Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

The interaction of extracellular matrix (ECM) with cells plays a key role in the regulation of cell adhesion, migration, and proliferation, as well as differentiation. The components and structure of ECM provide essential information for the induction of cellular physiological events. Fn is a heterodimeric ECM glycoprotein that has been shown to regulate various kinds of physiological events during embryogenesis, angiogenesis, thrombosis, inflammation, and wound healing (Hay, 1991). Assembly of soluble Fn into matrix is a multistep process under cellular control. Among the membrane components implicated in Fn matrix assembly, integrins have been firmly demonstrated to have a central role (Sakai et al., 1998). Integrins are receptor heterodimers with overlapping specificity toward ECM components (Hynes, 1992). Integrin-mediated cell-ECM interactions promote the assembly of cytoskeletal and signaling molecule complexes at sites called focal adhesions. Integrin-focal adhesion kinase signaling complexes have been implicated in the regulation of anchorage-dependent cell survival.

Continuous remodeling of bone through resorption and formation enables the skeleton to maintain strength. Small changes in modeling and remodeling activities by bone-forming osteoblasts and bone-resorbing osteoclasts can have significant functional consequences on skeletal integrity. Osteoblasts, the cells responsible for the formation of new bones, first differentiate from precursors adjacent to bone surfaces. The ECM produced by osteoblasts is complex and consists of several different classes of molecules that may regulate the modeling and remodeling of bone. The ECM contains structural components such as type I collagen and Fn, as well as proteases that degrade the matrix (Nordahl et al., 1995; Winnard et al., 1995; Robey, 1996). There is strong evidence to suggest a role for Fn in the early stages of osteogenesis. The distribution of Fn in areas of skeletogenesis suggests that it may be involved in early stages of bone formation (Moursi et al., 1996, 1997). The expression of Fn mRNA increases during the early stages of osteoblast differentiation and is reduced during cell maturation (Stein et al., 1990; Winnard et al., 1995; Moursi et al., 1997). Fn is synthesized and deposited in the areas of bone tissue at which recruitment and commitment of osteoblast precursors occur; therefore, Fn is highly localized to sites of early osteogenesis, where the ECM undergoes a great deal of turnover and organization. Fn can interact extensively with itself, and with other matrix components, through its collagen-, fibrin-, and glycosaminoglycan-binding domains. However, the signaling pathways leading to Fn fibrillogenesis underneath the osteoblasts are poorly understood. Cells isolated from fetal rat calvaria and grown in culture provide a useful model of Fn fibrillogenesis. In this study, we investigated the regulation of Fn fibrillogenesis in cultured osteoblasts by protein kinases A and C. It was found that PKC increased and PKA inhibited extracellular Fn assembly. Both protein kinases may play important roles in the dynamic changes of Fn matrix and bone tissue remodeling.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

Chemicals and Solutions. 1-(5-Isoquinolinesulfonyl)-2-methylpiperazine dihydrochloride (H7), N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide (H-8), forskolin, 12-O-tetradecanoylphorbol-13 acetate (TPA), and leupeptin were obtained from Sigma-Aldrich (St. Louis, MO). Ro 318220 and Gö 6976 were from Calbiochem (San Diego, CA), and soluble human Fn was from Invitrogen (Carlsbad, CA).

Primary Osteoblast Cultures. The primary osteoblastic cells were obtained from the calvaria of 18-day-old fetal rats. In brief, the fetal rats were put under anesthesia using intraperitoneal injection of pentobarbital. The calvaria were then dissected by aseptic technique. The soft tissues were removed under a dissecting microscope. The clavaria were divided into small pieces and were treated with 0.1% collagenase solution for 10 min at 37°C. The next two 20-min sequential collagenase digestions were then pooled and filtered through a 70-µm nylon filter (Falcon; BD Biosciences, San Jose, CA). The cells were then grown on plastic cell culture dishes in 95% air-5% CO₂ with Dulbecco's modified Eagle's medium, which was supplemented with 20 mM HEPES and 10% heat-inactivated fetal calf serum, 2 mM glutamine, penicillin (100 U/ml), and streptomycin (100 µg/ml), pH adjusted to 7.6. The cell medium was changed twice a week. The osteoblast characteristics were confirmed by morphology and alkaline phosphatase expression.

Immunocytochemistry. Osteoblasts were grown on glass coverslips. Cultures were rinsed once with phosphate-buffered saline (PBS) and fixed for 15 min at room temperature in phosphate buffer containing 4% paraformaldehyde. Cells were rinsed three times with PBS. After blocking with 4% BSA for 15 min, cells were incubated with rabbit anti-rat Fn (1:100; Invitrogen) for 1 h at room temperature. Cells were then washed again and labeled with FITC-conjugated goat anti-rabbit IgG (1:150; Leinco Technologies, Inc., Ballwin, MO) for 1 h. Finally, cells were washed, mounted, and examined with a fluorescence microscope. The mean fluorescence under 10 to 15 cells was measured using an LSM 410 confocal microscope (Zeiss, Thornwood, NY). In some experiments, the distribution of intracellular Fn was also examined by incubating the cells with 0.5% Triton X-100 for 10 min to permeabilize the cell after fixation.

Western Blotting Analysis. Osteoblasts were plated on six-well (35-mm) dishes. Cells were incubated with various drugs for 15 h [7 min for phospho-cAMP response element-binding protein (CREB) detection] and then washed in PBS lysed for 30 min at 4°C with radioimmunoprecipitation assay buffer. Thirty micrograms (50 µg for phospho-CREB detection) of protein was applied per lane, and electrophoresis was performed under denaturing conditions on a 7.5% (10% for phospho-CREB detection) polyacrylamide-SDS gel and then transferred to Immobilon polyvinylidene difluoride membranes (Millipore, Bedford, MA) at 4°C overnight. The blots were blocked with 4% BSA for 1 h at room temperature and then probed with rabbit anti-rat antibodies against Fn (1:1500), 5 integrin (1:100), and phospho-CREB (1:1000; Upstate Biotechnology, Lake Placid, NY) or mouse anti-rat 1 integrin (1:2000; Transduction Laboratories) for 1 h at room temperature. After three washes, the blots were subsequently incubated with a donkey anti-rabbit or sheep antimouse peroxidase-conjugated secondary antibody (1:2000; Amersham Biosciences, Piscataway, NJ) for 1 h at room temperature. The blots were visualized by enhanced chemiluminescence using Kodak X-OMAT LS film (Eastman Kodak, Rochester, NY). For normalization purposes, the same blot was also probed with mouse anti-rat -tubulin antibody (1:1000; Oncogene Science, Boston, MA).

Flow Cytometry. Osteoblasts were plated in six-well (35-mm) dishes. The cells were then washed with PBS and detached with trypsin at 37°C. Cells were fixed for 10 min in PBS containing 1% paraformaldehyde. After rinsing in PBS, the cells were incubated with rabbit anti-rat 5 or mouse anti-rat 1 integrin antibody for 1 h at 4°C. Cells were then washed again and incubated with FITC-conjugated secondary IgG for 45 min and analyzed by flow cytometry using FACSCalibur (BD Biosciences).

mRNA Analysis by RT-PCR. Total RNA was extracted from osteoblasts using a TRIzol kit (MDBio, Inc., Taipei, Taiwan). Five hundred nanograms of RNA from osteoblasts was used for reverse transcriptase-polymerase chain reaction (RT-PCR) by using a One-Step RT-PCR kit (CLONTECH, Palo Alto, CA). Amplification was accomplished with 17 cycles, which was within a linear range in a PCR reaction (Biometra, Göttingen, Germany). PCR products were then separated electrophoretically in a 2% agarose DNA gel and stained with ethidium bromide. 1-integrin mRNA levels were normalized to levels of -actin. The PCR primers used were as follows: 1 integrin: forward primer, GGACAGGAGAAAATGGACGA; reverse primer, TCTGACCATTTGTCGCTACG; -actin: forward primer, TGTCACCAACTGGGACGATA; reverse primer, TCTCCGGAGTCCATCACAAT.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

Fn Fibrillogenesis by Cultured Rat Osteoblasts. The immobilized form of fibrillogenesis from the endogenously released Fn by monolayer osteoblasts was studied using immunocytochemistry. As shown in Fig. 1, rat osteoblasts are able to form an Fn network on the substratum using endogenously released Fn. The assembly of Fn by the rat osteoblasts was time-dependent (Fig. 1, B and C). The quantitative data showed a gradual increase of fluorescence intensity day by day (Fig. 1D). The mean fluorescence intensity under 10 to 15 cells was 12.0 ± 1.0, 19.1 ± 1.8, 38.5 ± 2.3, 42.8 ± 5.8, and 49.1 ± 5.2 (n = 21-25; n represents the group number of the cells) for cells from days 1, 2, 3, 4, and 5, respectively). The following experiments were performed using cells of days 3~5.

View larger version (58K): [in this window] [in a new window]   Fig. 1.   Time-dependent Fn fibrillogenesis by cultured rat osteoblasts. The Fn network, which was shown by immunofluorescence, formed underneath the cultured osteoblasts. The assembly of endogenously released Fn by the rat osteoblasts progressively increased day by day. Phase-contrast images are shown on the left. The quantitative data are shown in D. Bar, 10 µm. Data are presented as mean ± S.E. (n represents the group number of the cells).

Regulation of Matrix Assembly from Endogenously Released Fn by PKC and PKA. The effects of PKC and PKA on the assembly of endogenously released Fn were compared in the rat osteoblasts using quantitative immunofluorescence (Figs. 2 and 3). The osteoblasts from days 3~5 were changed to serum-free medium and incubated with various drugs for 15 h. The mean immunofluorescence of 10 to 15 cells of the monolayer osteoblasts was measured using a confocal microscope. For the study of PKC regulation on the assembly of endogenously released Fn, the cultured osteoblasts were treated with PKC activator TPA or PKC inhibitors H7 and Ro 318220, respectively. Compared with control (Fig. 2A), Fn fibrillogenesis increased markedly after treatment with 0.01 µM TPA for 15 h (Fig. 2B). The mean fluorescence intensity increased from 42.6 ± 2.1 to 73.0 ± 4.6 (n = 16-56; Fig. 2B). The Fn assembly was greatly inhibited by chronic treatment with PKC inhibitors Ro 318220 (1 µM; Fig. 2C) and H7 (10 µM). The mean fluorescence intensity was 28.4 ± 2.9 and 27.3 ± 3.7, respectively (n = 16-56). Fn assembly also decreased when the cultures were treated with TPA at a higher concentration of 1 µM for 15 h (18.0 ± 3.2, n = 19; Fig. 2D), probably resulting from the down-regulation of PKC. There was no obvious cytotoxicity in osteoblasts after prolonged incubation with 1 µM TPA for 15 h. For the investigation of PKA activation on the assembly of endogenously released Fn, osteoblasts were treated with forskolin, an adenylate cyclase activator. Compared with control (Fig. 3A), the assembly of endogenously released Fn greatly decreased after treatment with 10 µM forskolin for 15 h (Fig. 3B). The mean fluorescence intensity was 42.6 ± 2.1 and 15.2 ± 2.7 (n = 22-31) for control and forskolin-treated cells, respectively (Fig. 3C).

View larger version (96K): [in this window] [in a new window]   Fig. 2.   Effects of PKC activity on the assembly of endogenously released Fn by rat osteoblasts. Compared with control (A), Fn assembly markedly increased after treatment with 0.01 µM TPA for 15 h (B). Fn assembly greatly decreased after 15 h of treatment with PKC inhibitor Ro 318220 (C) or higher concentration of TPA at 1 µM (D). Phase-contrast images are shown on the left. Bar, 10 µm.

View larger version (73K): [in this window] [in a new window]   Fig. 3.   Inhibition of forskolin on the assembly of endogenously released Fn by rat osteoblasts. Compared with control (A), treatment with forskolin for 15 h of inhibited Fn fibrillogenesis (B). The quantitative data are shown in C. Phase-contrast images are shown on the left. Bar, 10 µm. Data are presented as mean ± S.E. (n). , p < 0.05 compared with control.

View larger version (58K): [in this window] [in a new window]   Fig. 4.   Increase of Fn protein levels by PKC activation. A, Western blot showed that activation (TPA at 0.01 and 0.1 µM) and inhibition of PKC (Ro 318220 and H7) for 15 h increased and decreased Fn protein levels, respectively. B, classic type PKC inhibitor Gö 6976 also inhibited Fn protein levels in both resting and TPA-stimulated cells. C, treatment with TPA for 30 min showed an obvious translocation of cytosolic PKC and PKC to cell membrane in a concentration-dependent manner. D, treatment with 0.01 µM TPA for 15 h caused a slight increase of membrane translocation of PKC isoforms, including PKC, PKC, PKC, and PKC. However, treatment with 1 µM TPA for 15 h exerted an obvious down-regulation of cytosolic PKC, PKC, PKC, and PKC.

View larger version (18K): [in this window] [in a new window]   Fig. 5.   Effects of forskolin on Fn protein levels and CREB activation. A, Western blot showed that treatment with forskolin or H-8 for 15 h, respectively increased and decreased Fn protein levels in cultured rat osteoblasts. Fn proteins include both cytosolic and extracellularly immobilized forms. B, treatment with forskolin but not TPA for 7 min increased the phosphorylation of CREB.

View larger version (32K): [in this window] [in a new window]   Fig. 6.   Effect of forskolin on intracellular Fn. To observe intracellular Fn, the osteoblasts were fixed with 4% paraformaldehyde and permeabilized with 0.5% Triton X-100. Compared with control (A), treatment with forskolin for 15 h significantly increased cytosolic Fn (B). The cells were treated with forskolin (10 µM) or TPA (0.01 µM) for 15 h and the cytosolic fraction was obtained by centrifugation. The Western blot from cytosolic fraction showed that treatment with forskolin increased Fn protein levels. Treatment of osteoblasts with TPA was used for comparison (C).

Regulation of Protein Kinases on the Matrix Assembly from Exogenously Applied Soluble Fn. To exclude the factor of endogenous Fn synthesis, we further examined the effects of TPA and forskolin on the assembly of exogenously applied soluble Fn by rat osteoblasts. Exogenous soluble human Fn (30 µg/ml) was bath-applied concomitantly with TPA or forskolin for 15 h. The immunocytochemistry of Fn was performed by using mouse antihuman Fn monoclonal antibody, which does not recognize endogenously released rat Fn. We thus are able to simply compare the effects of protein kinases on the extracellular assembly of Fn excluding Fn synthesis. As shown in Fig. 7A, TPA still exerted a stimulatory effect on the assembly of exogenous Fn underneath the cells (Fig. 7B), whereas forskolin inhibited Fn-like immunoreactivity (Fig. 7C). The mean fluorescence intensity was 32.8 ± 2.2, 56.5 ± 6.9, and 16.5 ± 3.1 (n = 22-31) for control, TPA-treated, and forskolin-treated cells, respectively (Fig. 7D). These results further confirm that extracellular Fn assembly is potentiated by PKC and inhibited by PKA activation, respectively.

View larger version (67K): [in this window] [in a new window]   Fig. 7.   Effects of TPA and forskolin on the assembly of exogenously applied soluble human Fn. Exogenous soluble human Fn (30 µg/ml) was bath-applied to osteoblast cultures for 15 h and the immunocytochemistry was performed using mouse anti-human Fn, which does not recognize rat Fn. Compared with control (A), TPA increased (B) and forskolin inhibited (C) the assembly of exogenous soluble Fn underneath the cells. Phase-contrast images are shown on the left. The quantitative data are shown in D. Bar, 10 µm. Data are presented as mean ± S.E. (n). , p < 0.05 compared with control.

Effect of TPA and Forskolin on the Distribution and Synthesis of Integrins. The assembly of extracellular Fn matrix underneath the cells may be related to integrins (Wu et al., 1993; Dzamba et al., 1994). Integrins are a family of dimeric transmembrane receptors that contain  and  subunits. The different combinations of  and  chains form different receptors for various kinds of ECM molecules. 51 integrin is a specific receptor for Fn. We thus used immunocytochemistry to visualize the localization of 5 integrins in cultured rat osteoblasts. The fluorescence was difficult to detect unless the integrin molecules aggregated to form clustering. The control osteoblasts showed the clustering of 5 integrins underneath the cell (Fig. 8A). Treatment with 0.01 µM TPA for 15 h greatly enhanced the fluorescence intensity of 5 integrins (Fig. 8B). By contrast, forskolin showed an inhibitory effect on the fluorescence intensity of 5 integrins (Fig. 8C). These results are consistent with the actions of TPA and forskolin on the extracellular assembly of Fn.

View larger version (110K): [in this window] [in a new window]   Fig. 8.   Effects of TPA and forskolin on the clustering of 5 integrins. 5 integrin, which was shown by immunofluorescence, clustered underneath the cultured osteoblasts. Compared with control (A), treatment with TPA (B) or forskolin (C) for 15 h enhanced and inhibited the clustering of 5 integrins, respectively. Phase-contrast images are shown on the left. Bar, 10 µm.

View larger version (38K): [in this window] [in a new window]   Fig. 9.   Effect of TPA and forskolin on the cell surface expression of 5 integrins. Compared with control, treatment with TPA (A) or forskolin (B) for 15 h enhanced and inhibited, respectively, the fluorescence intensity of 5 integrins, using flow cytometric analysis. The quantitative data are shown in C. Protein levels of 5 integrins were not affected by either TPA or forskolin (D). Data are presented as mean ± S.E. (n = 5). , p < 0.05 compared with control.

View larger version (44K): [in this window] [in a new window]   Fig. 10.   Effect of TPA and forskolin on the cell surface expression of 1 integrins. Compared with control, treatment with TPA (A) or forskolin (B) for 15 h enhanced and inhibited, respectively, the fluorescence intensity of 1 integrins, using flow cytometric analysis. Protein (C) and mRNA levels (D) of 1 integrins were not affected by TPA and forskolin.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Interfering with interactions between Fn and integrin Fn receptors in immature fetal rat calvarial osteoblasts suppressed formation of mineralized nodules in vitro and delayed the expression of tissue-specific genes, including osteocalcin (Moursi et al., 1996, 1997). It also has been reported that osteoblasts become increasingly dependent on Fn for survival when they differentiate and form nodules (Globus et al., 1998). The present study has demonstrated the regulation of protein kinases on the synthesis and assembly of Fn in primary rat osteoblasts. PKC activation enhanced the synthesis of Fn assembly from both endogenously released and exogenously applied soluble Fn. In contrast, PKA activation inhibited the Fn assembly from both endogenously released and exogenously applied soluble Fn. The synthesis of Fn, however, is increased by forskolin. Our results have provided important information about the regulation of Fn dynamic changes by protein kinases in osteoblasts.

The physiological process of Fn matrix formation is complex. The soluble Fn dimmer is compact and maintained by intramolecular binding. The dimmer then binds to integrin heterodimers at the cell surface to immobilize Fn dimmers and induce conformational changes. The clustering of integrin and binding of additional Fn leads to formation and elongation of Fn fibrils, and then connects to the neighboring cells to form a dense network (Schwarzbauer and Sechler, 1999). The turnover of Fn concentration and affinity of Fn receptors, as well as the components of ECM molecules, may affect cell-Fn interactions. With regard to Fn fibrillogenesis in osteoblasts, immunocytochemistry study showed the assembly of endogenously released Fn. In this study, we found that PKC activation enhanced Fn fibrillogenesis. TPA is a direct stimulator of classic and novel types of PKCs. Acute treatment with TPA causes translocation of classic and novel PKCs from the cytosol to the membrane, an event that is necessary for activation of at least some PKC members. However, prolonged treatment with high concentrations of TPA results in degradation and loss of expression of some TPA-responsive PKCs. PKC and PKC are reported to be associated with focal adhesion (Jaken et al., 1989; Barry and Critchley, 1994). A role for PKC in regulating integrin-mediated cell spreading has been observed in other cell systems. For example, down-regulation of PKC and PKC in vascular smooth muscle cells blocked cell spreading on Fn (Haller et al., 1998). Overexpression of a dominant inhibitory mutant of the well-characterized myristoylated alanine-rich C kinase substrate, completely blocks cell spreading of fibroblasts on Fn (Myat et al., 1997). However, the fact that PKC activation increases Fn production has been previously noted in other cell lines, such as human pulmonary fibroblasts, cultured human retinal pigment epithelial cells, and human vascular smooth muscle cells (Osusky et al., 1994; Lee et al., 1996; Kaiura et al., 1999). Activation of PKC results in increased amounts of ¹²⁵I-labeled Fn binding to the cell surface of fibroblast (Somers and Mosher, 1993). In rat cultured mesangial cells, hyperglycemia activated PKC, which then stimulated production of Fn (Koya et al., 1997). In the present study, chronic treatment with low concentrations of the PKC activator TPA enhances the assembly of the endogenously released Fn. Furthermore, TPA increased the cytosolic protein levels of Fn from Western blotting analysis. TPA can induce the membrane translocation of PKC, PKC, PKC, and PKC in osteoblasts, indicating that both classic and novel types of PKCs are involved in the effect of TPA. TPA at higher concentrations caused a cytosolic down-regulation of these PKC isoforms and inhibited Fn fibrillogenesis. Furthermore, PKC inhibitors such as H7, Ro 318220, and Gö 6976 also exerted a marked inhibition on Fn fibrillogenesis. Therefore, the current study suggests that PKC regulates Fn fibrillogenesis in multiple ways.

Forskolin, an adenylate cyclase activator, showed a marked inhibition on Fn fibrillogenesis. This may result from the decrease of Fn synthesis or extracellular Fn assembly and/or the increase of disassembly of Fn matrix. Intracellular staining of Fn and Western blot showed that forskolin increased cytosolic protein levels of Fn. Therefore, inhibitory action on Fn matrix formation by forskolin may be related to the decrease of assembly. Our findings in flow cytometry and immunocytochemistry of 5 integrins are correlated to this decrease of assembly. In addition, experiments with exogenously applied soluble Fn also confirmed that forskolin inhibited Fn assembly. However, forskolin caused a disassembly of previously formed Fn fibrils. Therefore, Fn fibrillogenesis is enhanced and inhibited by PKC and PKA activation, respectively. Although forskolin inhibited extracellular Fn fibrillogenesis, it increased Fn synthesis, as demonstrated by immunocytochemistry and Western blotting analysis of intracellular Fn. It has been shown that cAMP inhibits Fn gene expression in granulosa cells of human cytotrophoblasts (Ulloa-Aguirre et al., 1987; Bernath et al., 1990). However, transcription of the Fn gene is stimulated by cAMP in other cells such as HT1080 and JEG-3 (Dean et al., 1988, 1989). We found here that intracellular Fn levels are enhanced by PKA activation in primary osteoblast cultures. CREB phosphorylation is probably involved in the action of PKA. Intracellular Fn synthesis and extracellular Fn assembly may thus be differentially regulated by PKA activation. In contrast, PKC regulates Fn synthesis and assembly in parallel. Our data point to the existence of multiple regulatory circuits involved in the control of Fn expression in osteoblasts. A number of studies have shown that tissue repair in both normal and pathological conditions is linked to an increased activity of neutral proteases. These enzymes are involved in the regulation of proteolysis of ECM and have an important role in tissue remodeling and cell-matrix and cell-cell interactions (Bond and Butler, 1987; Saksela and Rifkin, 1988). Leupeptin and aprotinin partially antagonize the action of forskolin on the disassembly of previously formed Fn fibril, suggesting that matrix protease activity increased in response to PKA activation (data not shown).

Direct osteoblast interactions with the extracellular matrix are mediated by a select group of integrin receptors that includes 51, 31, v3, and 41 (Clover et al., 1992; Grzesik and Robey, 1994). 51 integrin, a specific Fn receptor, mediates critical interactions between osteoblasts and Fn required for both bone morphogenesis and osteoblast differentiation (Moursi et al., 1997). Perturbing cell-Fn interactions suppress osteogenic differentiation of MG-63 osteosarcoma cells, whereas amplification of 51 promotes differentiation of these cells (Dedhar et al., 1987; Dedhar, 1989). Using flow cytometric analysis, we found here that the fluorescence intensity of 5 and 1 integrins was increased and decreased by TPA and forskolin, respectively. However, Western blotting analysis showed that TPA and forskolin do not affect the protein levels of either integrin. In addition, 1 mRNA level is also not altered by either drug. Therefore, TPA and forskolin may influence the surface expression of 5 and 1 integrins. They may also affect the clustering of integrins, which is consistent with the result derived from immunocytochemistry. TPA increased and forskolin inhibited the clustering of 5 integrins, which is correlated to the drug effect on Fn fibrillogenesis.

In conclusion, our results demonstrated that both PKC and PKA are involved in the regulation of Fn fibrillogenesis. PKC activators enhance the Fn fibrillogenesis in multiple ways; i.e., TPA is able to stimulate the synthesis of Fn, assembly of endogenously released and exogenously applied soluble Fn, and clustering of 5 and 1 integrins. Although Fn synthesis is increased by forskolin, activation of PKA inhibited Fn matrix formation via the inhibitory effect on Fn assembly, clustering of 5 and 1 integrins, and enhancement of Fn disassembly. Our results show that PKC and PKA may be involved in Fn dynamic changes and bone tissue remodeling and may provide some information for the development of drugs to treat osteoporosis.