptors are
probably the functional nAChRs involved in the modulation of
keratinocyte adhesion. The cholinergic pathway involved in this process
is still unknown but the distinctive pharmacological profile of
9-10-receptor suggests that specific agonists could have a
therapeutic effect on such skin diseases.
The conclusion that 10-subunit is probably associated in vivo with
9 to form a novel subtype of nicotinic receptor involved in
different physiological systems further illustrates the complexity of
this receptor family. In a very recent publication, Elgoyhen et al.
(2001) have reported the cloning and characterization of the rat
10-subunit. Similarly to the human 10, the rat 10 can assemble
with 9 to form functional receptors and is expressed in cochlear
hair cells. Whether 10 might be involved in the composition of other
atypical nAChRs remains to be determined.
We thank Danielle Gaudeau and Monique Vasseur for excellent
technical assistance, Sandrine Poea for scientific discussion and Guy
Rebillard (INSERM U254, Montpellier) for the gift of RT reactions from
rat cochlea. UB/OC-2 immortalized cochlear cells were kindly provided
by Dr. M. Holley (Dept. of Physiology, University of Bristol, UK).
This work was supported in part by a Swiss National Science
Foundation grant (to D.B.).
Frédéric Sgard,
Department of Molecular and Functional Genomics,
Sanofi-Synthélabo, 10 Rue des Carrières 92500 Rueil-Malmaison, France. E-mail:
frederic.sgard{at}sanofi-synthelabo.com
nAChR, nicotinic acetylcholine receptor;
EST, expressed sequence tag;
OHC, outer hair cells;
ORF, open reading frame;
bp, base pair(s);
PCR, polymerase chain reaction;
RACE, rapid
amplification of cDNA ends;
RT, reverse transcription;
ACh, acetylcholine;
-bgt, -bungarotoxin;
BAPTA-AM, 1,2-bis(2-aminophenoxy)ethane-N',N,N',N'-tetraacetic
acid-acetoxymethyl ester.
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
10, That Confers
Functionality to the 
Top
Abstract
Introduction
