The Pediatric Center for Neuroscience, Children's Hospital of
Pittsburgh, Pittsburgh, Pennsylvania (C.Y., Y.L., K.D.N., J.W., R.M.R.,
N.F.S.); and Department of Pharmacology and Therapeutics, McGill
University Cancer Center, Montreal, Quebec, Canada (H.U.S.)
Growth factors, including nerve growth factor (NGF), have been
hypothesized to play a role in resistance to chemotherapeutic agent-induced apoptosis. Induction by NGF of resistance to apoptosis is
primarily thought to be the result of its binding to its high-affinity receptor, TrkA. The low-affinity NGF receptor, p75, has long been thought merely to facilitate NGF binding to TrkA. However, we have
previously shown that the binding of NGF to its low-affinity receptor,
p75, protects neuroblastoma cells that do not express TrkA against
apoptosis induced by enediyne chemotherapeutic agents. In cells that
express both receptors, it is not clear what determines which receptor
is responsible for the protective effect of NGF. We now show that, in
enediyne-treated SH-SY5Y neuroblastoma transfectants with native levels
of p75 and a low TrkA/p75 ratio (1/100), the anti-apoptotic effect of
NGF requires binding to p75. In contrast, in transfectants with native
levels of p75 and a high TrkA/p75 ratio (100/100), NGF treatment
prevents enediyne-induced apoptosis by a mechanism independent of p75
binding. Treatment of low TrkA/p75 ratio cells with NGF results in
activation and nuclear translocation of NF-
B and tyrosine
phosphorylation of TrkA. Analogous treatment of high TrkA/p75 ratio
cells results only in phosphorylation of TrkA even though nuclear
factor (NF)-B signaling is not inactive and can be initiated by
other ligands. The ratio of TrkA/p75 in cells that express both
receptors probably contributes to the determination of which of the two
known roles of p75 (i.e., TrkA independent or TrkA facilitatory) are
responsible for NGF-mediated protection from enediyne-induced apoptosis.
 |
Introduction |
Several
growth factors have recently been found to increase chemotherapeutic
resistance of cancer cells (Koutsilieris et al., 1999
; Schor, 1999;
Sola et al., 1999; Bunn et al., 2000; Powis et al., 2000; Sezer et al.,
2001). In the case of tumors of the nervous system, nerve growth factor
(NGF), among other neurotrophins, has been implicated in resistance to
apoptosis induction (Cortazzo and Schor, 1996; Schor, 1999; Schor and
Saragovi, 1999).
The biological activities of NGF result from its binding to one
or both of its receptors termed TrkA and p75, respectively. This
binding in turn triggers a cascade of cellular signaling events, the
precise nature of which is still the subject of considerable investigation and controversy (Bono et al., 1999). TrkA, the
high-affinity NGF receptor, is a tyrosine kinase the
autophosphorylation of which results in initiation of the
mitogen-activated protein kinase (Ulrich et al., 1998),
inositol-1,4,5-triphosphate, adapter protein Shc, fibroblast
growth factor receptor substrate 2, and other pathways (van der Geer et
al., 1996; Meakin et al., 1999). TrkA is primarily but not exclusively
expressed on cells of neural lineage. In contrast, the signaling
mechanism related to the binding of NGF to its low-affinity receptor,
p75, has only recently begun to be defined. The p75 receptor has
variously been found to induce apoptosis when not bound to NGF
(Rabizadeh et al., 1993; Huang et al., 2000), induce (Kuner and Hertel,
1998; Sedel et al., 1999) or prevent (Rabizadeh et al., 1993; Cortazzo
et al., 1996) apoptosis when bound to NGF, and mediate neurotrophin
dependence and alter neurotrophin affinity of other neurotrophin
receptors when coexpressed with them (Bredesen et al., 1998; Ross et
al., 1998). Signaling of NGF through p75 alone is thought to involve
the NF-B/ceramide pathway (Carter et al., 1996; Dobrowsky and
Carter, 1998; Brann et al., 1999; Coulson et al., 1999).
It is easy to envision the role of p75 as an independent signal
transducer in cells that express only this receptor and not any of the
Trk family tyrosine kinase receptors (Cortazzo et al., 1996).
Similarly, it is not surprising that the magnitude and duration of NGF
signaling through TrkA is dependent on how many p75 receptors
participate in the enhancement of TrkA affinity for NGF (Chao et al.,
1998; Twiss et al., 1998). This is especially so because, in addition
to enhancing TrkA-NGF affinity, p75 is also a functional regulator of
TrkA trophic activity (Maliartchouk and Saragovi, 1997; Saragovi et
al., 1998). What is unexpected and novel is the p75-mediated protective
effect of NGF against enediyne chemotherapeutic agent-induced apoptosis
in NGF-independent cells (Cortazzo et al., 1996). This is in sharp
distinction to the proapoptotic effects of p75 alone in NGF-dependent
cells deprived of NGF (Bredesen et al., 1998) and of NGF through p75 in
developing motoneurons in the rat embryonic spinal cord (Sedel et al.,
1999). We now demonstrate that the ratio of TrkA/p75 in the cell
membrane is one determinant of the relative importance of the two
alternative signaling pathways triggered by NGF for its negative effect
on enediyne-induced apoptosis.
| |
Materials and Methods |
Cells.
SY5Y-TrkA (high TrkA/p75) and SY5Y-ET (low
TrkA/p75) cells were the kind gift of Dr. Alonzo Ross (University of
Massachusetts Medical Center, Worcester, MA). These cells were
generated by transfection by electroporation of the TrkA expression
vector, pIRVCMV-TrkA, or the corresponding vector lacking the
trkA insert, respectively, into SH-SY5Y cells. Unlike
SY5Y-ET cells, SY5Y-TrkA cells overexpress TrkA. Like native TrkA, the
overexpressed product is phosphorylated upon NGF treatment and mediates
NGF-induced neurite outgrowth in SY5Y-TrkA cells (Poluha et al., 1995).
All cells used in these studies were demonstrated to be mycoplasma-free using a MycoTect Kit (Invitrogen, Carlsbad, CA). SY5Y-TrkA and SY5Y-ET cells were cultured in RPMI 1640 medium supplemented with 1%
(v/v) glutamine (200 mM), 10% fetal bovine serum, and 0.4% (v/v) G418
(5 mg/ml) as the selection antibiotic for these transfectants.
Chemicals and Reagents.
Neocarzinostatin (NCS), an enediyne
antineoplastic agent previously demonstrated to induce apoptosis in
SH-SY5Y neuroblastoma cells in culture (Hartsell et al., 1995, 1996),
was obtained from Kayaku Pharmaceuticals Ltd. (Tokyo, Japan). NCS was
stored in powder form at 
20°C; a 47 µM (0.5 mg/ml) working stock
solution in 0.015 M sodium acetate buffer, pH 5.0, was stored in the
dark at 4°C for up to 2 weeks and diluted with medium immediately
before each experiment. NGF was obtained from Roche Applied Science
(Indianapolis, IN).
Preparation and characterization of the monoclonal antibody
mAbNGF30 were described in our previous publication (Saragovi et al.,
1998). This antibody binds to the p75 binding site of NGF, blocking the
binding of NGF to p75. Monoclonal antibody 5C3, a TrkA-specific NGF
agonist, was prepared as described previously (LeSauteur et al., 1996).
Mouse monoclonal anti-TrkA IgG (Ab-1) was obtained from Calbiochem.
Rabbit polyclonal anti-p65 IgG, mouse monoclonal anti-phospho-TrkA IgG
(E-6) and rabbit anti-mouse IgG-HRP were obtained from Santa Cruz
Biotechnology (Santa Cruz, CA). Cy3-conjugated AffiniPure Goat
Anti-rabbit IgG(H+L) and Cy2-conjugated AffiniPure Rabbit Anti-mouse
IgG(H+L) were obtained from Jackson ImmunoResearch Laboratories, Inc.
(West Grove, PA) and used for fluorescent immunostaining of cells.
Geneticin Solution (antibiotic G418), 7-amino-actinomycin D (7-AAD),
and saponin were purchased from Sigma Chemical Corporation (St. Louis, MO).
Flow Cytometric Analysis.
Apoptotic cells were quantified by
flow cytometry considering 7-AAD staining intensity to be proportional
to the DNA content (Lecoeur and Gougeon, 1996). In short, after
harvesting, the cells were washed once in PBS and once in PBS/0.05%
saponin, followed by addition of 4 µg of 7-AAD in 1 ml of PBS/saponin
to the samples. The cells were incubated at room temperature in the
dark for 30 min, and DNA histograms were obtained using a CellQuest
apparatus and CellQuest software (BD Biosciences, San Jose, CA).
Data on 104 cells were collected. Electronic
gates were set for viable and apoptotic cells with 2N to 4N DNA and
subnormal DNA content, respectively, and for exclusion of debris.
Percentage of apoptosis was calculated as (number of apoptotic cells /
number of total cells) × 100.
Effects of Blocking p75 Binding of NGF on Its Antiapoptotic
Activity in SY5Y-ET and SY5Y-TrkA Cells.
Sister cultures of
SY5Y-ET cells and SY5Y-TrkA cells were treated with a preincubated (15 min) mixture of mAbNGF30 and NGF ([mAbNGF30]:[NGF] = 2:1; final
[NGF] = 2 nM) from 24 h before through the completion of the
experiment. Twenty-four hours after the addition of the NGF mixture,
the cells were treated for 1 h with NCS at two different
concentrations (3 and 10 nM). Control conditions for this experiment
included cells treated with NGF alone, mAbNGF30 alone, NCS alone, NGF
followed by NCS, NGF with mAbNGF30, and mAbNGF30 followed by NCS.
Adherent cells were counted as described previously (Hartsell et al.,
1995, 1996; Cortazzo et al., 1996), and flow cytometric and
fluorescence microscopic assessments of percent apoptosis were
performed as described above.
Effect of NGF on NF-B Activation in SY5Y-ET and SY5Y-TrkA
Cells.
Cells were treated for 2 h with NGF (2 nM) or an
equivalent volume of vehicle. Nuclear extracts were made from these
cells as follows: treated cells were washed twice with ice-cold PBS and
harvested by scraping into fresh PBS. Harvested cells were washed again
with ice-cold PBS, then with 10 mM Tris buffer, pH 7.5, containing 1.5 mM MgCl2, 10 mM KCl, 0.5 mM dithiothreitol, 0.5 mM PMSF, and 0.1 mM Na3VO4,
and then suspended in the same buffer made 0.1% in Triton X-100. Cells
were vortexed gently on ice, incubated on ice for 10 min, and then
centrifuged at 7000 rpm for 5 min at 4°C. The pellet was suspended
once again in 20 mM Tris buffer, pH 7.5, containing 1.5 mM
MgCl2, 420 mM NaCl, 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM dithiothreitol, 0.1 mM
Na3VO4, 0.1% Triton X-100,
and 25% glycerol, and incubated on ice for 20 min. The mixture was
centrifuged at 14,500 rpm for 15 min at 4°C, and the pellet was
discarded. The supernatant (nuclear extract) was diluted with three
volumes of 20 mM Tris buffer, pH 7.5, containing 1.5 mM
MgCl2, 25 mM KCl, 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM dithiothreitol, 0.1 mM
Na3VO4, and 20% glycerol.
Nuclear extracts were aliquoted (20 µl/vial) and frozen until analysis.
Gel Shift Assays.
For gel shift analysis, the
32P-labeled double-stranded NF-B consensus
oligonucleotides [sense, 5'GGGGAGTTGAGGGGACTT-TCCCAGGC3'; antisense,
5'GGGGGCCTGGGAAAGTCCCCTCAACT3' (DNA Synthesis Facility, University
of Pittsburgh)] were annealed to the nuclear extracts by PCR
thermocycling (85°C, 2 min; 65°C, 15 min; 37°C, 15 min; 22°C,
15 min; 0°C, 15 min). For supershifts, a subsequent incubation was
performed with antibodies to the p65 or p50 components of NF-B
(Santa Cruz Biotechnology, Inc.). Samples were run (2.5 µg of
protein/lane) on a 4% polyacrylamide gel. The gel was dried and
subsequently exposed to X-ray film overnight (4°C) for
autoradiographic analysis.
Effects of NGF on Phosphorylation of IB-
.
SY5Y-ET and
SY5Y-TrkA cells were treated with NGF (2 nM) for 0 to 6 h. Cells
were rinsed with fresh medium and harvested with trypsin. After washing
twice, cells were suspended in radioimmunoprecipitation assay buffer
containing PMSF, aprotinin, and
Na3VO4 and was then homogenized. Homogenates were run on a 10% polyacrylamide gel (500 µg protein/lane) and transferred to a Trans-Blot Pure Nitrocellulose Membrane (0.45 µm; Bio-Rad) using a Bio-Rad Trans-Blot apparatus. Staining was performed using antibodies to IB-,
phospho-IB-, and 
-actin at 20°C for 2 h, then washed,
and incubated with horseradish peroxidase-conjugated secondary
antibodies for 1 h. Staining with nonimmune serum in place of
primary antibody served as a negative control in these studies. The
membrane was finally washed and developed with Western Blotting
Chemiluminescence Luminol Reagent (Santa Cruz Biotechnology) following
the manufacturer's instructions. Optical scanning of the membranes was
performed using a Optiscan optical scanner (Bio-Rad, Hercules, CA).
Western Blot and Immunohistochemical Demonstration of
Phosphorylation of TrkA and Translocation of p65 in SY5Y-ET and
SY5Y-TrkA Cells.
At the indicated time points after incubation
with 40 nM NGF, SY5Y-ET, and SY5Y-TrkA cells were lysed in
radioimmunoprecipitation assay buffer (10 mM Tris, pH 8, 150 mM NaCl,
0.1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM PMSF, 4 µg/ml aprotinin, and 1 mM sodium orthovanadate). Subsequently the
protein concentrations of the lysates were estimated using the Bio-Rad
protein assay (Bio-Rad) with bovine serum albumin as a standard. An
aliquot of each lysate containing 150 µg of protein was loaded onto
each lane and electrophoresed on a 15% SDS-polyacrylamide gel,
followed by blotting on a nitrocellulose membrane (Bio-Rad). After
blotting, nonspecific binding was blocked with 5% nonfat dry milk in
PBS and the membrane was incubated with either anti-TrkA or
anti-phospho-TrkA antibodies (primary antibody) diluted in 5% nonfat
dry milk in PBS at 20°C for 2 h. The blot was then developed
with Western Blotting Chemiluminescence Luminol Reagent (Santa Cruz
Biotechnology), as described above for IB- blots. For SY5Y-TrkA
cell lysates, the blot was developed for 1 min. For SY5Y-ET cell
lysates, known to contain 100-fold less TrkA than SY5Y-TrkA cell
lysates (Poluha et al., 1995), the blot was developed for 10 min. In
all cases, the same blot was stained for TrkA, stripped using standard
methods, and restained for phospho-TrkA using the same development time as for TrkA.
For immunohistochemical staining, SY5Y-TrkA and SY5Y-ET cells
were grown on glass coverslips in six-well tissue culture plates. The
cells were incubated with NGF and/or NCS, washed three times with PBS,
fixed in 95% ethanol for 20 min, and washed three more times with PBS.
The cells were then permeabilized by incubation in 2% Triton X-100 for
30 min followed by three PBS washes. After blocking of nonspecific
staining (0.5% bovine serum albumin + 2% horse serum in PBS; 10 min),
the cells were incubated for 2 h at 37°C with the appropriate
primary antibody (anti-p65, anti-TrkA, or anti-p-TrkA) and
then with a 1:100 dilution of goat anti-rabbit Cy3 immunoconjugate or
rabbit anti-mouse Cy2 immunoconjugate followed by three additional
washes (10 min each) with PBS. Coverslips were removed from the wells
and mounted with Gelvatol [15.3% (w/v) polyvinyl alcohol, 33% (v/v)
glycerol] onto glass microscope slides. A Zeiss light microscope
equipped for epifluorescent illumination was used for examining these
preparations. Nonspecific immunostaining (negative control) was
assessed by subjecting sister cultures to this same procedure minus
treatment with the primary antibody.
Statistical Methods.
For studies involving the
comparison of multiple samples, statistical significance was assessed
by one-way ANOVA followed by Fisher's protected least significant
difference test (PLSD). For studies involving the comparison of paired
samples, statistical significance was assessed by Student's (paired)
t test. In all cases, p < 0.05 was
considered to be indicative of statistical significance.
| |
Results |
The use of trkA (SY5Y-TrkA) and mock (SY5Y-ET)
transfectants, respectively, of SH-SY5Y human neuroblastoma cells
(Poluha et al., 1995) allowed us to examine the effects of manipulation
of the TrkA/p75 ratio without alteration of the absolute amount of p75
on the cell surface. SY5Y-ET cells express TrkA and p75 at native
levels. SY5Y-TrkA cells express native levels of p75, and TrkA in
100-fold excess over native levels. The TrkA/p75 ratio of these cells
is 100/100, whereas that of native SH-SY5Y cells and SY5Y-ET cells is
1/100. The p75 content of both transfectants is equivalent (Poluha et
al., 1995).
NCS Induces Apoptosis in Both SY5Y-ET and SY5Y-TrkA Cells.
Previous studies (Hartsell et al., 1995; Hartsell et al., 1996) have
demonstrated that NCS induces apoptosis in the parent cell line,
SH-SY5Y. Similarly, 48 to 72 h after a 1-h exposure to NCS, both
SY5Y-ET and SY5Y-TrkA cells are seen by light microscopy to shrink,
round-up, and detach from the culture surface in a time- and NCS
concentration-dependent manner (data not shown). Cells of both
transfectants also demonstrate apoptotic changes in nuclear
configuration seen after fluorescent staining (Fig. 1, A-D).
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
Nuclear fluorescent staining of SY5Y-ET (A, B) and
SY5Y-TrkA (C, D) stained with acridine orange and ethidium bromide to
demonstrate apoptosis induced by NCS treatment. Nonadherent cells were
collected, stained, and photographed on day 3 after a 1-h NCS
treatment. A and C, [NCS], 3 nM; B and D, [NCS], 10 nM. Apoptotic
cells are distinguished by condensed (white arrows) and fragmented
(green arrowheads) chromatin. (magnification, 1000×) E, NCS (0, 1, 3, 5, 10, and 20 nM; 1 h) increases cell death in a dose-dependent
manner in both SY5Y-ET and SY5Y-TrkA cells. Both transfectants were
treated with NCS. Pooled adherent and nonadherent cells were harvested,
stained with 7-AAD, and analyzed by flow cytometry. Electronic gates
were set for viable and apoptotic cells with 2N to 4N DNA and subnormal
DNA content, respectively. Percent apoptosis observed in a simultaneous
vehicle-treated sister culture was subtracted from the respective value
obtained in the presence of NCS. Shown is the cumulative result of five
experiments. Error bars on this and all subsequent bar graphs represent
the S.D. *, p < 0.05; **,
p < 0.01; ***, p < 0.001 compared with vehicle-treated cells [one-way ANOVA followed by
Fisher's PLSD test]. Inset, representative histogram (SY5Y-ET
cells).
|
|
To quantify cell number after NCS treatment (0-20 nM), cell counts of
adherent cells were performed for SY5Y-ET and SY5Y-TrkA transfectants
over an experimental period of 7 days after 1 h of NCS treatment.
The effects of NCS on adherent cell number were concentration-dependent
and became apparent on day 3 in both transfectants. NCS was equipotent
for diminution of adherent cell number in the two transfectants
(n = 6; data not shown).
In addition, we also examined the apoptotic response of SY5Y-ET and
SY5Y-TrkA cells to NCS treatment (performed for 1 h on day 0) with
7-AAD staining and flow cytometric analysis on day 3. As demonstrated
in Fig. 1E, a concentration-dependent increase in the apoptotic
fraction, detected as cells with sub-2N DNA content, was found after
NCS treatment. The within-experiment concentration dependence was
robust despite some between-experiment variability of the absolute
incidence of apoptosis at a given NCS concentration. Flow cytometric
analysis also demonstrates the equipotency of NCS for the two transfectants.
Protective Effects of NGF on NCS-Treated SY5Y-ET and SY5Y-TrkA
Cells.
To determine whether NGF can induce resistance of SY5Y-ET
and SY5Y-TrkA cells to NCS-induced apoptosis, flow cytometric analysis was performed in the presence of NGF (2 nM) from 24 h before NCS (3 or 10 nM) treatment through the duration of the experiment. As shown
in Fig. 2, incubation with NGF protected
both SY5Y-ET and SY5Y-TrkA cells from NCS-induced apoptosis.
View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
Protective effects of NGF (2 nM) on NCS (3 nM, 10 nM;
1 h) -induced apoptosis in SY5Y-ET (A, C) and SY5Y-TrkA (B, D)
cells. Sister cultures were pretreated with NGF for 24 h, then
exposed to NCS for 1 h in the presence of NGF. NGF was maintained
in the culture medium throughout the duration of the experiment. On day
3 after NCS treatment, the cells were harvested, stained with 7-AAD,
and analyzed by flow cytometry. Percentage of apoptosis observed in a
simultaneous vehicle-treated control was subtracted from the respective
NCS- or NCS+NGF-treated sister culture. Each line represents one
independent trial (paired NCS- and NCS+NGF-treated samples) of four
performed.
|
|
MC192, a p75-Specific NGF Ligand, Protects Low TrkA/p75 (SY5Y-ET)
but not High TrkA/p75 (SY5Y-TrkA) Cells from NCS-Induced
Apoptosis.
Previous work has demonstrated the specificity of MC192
for p75 (Chandler et al., 1984; Barker and Shooter, 1994). MC192 has been shown to synergistically enhance the activity of the TrkA-specific ligand, 5C3, in much the same way as NGF binding to p75 enhances NGF
signaling through TrkA (Maliartchouk and Saragovi, 1997). We have
therefore used MC192 to determine the effects of ligand binding of p75
alone in SY5Y-ET and SY5Y-TrkA cells.
Fluorescent nuclear staining suggested that MC192 decreased the
incidence of condensed nuclei in NCS-treated SY5Y-ET cells, although it
did not alter the incidence of condensed nuclei in NCS-treated
SY5Y-TrkA cells (data not shown). Similarly, whereas MC192 increased
the EC50 (as defined in Schor et al., 2000) for decrease in adherent cell number after NCS treatment of SY5Y-ET cells
from 5 to 20 nM, it had no effect on the EC50 of
SY5Y-TrkA cells (Fig. 3A). Consistent
with the cell counting results, flow cytometric analysis showed a
differential effect of MC192 upon SY5Y-ET and SY5Y-TrkA cells (Fig.
3B). MC192 protects SY5Y-ET cells, but not SY5Y-TrkA cells, from
apoptosis induction by NCS.
View larger version (36K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of MC192 on NCS-induced SY5Y transfectant
cell death. A, both SY5Y-ET and SY5Y-TrkA cells were pretreated with 1 nM MC192 for 24 h, then exposed to NCS (1, 3, 5, 10, and 20 nM)
for 1 h in the presence of MC192. Where indicated, MC192 was
maintained in the culture medium throughout the duration of the
experiment. Cell counts are performed at 2 d after NCS treatment.
*, p < 0.05; ***, p < 0.001 (one-way ANOVA followed by PLSD) compared with corresponding
group without MC192. B, both transfectants were treated as described in
A. Flow cytometry was performed on day 3 after NCS treatment as
described for Fig. 2. Percentage of apoptosis observed in a
simultaneous vehicle-treated control was subtracted from the respective
value obtained in the NCS- or NCS+MC192-treated sister culture. **,
p < 0.05 compared with NCS treatment alone
(Student's t test)
|
|
mAbNGF30, an Anti-NGF Antibody That Renders Inactive the p75
Binding Site of NGF, Protects High TrkA/p75 (SY5Y-TrkA) but Not Low
TrkA/p75 (SY5Y-ET) Cells from NCS-Induced Apoptosis.
We have
previously documented the protection of SH-SY5Y cells, the parent cells
of both transfectants, from the effects of NCS on cell number by NGF
binding to p75 under circumstances when NGF binding to TrkA was blocked
by an engineered, TrkA-specific mutant NGF (Cortazzo et al., 1996). We
have now used the monoclonal antibody mAbNGF30 to block the p75 binding
site of NGF, thereby converting NGF into a ligand that binds to TrkA
but not to p75 (Saragovi et al., 1998). We have tested the effect of
this NGF-NGF30 complex on NCS-treated SY5Y-ET and SY5Y-TrkA cells. As
is shown in Fig. 4, the NGF-NGF30 complex
does not protect SY5Y-ET cells from the effects of NCS. In contrast,
NGF-NGF30 does protect SY5Y-TrkA cells in the same system. Control
treatment of either transfectant with mAbNGF30, NGF, or NGF-NGF30 alone
(i.e., without NCS) had no effect on apoptosis prevalence, and mAbNGF30
did not alter the increased prevalence of apoptosis seen after NCS
treatment (data not shown). This further suggests that the role of p75
is different in these two cell lines, despite the fact that both lines
express the same amount of p75.
View larger version (37K):
[in this window]
[in a new window]
|
Fig. 4.
Effects of blocking p75 binding of NGF on its
anti-apoptotic activity in SY5Y-ET and SY5Y-TrkA cells. Sister cultures
of SY5Y-ET and SY5Y-TrkA cells were treated with all possible
combinations of vehicle, NCS (3 and 10 nM, 1 h, 37°C), NGF
(final concentration, 2 nM) present from 24 h before NCS addition
through the termination of the experiment, and mAbNGF30 (final
concentration, 4 nM), as we have described previously for other
antibodies (Cortazzo et al., 1996). Flow cytometry was performed as
described for Fig. 2. NGF alone, mAbNGF30 alone, and NGF + mAbNGF30 had
no effect on flow cytometric profiles. Similarly, mAbNGF30 alone had no
effect on change in flow cytometric profile induced by NCS (data not
shown). For both transfectants, NCS+NGF treatment values differ
significantly from NCS alone values [*, p < 0.05; **, p < 0.01 (one-way ANOVA followed by
PLSD)]. For SY5Y-ET cells, NGF+NCS+Ab treatment values differ
significantly from NCS+NGF treatment values (##, p < 0.01; ###, p < 0.001), but not from NCS alone
values (p > 0.05). For SY5Y-TrkA cells, NGF+NCS+Ab
treatment values do not differ significantly from NCS+NGF treatment
values (p > 0.05).
|
|
NF-B Activation Accompanies NGF-Mediated Protection of SY5Y-ET,
but Not SY5Y-TrkA Cells from the Effects of NCS.
The NF-B
pathway has been proposed to be involved in independent (i.e.,
non-TrkA-dependent) signaling of NGF through p75. We therefore
examined the activation of this pathway by NGF in SY5Y-ET and SY5Y-TrkA
cells. The difference in signaling by NGF between the two transfectants
was suggested by gel supershift studies of NF-B activation after
incubation of each transfectant with vehicle or NGF. Treatment of
SY5Y-ET cells with NGF (2 nM) for 2 h results in more intense
staining of the components of NF-B with a radiolabeled specific
oligonucleotide probe (Fig. 5). Both the
p65 and p50 components of NF-B seem to be represented in this
staining, as demonstrated by the displacement and altered staining
characteristics of each in turn in the lanes containing antibodies to
each of these components, respectively. On the other hand, similar
treatment of SY5Y-TrkA cells results in no significant change in the
intensity of staining of NF-B with this probe. Note that both cell
lines exhibit some baseline nuclear content of NF-B, as expected for
cells cultured in growth factor- (i.e., serum-) containing medium.
View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of NGF on NF-B activation in SY5Y-ET and
SY5Y-TrkA cells. Gel supershift assays were performed as detailed under
Materials and Methods using oligonucleotides that bind
specifically to NF-B. Nuclear preparations from all experimental
conditions in both transfectants were simultaneously run on a single
gel. Lanes 1 to 6, cells under native conditions; lanes 7 to 12: cells
treated for 2 h with NGF (2 nM). Results are shown from one
representative experiment of two performed. P, probe alone; 1, SY5Y-ET
nuclear prep. + probe; 2, SY5Y-ET nuclear prep. + anti-p50 antibody + probe; 3, SY5Y-ET nuclear prep. + anti-p65 antibody + probe; 4, SY5Y-TrkA nuclear prep. + probe; 5, SY5Y-TrkA nuclear prep. + anti-p50
antibody + probe; 6, SY5Y-TrkA nuclear prep. + anti-p65 antibody + probe; 7, (SY5Y-ET + NGF) nuclear prep. + probe; 8, (SY5Y-ET + NGF)
nuclear prep. + anti-p50 antibody + probe; 9, (SY5Y-ET + NGF) nuclear
prep. + anti-p65 antibody + probe; 10, (SY5Y-TrkA + NGF) nuclear prep. + probe; 11, (SY5Y-TrkA + NGF) nuclear prep. + anti-p50 antibody + probe; 12, (SY5Y-TrkA + NGF) nuclear prep. + anti-p65 antibody + probe.
The open arrows indicate the shifted position of p50 in lanes including
an antibody to this protein. The closed arrowheads indicate the
disappearance of the band for p65 in lanes including an antibody to
this protein. Binding of specific antibody to p65 has previously been
shown to alter binding to the oligonucleotide probe sufficiently to
diminish radiographic detection of this protein (Carter et al.,
1996).
|
|
Because of the difficulty quantifying gel supershift data and because
the NF-B signaling pathway involves phosphorylation of IB- and
p65 translocation, we confirmed these results by examining the phospho-
and total IB- contents (Fig. 6A)
and p65 translocation in SY5Y-ET (Fig. 6B) and SY5Y-TrkA (Fig. 6C) cells over time of exposure to NGF. As demonstrated in Fig. 6A, the
cellular content of phospho-IB- significantly increased over time
in SY5Y-ET cells, whereas the content of IB- remained constant.
Consistent with this result, translocation of p65 protein from the
cytoplasm to the nucleus was observed after NGF (2 nM) treatment of
SY5Y-ET cells (Fig. 6B). This phenomenon was also observed in the case
of treatment with NCS (1 h) in the presence of NGF (Fig. 6D). These
results imply that signaling through an independent p75 receptor and
the NF-B pathway could be an important mechanism by which NGF
protects SY5Y-ET cells from NCS-induced apoptosis. In sharp contrast,
neither phosphorylation of IB- nor translocation of p65 protein
changed significantly during incubation of SY5Y-TrkA cells with NGF
alone (Fig. 6, A and C) or NCS+NGF (Fig. 6E), implying that despite the
invariant content of p75 between these two transfected cell lines, in
the SY5Y-TrkA line, NGF does not signal through an independent,
NF-B-linked p75 receptor.
View larger version (49K):
[in this window]
[in a new window]
|
Fig. 6.
A, effects of NGF on phosphorylation of IB-.
Western blotting was performed to examine SY5Y-ET and SY5Y-TrkA cells
for phosphorylation of IB- after NGF exposure (2 nM; 0-6 h).
Blots were stripped and then stained for IB- and -actin as
IB- expression and loading controls, respectively. Plots of
optical density were generated using a Bio-Rad Optiscan optical scanner
and normalized to IB- expression. Intensity of the band for
-actin did not change significantly from lane to lane (data not
shown). Results are shown from one representative experiment of three
performed. B to E, expression and translocation of p65 protein after
NGF (2 nM) treatment in the absence (B and C) and presence (D and E) of
NCS were performed in SY5Y-ET cells (B and D) and SY5Y-TrkA cells (C
and E). Sister cultures of SY5Y-ET and SY5Y-TrkA cells grown on glass
coverslips were incubated for varying lengths of time with NGF (B and
C) or preincubated with NGF for 24 h followed by 1 h of NCS
(3 and 10 nM) treatment in the presence of NGF and another 24 h of
incubation with NGF alone (D and E). The cells were washed, fixed,
blocked, and stained with anti-p65 polyclonal antibody. Subsequent
washing, staining with a fluorescent secondary antibody, and microscopy
were performed as detailed under Materials and
Methods.
|
|
Independent Signaling through p75 in SY5Y-ET Cells Is Not the
Result of Lack of a Critical Threshold TrkA Content in These Cells;
TrkA Signaling Is Competent in SY5Y-ET Cells.
From the results we
describe above, it is not possible to distinguish between alteration of
TrkA/p75 ratio and expression of a critical threshold number of TrkA
receptors as the reason for differential signal transduction. It is
theoretically possible that signaling through the TrkA tyrosine
phosphorylation pathway requires a critical number of TrkA receptors
and that only independent p75-mediated signaling was important in
protection against apoptosis of SY5Y-ET cells because no TrkA-mediated
signaling of NGF occurred. We therefore examined NGF-induced TrkA
phosphorylation in SY5Y-ET and SY5Y-TrkA cells treated with NGF at a
concentration (40 nM) sufficient to saturate both TrkA and p75. In so
doing, we sought to test the hypothesis that, even with low TrkA
content, SY5Y-ET cells are capable of phosphorylating TrkA.
Fig. 7A confirms the differential
expression of TrkA in the two transfectants. Figures 7, B and C, and
8 show that even when p75 is saturated
with NGF and TrkA is present only at native levels, NGF-mediated TrkA
phosphorylation takes place in both transfectants, and that the
relatively low TrkA expression of SY5Y-ET cells does not preclude such
phosphorylation.
View larger version (47K):
[in this window]
[in a new window]
|
Fig. 7.
A, differential TrkA receptor protein expression in
SY5Y-ET and SY5Y-TrkA cells. Immunofluorescent staining for TrkA was
performed on the native transfectants. B and C, effects of NGF on
phosphorylation of TrkA are shown for SY5Y-ET (B) and SY5Y-TrkA (C)
cells. Sister cultures of SY5Y-ET and SY5Y-TrkA cells were incubated
for varying lengths of time with NGF (40 nM). Results for
t = 0 (control) are denoted as "Cont". The TrkA
and phospho-TrkA (p-TrkA) contents of lysates of these
cells were determined by Western blotting as described under
Materials and Methods. In the case of each transfectant,
the same blot was stained with an antibody to TrkA, stripped, and
subsequently stained with an antibody to p-TrkA. The
notation to the left of each blot indicates the running position of a
140 kD TrkA standard on the same gel. A representative set of results
for one experiment of four performed with SY5Y-TrkA cells and three
performed with SY5Y-ET cells is shown.
|
|
View larger version (53K):
[in this window]
[in a new window]
|
Fig. 8.
Immunofluorescent staining for phospho-TrkA in
SY5Y-ET and SY5Y-TrkA cells treated with NGF (40 nM). Sister cultures
of SY5Y-ET and SY5Y-TrkA cells grown on glass coverslips were incubated
for varying lengths of time with NGF and then stained with an antibody
to phospho-TrkA. Staining with a fluorescent secondary antibody and
subsequent microscopy were performed as detailed under Materials
and Methods. Panels labeled "0 min" were treated with
vehicle only and stained immediately thereafter.
|
|
Absence of Independent Signaling through p75 in SY5Y-TrkA Cells Is
Not the Result of Inability of NGF to Induce Activation of NF-B
through p75; p75 Signaling Is Competent in SY5Y-TrkA Cells.
NGF, a
ligand of both TrkA and p75, does not induce activation of NF-B in
SY5Y-TrkA cells. This could mean either that p75 does not function
independently when the TrkA/p75 ratio is 100/100 and both p75 and TrkA
are bound to NGF, or that p75 is incapable of independent signaling
under any circumstances in this transfectant. To distinguish between
these possibilities, we examined SY5Y-TrkA and SY5Y-ET cells for
activation of NF-B after treatment with MC192, a ligand that binds
to p75 but not to TrkA (Chandler et al., 1984; Barker and Shooter,
1994). As shown in Fig. 9, in both SY5Y-ET and SY5Y-TrkA cells, binding of MC192 by p75 results in a
time-dependent increase in cellular levels of phospho-IB-, whereas levels of actin and IB- remain constant. Binding of MC192
to p75 therefore activates NF-B in both transfectants. This is not
the case for NGF, which suggests that the inability of NGF to activate
NF-B in SY5Y-TrkA cells is related to its binding to both TrkA and
p75 and not to an innately incompetent pathway through p75 to NF-B
activation in these cells.
View larger version (16K):
[in this window]
[in a new window]
|
Fig. 9.
Effects of monoclonal antibody MC192 on
cellular content of phosphorylated IB-. Western blotting was
performed to examine SY5Y-ET and SY5Y-TrkA cells for phosphorylated
IB- after MC192 exposure (2 nM; 0-4 h). Plots of optical density
were generated using a Bio-Rad Optiscan optical scanner. Each blot was
stripped and stained for -actin and IB- as a loading control
and control for IB- expression, respectively. Results shown are
from one representative experiment of two performed.
|
|
In SY5Y-ET cells, p75 Enhances TrkA-Mediated Signaling of NGF,
Whereas in SY5Y-TrkA Cells, p75 Does Not Synergize with TrkA.
We
also tested the hypothesis that in SY5Y-TrkA cells, but not SY5Y-ET
cells, binding of NGF to p75 serves to enhance phosphorylation of TrkA
resulting from exposure to a single concentration of NGF. This was
suggested by our finding that the ratio of the optical densities of the
band for phospho-TrkA to that for TrkA peaks at 1.25-fold above control
levels after 30-min incubation with NGF in SY5Y-ET cells, whereas the
analogous ratio peaks at 3.75-fold of control levels after 5-min
incubation with NGF and remains close to this level for at least 2 h in SY5Y-TrkA cells (data not shown). This is consistent with
synergistic enhancement of TrkA activity by p75 in cells with a high
TrkA/p75 ratio, as has been seen previously in other cell systems
(Maliartchouk and Saragovi, 1997; Ross et al., 1998; Rabizadeh et al.,
1999).
In confirmation of this observation, the p75 ligand MC192 (2 nM) is
itself without effect on SY5Y-TrkA cells but affords synergistic enhancement of the antiapoptotic effect of the TrkA ligand 5C3 on these
cells. Conversely, 5C3 (5 nM) alone is without effect on SY5Y-ET cells,
and coincubation with 5C3 and MC192 does not alter the antiapoptotic
effect of MC192 on these cells (Fig.
10). These results underscore the
differential signaling capacity of NGF receptors in the two
transfectants, and demonstrate the different roles played by p75 in
SY5Y-TrkA and SY5Y-ET cells.
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 10.
The synergistic protective effects of 5C3 and
MC192 on NCS-induced cell death in SY5Y-TrkA but not SY5Y-ET cells.
Sister cultures were pretreated with 5C3 (5 nM) and/or MC192 (2 nM) for
24 h, then exposed to 10 nM NCS for 1 h in the presence of
5C3 and/or MC192. MC192 and 5C3 were left in the medium for the
duration of the experiment. Results are expressed as relative incidence
of apoptosis with apoptosis incidence in a simultaneous control sample
set at 1. This represents the fold-increase in apoptosis after
treatment relative to control conditions. *, p < 0.05; **, p < 0.01 compared with NCS alone;
#, p < 0.05 protective effect of both
ligands in coincubation compared with either ligand alone (one-way
ANOVA followed by PLSD)
|
|
| |
Discussion |
Neurotrophins have been implicated in positive and
negative modulation of the susceptibility of neural tumors to
chemotherapeutic agents (Cortazzo et al., 1996; Kim et al., 1999;
Schor, 1999). NGF, the first neurotrophin described, has been found to
variably induce or prevent apoptosis of normal and neoplastic neural
cells, depending upon the method by which apoptosis is induced and
which of the two known NGF receptors (p75 or TrkA) is involved in
mediating the response to NGF (Bredesen and Rabizadeh, 1997; Bredesen
et al., 1998).
In addition, previous studies have demonstrated the multiple roles of
the p75 receptor (Frade and Barde, 1998) and have suggested that its
predominant role varies from cell type to cell type (Cortazzo et al.,
1996). What determines the function of p75 in different cell types or
in the same cell at different times in its development remaines unclear
(Fundin et al., 1997). Several studies have indicated that p75 binding
to TrkA, TrkB, or TrkC enhances the affinity of the respective Trk for
its corresponding neurotrophin (Hempstead et al., 1991; Bredesen and
Rabizadeh, 1997; Ryden et al., 1997; Ross et al., 1998; Brennan et al.,
1999). Recently, it has been reported that a complex consisting of
TRAF6 and atypical protein kinase C-interacting protein (p62) could
serve as a bridge between p75 and TrkA signaling (Wooten et al., 2001).
This interaction is almost certainly initiated by the physical
proximity of the two receptors to one another (Huber and Chao, 1995;
Gargano et al., 1997; Bibel et al., 1999). Some authors have
hypothesized that the direct interaction of p75 with TrkA requires that
the TrkA/p75 ratio be no smaller than 1/10 (Verdi et al., 1994; Greene and Kaplan, 1995). However, most of the studies performed to test this
hypothesis compare the response to NGF of different cell lines that
undoubtedly differ in characteristics other than just the TrkA/p75
ratio. Furthermore, none of these studies approach the question of
what, if anything, p75 does in cells where a physical or functional
TrkA-p75 interaction is not apparent.
The present study demonstrates that NGF decreases NCS-induced apoptosis
in both SY5Y-ET and SY5Y-TrkA cells (Fig. 2). This neuroprotective
effect of NGF is mediated by p75 in SY5Y-ET cells and by TrkA in
SY5Y-TrkA cells. This conclusion is based on the following
observations. First, monoclonal antibody MC192, a p75-specific NGF
ligand, selectively protects SY5Y-ET cells, but not SY5Y-TrkA cells,
from NCS-induced apoptosis (Fig. 3). Second, mAbNGF30, which occupies
and inactivates the p75 binding site of NGF, selectively abolishes the
protective effects of NGF on NCS-treated SY5Y-ET cells but not
NCS-treated SY5Y-TrkA cells (Fig. 4). Third, although p75-NF-B
signaling is intact in both transfectants (Fig. 9), NGF induces such
signaling only in SY5Y-ET cells (Figs. 5 and 6, A, B, and D), and not
in SY5Y-TrkA cells (Figs. 5 and 6, A, C, and E). Thus, although the
absolute p75 content is the same in both transfectants, the role of p75
signaling in the neuroprotective effects of NGF differs between them.
The present studies are consistent with the study by Twiss et al.
(1998), who reported that not only the presence of p75 but also the
p75/TrkA ratio determines cellular responsiveness to NGF. Although
there is ample evidence that changes in ligand concentration or
availability that lead to alterations in receptor occupancy rate can
alter the predominant signal transduction pathway activated by that
ligand (Shimizu and Gurdon, 1999), no prior studies have shown directly
that heterologous receptor ratio determines signaling by a single
common ligand.
Many recent studies have demonstrated the existence of an independent
function of p75 (Carter et al., 1996; Cortazzo et al., 1996; Brann et
al., 1999; Coulson et al., 1999; Yamashita et al., 1999; Huang et al.,
2000). The exact independent function of p75 seems to depend on whether
NGF is bound to it (Rabizadeh et al., 1993; Huang et al., 2000). As a
"naked" receptor, p75 seems in some cells to function as a mediator
of apoptosis. In contrast, the binding of NGF to p75 prevents apoptosis
induction in these lines (Rabizadeh et al., 1993; Cortazzo et al.,
1996); p75 has therefore been said to induce "neurotrophin
dependence" in cells (Bredesen et al., 1998). A number of studies in
other cell types have demonstrated the apoptosis-inducing effect of NGF
binding to p75 (Kuner and Hertel, 1998; Sedel et al., 1999). The
present experiments differ from these studies in that we use an
antimitotic, DNA-cleaving agent in the presence of serum, rather than
serum deprivation or NGF exposure itself, to induce cell death.
Apoptosis in this model is not itself p75-dependent, as evidenced by
the absence of effect of NGF, MC192, or 5C3 alone (i.e., in the absence of NCS) on SY5Y-ET or SY5Y-TrkA cells. Binding of NGF to p75 protects these cells from apoptosis induced by the enediyne chemotherapeutic agent, NCS. This protection may be reflective of potential resistance to chemotherapy, and could therefore presage the existence of residual
tumor after treatment. Because these neoplastic cells are mitotically
active, even small numbers of chemoresistant cells could be
biologically and medically significant.
From the signal transduction standpoint, TrkA is the starting point for
a tyrosine kinase pathway that clearly mediates the differentiative and
trophic functions of NGF. Many of the intermediate steps in the pathway
from TrkA binding of NGF to the induction of neurite outgrowth have
been identified (Cordon-Cardo et al., 1991; Kaplan et al., 1991; Kremer
et al., 1991; Ohmichi et al., 1991; Saltiel and Ohmichi, 1993). More
recently, an antiapoptosis function and pathway for TrkA have been
described as well (Pincelli et al., 1997; Garcia Valenzuela and Sharma,
1998).
Other studies have suggested that NF-B activation is associated with
cell survival in some systems (Beg and Baltimore, 1996; Liu et al.,
1996; Van Antwerp et al., 1996; Wang et al., 1996). The signal
transduction pathways responsible for this association are only
recently being elucidated. NF-B is composed of two subunits (p65 and
p50) and exists in a complex with an inhibitory protein, termed IB,
in resting cells (Nagata, 1997). It has been suggested that
ligand-induced trimerization of tumor necrosis factor (TNF) results in
the recruitment of the death domain adaptor protein TRADD, which in
turn recruits and interacts with receptor interaction protein
(Ashkenazi and Dixit, 1998). Overexpression of receptor interaction
protein activates NF-B-inducing kinase, which in turn activates
IB kinase complex (IKK). Upon phosphorylation by IKK, IB becomes
ubiquitinated and degraded by proteosome complexes (Zandi et al.,
1997). Once free of this inhibitor, NF-B dimerizes and becomes an
active transcription factor that translocates to the nucleus and
activates transcription of NF-B-responsive genes (Ashkenazi and
Dixit, 1998). The low-affinity NGF receptor, p75, is a member of the
TNF receptor family, and there is evidence to support the notion that
activation and translocation of NF-B are steps in the signaling
cascade initiated by NGF binding to p75 (Carter et al., 1996).
In the present study, we demonstrated that NGF induces phosphorylation
of IB- in SY5Y-ET cells, but not in SY5Y-TrkA cells (Fig. 6A).
Furthermore, NGF induces the translocation of p65 from the cytoplasm to
the nucleus of SY5Y-ET, but not SY5Y-TrkA, cells (Fig. 6, B-E). These
findings, taken together with the effects of selective TrkA or p75
agonists in this system, support the notion that NGF protects against
NCS-induced apoptosis through the p75-NF-B signaling pathway in
SY5Y-ET cells, and through a TrkA tyrosine phosphorylation pathway in
SY5Y-TrkA cells.
These findings suggest that in cell lines and at stages of in
vivo development in which p75 is in overabundance relative to TrkA, p75
serves an independent function, whereas a TrkA/p75 ratio closer to
100/100 implies enhancement of the TrkA-mediated functions of NGF by
p75. Given the very wide tissue expression profile of p75 (Wheeler et
al., 1998; Guate et al., 1999; Lara et al., 2000), these relationships
are likely to have implications in both neural and non-neural tissues
and pathological states (Labouyrie et al., 1997; Brann et al., 1999;
Hamanoue et al., 1999; Hannila and Kawaja, 1999; Guate et al., 1999;
Lara et al., 2000; Sortino et al., 2000). Whether NGF receptors can
serve as a prototype for other homo- and heterodimeric receptors
remains to be seen, particularly with regard to the mechanism by which
receptor pairing is determined. Furthermore, additional studies will
determine the generalizability to other chemotherapeutic agents of the
effects of NGF on susceptibility to enediyne-induced apoptosis.
We thank Jennifer L. Petrus, Patricia Will, and Richard Adams
for technical assistance with several of the studies presented in this
article. In addition, Drs. Laura Lillien and Massimo Trucco offered
many helpful suggestions during the writing of the manuscript.
This work was funded by the National Institute of Neurological
Disease and Stroke and the National Cancer Institute (grants RO1-NS38569 and RO1-CA74289, respectively) of the National Institutes of Health and the Carol Ann Craumer Endowment Fund of Children's Hospital of Pittsburgh.
NGF, nerve growth factor;
NCS, neocarzinostatin;
7-AAD, 7-amino-actinomycin D;
PBS, phosphate-buffered
saline;
NF-B, nuclear factor-B;
PMSF, phenylmethylsulfonyl
fluoride;
ANOVA, analysis of variance;
PLSD, protected least
significant difference;
TNF, tumor necrosis factor.
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
1.
Biochem Biophys Res Commun
179:
217-223[CrossRef][Medline].
