|
|
|
|
Vol. 61, Issue 5, 989-996, May 2002
Department of Pharmaceutical Science, University of Catania, Cataniea, Italy (S.C., A.Co.); Department of Human Physiology and Pharmacology, University of Rome La Sapienza, Rome, Italy (A.Ca., E.B., D.M., F.N.); I.N.M. Neuromed, Pozzilli, Italy (M.S., F.N.); I.B.S.N.C. C.N.R. Catania, Italy (M.V.C.); and Sigma-Tau Laboratories, Pomezia, Italy (M.V., R.N., M.C.)
| |
Abstract |
|---|
|
|
|---|
L-Acetylcarnitine (LAC, 100 mg/kg, s.c.), a drug commonly used for the treatment of painful neuropathies, substantially reduced mechanical allodynia in rats subjected to monolateral chronic constriction injury (CCI) of the sciatic nerve and also attenuated acute thermal pain in intact rats. In both cases, induction of analgesia required repeated injections of LAC, suggesting that the drug induces plastic changes within the nociceptive pathway. In both CCI- and sham-operated rats, a 24-day treatment with LAC increased the expression of metabotropic glutamate (mGlu) receptors 2 and 3 in the lumbar segment of the spinal cord, without changing the expression of mGlu1a or -5 receptors. A similar up-regulation of mGlu2/3 receptors was detected in the dorsal horns and dorsal root ganglia of intact rats treated with LAC for 5-7 days, a time sufficient for the induction of thermal analgesia. Immunohistochemical analysis showed that LAC treatment enhanced mGlu2/3 immunoreactivity in the inner part of lamina II and in laminae III and IV of the spinal cord. An increased mGlu2/3 receptor expression was also observed in the cerebral cortex but not in the hippocampus or cerebellum of LAC-treated animals. Reverse transcription-polymerase chain reaction combined with Northern blot analysis showed that repeated LAC injections selectively induced mGlu2 mRNA in the dorsal horns and cerebral cortex (but not in the hippocampus). mGlu3 mRNA levels did not change in any brain region of LAC-treated animals. To examine whether the selective up-regulation of mGlu2 receptors had any role in LAC-induced analgesia, we have used the novel compound LY 341495, which is a potent and systemically active mGlu2/3 receptor antagonist. LAC-induced analgesia was largely reduced 45 to 75 min after a single injection of LY 341495 (1 mg/kg, i.p.) in both CCI rats tested for mechanical allodynia and intact rats tested for thermal pain. We conclude that LAC produces analgesia against chronic pain produced not only by peripheral nerve injury but also by acute pain in intact animals and that LAC-induced analgesia is associated with and causally related to a selective up-regulation of mGlu2 receptors. This offers the first example of a selective induction of mGlu2 receptors and discloses a novel mechanism for drug-induced analgesia.
| |
Introduction |
|---|
|
|
|---|
Neuropathic pain is
characterized by spontaneous pain, allodynia, hyperalgesia, and pain
summation and is a hallmark of neuropathies caused by traumatic injury,
diabetes, and viral infections. An enhanced sensitivity of dorsal horn
neurons to sensory stimulation (a phenomenon referred as "central
sensitization") is commonly recognized as one of the mechanisms
underlying chronic pain. In animal models of neuropathic pain, a
sustained release of glutamate and peptides induces long-term
potentiation at the synapses between primary afferent fibers and
second-order neurons in the dorsal horns (reviewed by Sandkuhler,
2000
). Induction of long-term potentiation requires the simultaneous
activation of neurokinin receptors, NMDA receptors, and metabotropic
glutamate (mGlu) receptors (Randic et al., 1993
; reviewed by
Sandkuhler, 2000
). Particular attention is currently focused on mGlu
receptors because these receptors modulate rather than mediate
excitatory synaptic transmission and are therefore ideal targets for
"safe" drugs of potential use in the treatment of chronic pain.
mGlu receptors form a family of eight subtypes (named mGlu1 to mGlu8)
subdivided into three groups on the basis of sequence homology,
pharmacological profile and transduction pathways. Group I mGlu
receptors (mGlu1 and -5) are coupled to polyphosphoinositide
hydrolysis, whereas members of group II (mGlu2 and -3) or group III
(mGlu4, -6, -7, and -8) receptors are coupled to Gi proteins in
heterologous expression systems (reviewed by De Blasi et al., 2001
). In
the dorsal horns, mGlu1 and mGlu5 receptors are localized in laminae I
and II, whereas mGlu2/3 receptors are mainly found in the inner part of
lamina II (Valerio et al., 1997
; Berthele et al., 1999
; Jia et al.,
1999
; Azkue et al., 2000
; Tao et al., 2000
). mGlu4 and -7 receptors are
also present in the superficial laminae of dorsal horns (Li et al.,
1997
; Azkue et al., 2001
). The use of neutralizing antibodies, antisense oligonucleotides, and novel subtype-selective antagonists has
shown that endogenous activation of mGlu1 or -5 receptors reduces pain
threshold and is required for the development of chronic pain (Moroni
et al., 1997
; Young et al., 1998
; Fundytus et al., 1998
; 2001
;
Neugebauer et al., 1999
; Bhave et al., 2001
; Karim et al., 2001
; Walker
et al., 2001a
,b
). Pharmacological activation of group II or III mGlu
receptors depresses excitatory synaptic responses in dorsal horn
neurons (Gerber et al., 2000
). However, how endogenous activation of
these receptors regulates nociceptive transmission and contributes to
responses to analgesic drugs is unknown. We now report the
serendipitous finding that L-acetylcarnitine (LAC), a drug
commonly used for the treatment of painful neuropathies, induces
analgesia by selectively up-regulating the expression of the mGlu2
receptor subtype. This offers an unusual example of selectivity in the
induction of a particular mGlu receptor subtype and provides an
entirely novel mechanism for the induction of analgesia.
| |
Experimental Procedures |
|---|
|
|
|---|
Materials
LAC was synthesized and provided by Sigma Tau Laboratories
(Pomezia, Italy).
(
S)-
-Amino-
-[(1S,2S)-2-carboxycyclopropyl]-9H-xantine-9-propanoic acid (LY 341495) was purchased from Tocris Cookson (Avonmouth, Bristol,
UK). All drugs were dissolved in saline and administered in a volume of
1 ml/kg.
Induction of Chronic Constriction Injury of the Sciatic Nerve
Sciatic constriction injury was induced in male Sprague-Dawley
rats (300-350 g) under pentobarbital anesthesia (50 mg/kg, i.p.), as
described by Bennett and Xie (1988)
. The left common sciatic nerve was
isolated from surrounding tissues and four loose ligatures (4.0 chromie
gut) were placed around the nerve with about 1-mm spacing,
proximally to the nerve's trifurcation. In sham-operated rats, the
sciatic nerve was only exposed and freed of adhering tissues, but no
ligatures were placed on it.
Behavioral Studies
Mechanical Allodynia in Rats Undergoing CCI of the Sciatic Nerve. LAC (100 mg/kg, s.c.) or saline were injected twice a day in CCI- and sham-operated animals starting from the same day of surgery. The treatment was continued for 24 days. For the assessment of mechanical sensitivity, rats were placed in individual cages with elevated mesh floor 1 h before all behavioral testing. Mechanical allodynia was determined with a set of calibrated von Frey filaments used to stimulate the dorsal side of both right and left paws. Animals were tested for hind paw withdrawal both before and every week after CCI. The minimum value for the initial response of the right (nonligated) paw was subtracted from the score of the left (ligated) paw. Five applications of the von Frey filaments were repeated at 3-min intervals on each hind paw.
Thermosensitivity in Intact Animals.
LAC (100 mg/kg, s.c.)
or saline were also injected twice a day for 7 days in intact rats.
Changes in thermal sensitivity were evaluated using a plantar test
apparatus (Ugo Basile, Comerio, Italy). The latency of nociceptive
response was measured every day starting from the first day of
treatment. No tolerance to the test developed in rats treated with
saline. Two independent groups of animals treated with saline or LAC
received a single i.p. injection with the mGlu2/3 receptor antagonist
LY 341495 (1 mg/kg). The two remaining groups received a single
injection of saline. The latency of nociceptive response was measured
before injection and at 5, 15, 30, 45, 60, and 75 min after the single injection of LY 341495 or saline. Plantar test results are expressed as
percentage of maximum possible effect according to the following formula: (PTpost treatment
PTbasal) / (cut-off time
PTbasal) × 100. A cut-off time of 20 s
was set toa void tissue damage.
Western Blot Analysis
Tissues (lumbar segments of the spinal cord, dorsal horns, dorsal
root ganglia, cerebral cortices, hippocampi, and cerebella) were
homogenized on ice in 20 mM Tris-HCl, pH 7.4, containing 10% sucrose,
1 mM phenylmethylsulfonyl fluoride, 20 µg/ml leupeptin, and 1%
aprotinin. Homogenates were centrifuged at 3,000g for 20 min, and the supernatant was centrifuged at 10,000g to
obtained the P2 fraction. After washing by centrifugation, the
resulting pellets were resuspended in SDS-bromphenol blue buffer
containing 40 mM dithiothreitol to limit the formation of receptor
aggregates. Proteins (30 µg) were electrophoresed on 8%
SDS-polyacrylamide gel electrophoresis and electroblotted on
nitrocellulose paper (Bio-Rad, Hercules, CA). Filters were blocked
overnight at 4°C with Tris-buffered saline/Tween 20 (100 mM Tris-HCl,
pH 7.4, 0.9% NaCl, and 1% Tween 20) containing 3% nonfat dry milk,
and then incubated for 1 h at room temperature with 1 µg/ml of
anti-mGlu1a, -2/3, or -5 receptor antibodies (Upstate Biotechnology,
Lake Placid, NY). Filters were then incubated for 1 h at room
temperature with an anti-rabbit peroxidase-coupled secondary antibody
diluted 1:10,000 in Tris-buffered saline/Tween 20. Immunostaining was
revealed by enhanced chemiluminescence (Amersham Biosciences, Milan,
Italy). Changes in mGlu receptor expression were expressed as ratio of densitometric measurements of the receptor bands and the relative
-actin bands.
Immunohistochemistry
Intact rats treated for 7 days with saline or LAC were used for immunohistochemistry. Animals were perfused intracardially with 400 ml of 4% paraformaldehyde in PBS, pH 7.4; the lumbar segment of the spinal cord was removed and cut into 50-µm transverse sections on a vibrotome. Sections were washed in Tris-buffered saline (TBS; 100 mM Tris, 0.9% NaCl), and then incubated in TBS containing 2% of normal goat serum for 30 min. Sections were then incubated overnight at 4°C with mGlu2/3 antibodies (1:100) and, after three washes in TBS, were incubated for 1.5 h with biotin-conjugated goat anti-rabbit secondary antibodies (1:200; Vector Laboratories, Burlingame, CA). Immunostaining was revealed by the avidin-biotin-peroxidase method.
Sections from control and LAC-treated animals were processed in parallel and the time of 3,3'-diaminobenzidine/H2O2 development was identical for each section. mGlu2/3 expression in dorsal horn was quantified by computer-assisted densitometry, using the MCID system (Imaging Research, St Catharine's, Ontario, Canada). Images were visualized under the same light conditions on a video monitor connected to the microscope through a video camera. The integrated optical density was obtained by software conversion of absolute gray values in arbitrary optical density units. This computation was done after obtaining a linear calibration curve generated by the system and attributing the arbitrary value of 0 to the lightest gray value and 3 to the highest value. These values were averaged from several readings in different sections. Values obtained in the posterior white matter did not vary in different sections. Background values (ranging from 0.5 to 0.8 arbitrary units) were considered those obtained in the posterior white matter and were always subtracted.
RNA Extraction and Northern Blotting
Total RNA was prepared from freshly isolated tissue according to
Auffray and Rougeon (1980)
, with modifications. Briefly, tissue was
homogenized in a solution of 3 M LiCl, 6 M urea (5-ml volume per gram
of tissue) for 2 min on ice, using a Polytron homogenizer. After an
overnight incubation at 4°C, the homogenate was centrifuged at
14,000g for 15 min at 4°C. The pellet was then resuspended
in half of the original volume of 3 M LiCl, 6 M urea, and centrifuged
as before. The pellet was then resuspended in 5 ml of 10 mM Tris/HCl,
pH 8.0, 1 mM EDTA, 5% SDS per gram of original tissue and immediately
extracted with an equal volume of phenol/chloroform/isoamyl alcohol
(25:24:1). The aqueous phase was then extracted with an equal volume of
chloroform, and subjected to ethanol precipitation to recover the RNA.
The pellet was air-dried, and resuspended in sterile, distilled water
containing 20 units of RNasin (Promega, Madison, WI) and 5 units of
RNase-free DNaseI (Roche Applied Science, Mannheim, Germany).
After a 15-min incubation at 37°C, the sample was extracted once with
phenol/chloroform/isoamyl alcohol (25:24:1) and once with chloroform,
and finally precipitated in ethanol. The pellet was then resuspended in
sterile, distilled water containing 20 units of RNasin (Promega),
quantified by spectrophotometry and analyzed for integrity by agarose
gel electrophoresis. Northern blotting was carried out as described
previously (Caricasole and Ward, 1993
), using 20 µg RNA/sample. A
specific full-length cDNA probe (Tanabe et al., 1992
; kindly provided
by Prof. S. Nakanishi, Kyoto, Japan) was used for the detection of mGlu
mRNA. To detect mGlu3 mRNA, we used the following antisense oligoprobe:
CAGGATGACTGTTTCCCGCTTCTCTGGAAGGGTGTATCTTCTAGT. Hybridization signals
were analyzed and quantified using a filmless autoradiographic imaging
(Packard Instruments, Meriden, CT).
PCR Analysis
cDNA synthesis and RT-PCR was carried out as described in
Caricasole et al. (2000)
. PCR analysis was performed in a final volume
of 30 µl, using an estimated 0.15 ng of cDNA and primer oligonucleotides specific for rat mGlu2 receptors (forward,
5'-CTACAGTGATGTCTCCATCC-3'; reverse, AAAGCCTCAATGCCTGTCTC), mGlu3
receptors (forward, 5'-CAAGTGACTACAGAGTGCAG-3'; reverse,
5'-CTGTCACCAATGCTCAGCTC-3') or
-actin (Roelen et al., 1994
).
Reaction conditions included an initial denaturation step (94°C/3
min) followed by 45 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s. A final extension step (72°C/10 min) concluded the reaction. PCR products (one third of the reaction) were
analyzed electrophoretically on 2% agarose gels.
| |
Results |
|---|
|
|
|---|
Analgesic Activity of LAC
Thermosensitivity in Intact Rats.
Repeated injections of LAC
(100 mg/kg, s.c., twice daily for 7 days) induced thermal analgesia in
intact rats, as reflected by an increased latency in the plantar test.
Analgesia was substantial after 5 days of treatment with LAC, whereas
shorter treatments were ineffective (Fig.
1A). Analgesia induced by a 7-day
treatment with LAC was substantially reduced 45 to 75 min after a
single injection with the mGlu2/3 receptor antagonist LY 341495 (1 mg/kg, i.p.). LY 341495 did not affect the pain threshold in rats that underwent long-term treatment with saline (Fig. 1B).
|
Mechanical Allodynia in Rats Subjected to Chronic Constriction
Injury (CCI) of the Sciatic Nerve.
In rats subjected to unilateral
CCI of the sciatic nerve, mechanical allodynia developed between 3 and
10 days after surgery and remained unchanged for the subsequent 2 weeks. Two groups of rats were injected once daily with saline or LAC
(100 mg/kg, s.c.) starting 24 h after surgery and tested for
mechanical allodynia 23 days later. LAC treatment completely abolished
allodynia in CCI rats. LAC was ineffective when injected only once 30 to 60 min before the behavioral test. The analgesic effect of a 23-day treatment with LAC was prevented by a single injection of LY 341495 (1 mg/kg, i.p.). LY 341495 did not affect allodynia in CCI rats that had
not been treated with LAC (Fig. 2).
|
Expression of mGlu Receptor Subtypes in Rats Treated with LAC
Initially, we have examined the expression of mGlu1, -2/3, and -5 receptor proteins in the lumbar segment of the spinal cord of
sham-operated or CCI rats treated with LAC or saline for 23 days.
Western blot analysis of mGlu1 and -5 receptors showed a major band at
about 140 kDa, corresponding to receptor monomers. Immunoblots of
mGlu2/3 receptors revealed a band at 100 kDa, corresponding to receptor
monomers, and an additional high-molecular-mass band, corresponding to receptor dimers (Fig.
3A). CCI of the sciatic nerve induced a
trend to an increase in the expression of mGlu2/3 receptors in the
spinal cord without changing the expression of mGlu1 or -5 receptors.
Expression of spinal mGlu2/3 receptors was markedly up-regulated by LAC
treatment in both sham-operated and CCI rats. LAC had no detectable
effect on mGlu1 or -5 receptor expression (Fig. 3, A and B).
|
Because the effect of LAC on mGlu2/3 receptor expression was
independent of the induction of neuropathic pain, we decided to use
intact rats repeatedly injected with LAC for further characterization. Western blot analysis carried out in extracts prepared from the lumbar
spinal cord showed a substantial up-regulation of mGlu2/3 receptor
protein after a 5- or 7-day treatment with LAC. A slight up-regulation
of mGlu2/3 receptors was seen in only 2 of 5 rats treated with LAC for
3 days, but the overall difference from controls was not statistically
significant (Fig. 4A). Thus, the
increased expression of mGlu2/3 receptors in the spinal cords showed a
good relation with the analgesic activity of LAC in the plantar test (which was observed after 5 or 7 days of treatment but not after 3 days). An increased mGlu2/3 receptor expression was also observed in
isolated dorsal horns and in the cerebral cortex, but not in the
cerebellum or hippocampus, of animals treated with LAC for 7 days (Fig.
4B). Immunohistochemical analysis of mGlu2/3 receptors in control rats
showed a predominant labeling in the inner portion of lamina II of the
dorsal horns, as expected. In rats treated with LAC for 7 days, mGlu2/3
immunolabeling was more intense in the inner portion of lamina II and
in laminae III and IV (Fig. 5, A-C). At
higher magnification, mGlu2/3 immunostaining was mostly punctate in the
dorsal horns of LAC-treated animals (not shown), suggesting that
up-regulated receptors were preferentially localized on nerve
terminals. To examine the contribution of primary afferent fibers to
the up-regulation of mGlu2/3 receptors, we performed Western blot
analysis in dorsal root ganglia isolated from the lumbar tract of the
spinal cord. Immunoblots showed an up-regulation of mGlu2/3 receptors
in the dorsal root ganglia of animals treated with LAC for 5 or 7 days
(Fig. 6).
|
|
|
We also examined the expression of mGlu2 and -3 receptor mRNA by
combining RT-PCR and Northern blot analysis. mGlu2 mRNA in the dorsal
horns was below the detection levels by RT-PCR in control rats but was
clearly induced in rats injected repeatedly with LAC. RT-PCR analysis
suggested that a similar induction was present in the cerebral cortex
but not in the cerebellum or hippocampus (Fig.
7A). These data were confirmed by
Northern blot analysis, which showed an increased expression of mGlu2
mRNA levels in the cerebral cortex but not in the hippocampus of rats
treated with LAC. mGlu2 mRNA levels in the dorsal horns could not be
detected by Northern blot analysis (Fig. 7B). The effect of LAC
treatment on mGlu2 receptors was specific because no changes in mGlu3
mRNA levels were observed in any brain region (Fig. 7C).
|
| |
Discussion |
|---|
|
|
|---|
LAC, the acetyl ester of carnitine, is a compound of considerable
interest for its wide clinical application in a number of neurological
disorders, including diabetic and herpes- or HIV-associated neuropathies (Schoemaker, 1994
; Quatraro et al., 1995
; Scarpini et al.,
1996
; 1997
). LAC is a donor of acetyl groups and increases the
intracellular levels of carnitine, which serves as a major transporter
of fatty acids across the mitochondrial membranes (Dolezal and Tucek,
1981
; Farrell et al., 1986
). Hence, the beneficial effect of LAC on
neuropathic pain is generally considered secondary to an improved
energy metabolism in the injured peripheral nerves. Present results
show that LAC acts as a potent analgesic agent and is active not only
in a model of neuropathic pain (i.e., in rats subjected to CCI of the
sciatic nerve) but also in intact animals subjected to acute pain. This
suggests that LAC produces analgesia independently of its neurotrophic
activity and provides the basis for the use of LAC in the treatment of
non-neuropathic pain. Induction of analgesia required multiple
injections of LAC, as opposed to what we observed with classical
analgesic agents (such as opiates), which are active after the first
administration but then progressively loose efficacy, owing to the
development of tolerance. Hence, we have speculated that LAC modulates
nociceptive transmission by inducing plastic changes within the dorsal
horns of the spinal cord. Searching for a mechanism underlying
LAC-induced analgesia, we focused on mGlu receptors, which are largely
implicated in the regulation of pain transmission (Baranauskas and
Nistri, 1998
; Budai and Larson, 1998
; Maione et al., 1998
; Bordi and
Ugolini, 1999
). Recent studies have disclosed a role for mGlu1 and -5 receptors in pain transmission (Fundytus et al., 1998
, 2001
; Bordi and
Ugolini, 2000
; Chen et al., 2000
; Dogrul et al., 2000
; Bhave et al.,
2001
; Karim et al., 2001
; Walker et al., 2001
). However, LAC induced a
selective increase in mGlu2/3 receptors that was temporally related to
the analgesic effect of the drug. In the dorsal horns, mGlu2/3
receptors are known to be localized in postsynaptic densities, vesicle-containing profiles, and glial cells of the inner part of
lamina II (Jia et al., 1999
). In vesicle-containing profiles, mGlu2/3
immunoreactivity is located to membrane compartments distinct from
active release sites (Azkue et al., 2000
). Studies of mRNA levels in
the dorsal horns indicate that mGlu3 receptors are much more expressed
than mGlu2 receptors in resident neurons or glial cells (Boxall et al.,
1998
; Berthele et al., 1999
). An increased expression of mGlu3 mRNA has
been reported in the spinal cord after peripheral inflammation (Boxall
et al., 1998
). In our study, LAC treatment did not affect mGlu3 mRNA
levels, whereas it clearly induced the expression of mGlu2 mRNA in the
dorsal horns and cerebral cortex. This suggests that enhanced
expression of mGlu2 receptors accounts for the increased mGlu2/3
immunoreactivity in LAC-treated animals. Because the induction of mGlu2
mRNA by LAC in the dorsal horns could be detected only after
amplification by RT-PCR, it is likely that most of the receptor protein
is synthesized outside the spinal cord and conveyed inside the dorsal
horns through the afferent fibers, as suggested also by the punctate
profile of mGlu2/3 immunoreactivity. It is consistent with this
hypothesis that LAC treatment also induced an up-regulation of mGlu2/3
receptors in the lumbar dorsal root ganglia. To examine whether the
induction of mGlu2 receptors had any role in LAC-induced analgesia, we
have treated animals with the compound LY 341495, which behaves as a
potent and systemically active mGlu2/3 receptor antagonist (reviewed by
Schoepp et al., 1999
). A single injection of LY 341495 did not affect
acute pain or mechanical hyperalgesia in the absence of LAC, indicating
that endogenously activated mGlu2/3 receptors do not contribute to pain
transmission. Interestingly, however, LY 341495 largely reduced the
effect of LAC in both intact and CCI animals, suggesting that it is the
up-regulation of mGlu2 receptors that mediates LAC-induced analgesia.
We speculate that endogenous activation of mGlu2 receptors acquires the
ability to control the release of glutamate (and/or peptides) from
primary afferent fibers only in animals treated with LAC in which there is an increased probability that the endogenously released glutamate recruits presynaptic mGlu2 autoreceptors. However, we cannot exclude that the up-regulation of mGlu2 receptors in upper brain regions (such
as the cerebral cortex) participates in the analgesic effect of LAC.
Studies with local injections of mGlu2/3 receptor antagonists are
necessary to specifically address this point. The mechanism by which
LAC induces the expression of mGlu2 receptors is still obscure. The
regional selectivity of the effect of LAC suggests that the mGlu2
receptor gene is not a sensor of the metabolic changes induced by LAC
treatment in nerve cells. We rather believe that LAC specifically
affects the expression of the mGlu2 receptor gene in brain regions that
are directly involved in pain sensation, such as the dorsal horns of
the spinal cord and the cerebral cortex.
In conclusion, three novel findings emerge from the present data: 1) LAC treatment induces analgesia not only in models of neuropathic pain but also in models of acute pain in intact animals; 2) LAC is the only known drug that selectively induces mGlu2 receptors. This is relevant from a pharmacological standpoint, because it is hard to differentiate between mGlu2 and -3 receptors; and 3) an enhanced expression of mGlu2 receptors in particular brain regions (such as the spinal cord) can be instrumental for the induction of analgesia. LAC can be therefore considered as the prototype of a novel class of drugs that induce analgesia by up-regulating a specific mGlu receptor subtype.
| |
Footnotes |
|---|
Received September 12, 2001; Accepted January 9, 2002
Address correspondence to: Ferdinando Nicoletti, M.D., Dept. of Human Physiology and Pharmacology, University of Rome, "La Sapienza", Piazzale Aldo Moro, 6, 00185 Rome, Italy. E-mail: ferdinandonicoletti{at}hotmail.com
| |
Abbreviations |
|---|
mGlu, metabotropic glutamate;
LAC, L-acetylcarnitine;
LY 341495, (
S)-
-Amino-
-[(1S,2S)-2-carboxycyclopropyl]-9H-xantine-9-propanoic
acid;
CCI, chronic constriction injury;
TBS, Tris-buffered saline;
RT-PCR, reverse transcription-polymerase chain reaction.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. Chiechio, M. Zammataro, M. E. Morales, C. L. Busceti, F. Drago, R. W. Gereau IV, A. Copani, and F. Nicoletti Epigenetic Modulation of mGlu2 Receptors by Histone Deacetylase Inhibitors in the Treatment of Inflammatory Pain Mol. Pharmacol., May 1, 2009; 75(5): 1014 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Iacovelli, G. Molinaro, G. Battaglia, M. Motolese, L. Di Menna, M. Alfiero, J. Blahos, F. Matrisciano, M. Corsi, C. Corti, et al. Regulation of Group II Metabotropic Glutamate Receptors by G Protein-Coupled Receptor Kinases: mGlu2 Receptors Are Resistant to Homologous Desensitization Mol. Pharmacol., April 1, 2009; 75(4): 991 - 1003. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D Evans, T. F Jacobs, and E. W Evans Role of Acetyl-L-Carnitine in the Treatment of Diabetic Peripheral Neuropathy Ann. Pharmacother., November 1, 2008; 42(11): 1686 - 1691. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Dray Neuropathic pain: emerging treatments Br. J. Anaesth., July 1, 2008; 101(1): 48 - 58. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Poli, A. Beraudi, L. Villani, M. Storto, G. Battaglia, V. Di Giorgi Gerevini, I. Cappuccio, A. Caricasole, M. D'Onofrio, and F. Nicoletti Group II Metabotropic Glutamate Receptors Regulate the Vulnerability to Hypoxic Brain Damage J. Neurosci., July 9, 2003; 23(14): 6023 - 6029. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yang and R. W. Gereau IV Peripheral Group II Metabotropic Glutamate Receptors (mGluR2/3) Regulate Prostaglandin E2-Mediated Sensitization of Capsaicin Responses and Thermal Nociception J. Neurosci., August 1, 2002; 22(15): 6388 - 6393. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||