|
|
|
|
Vol. 62, Issue 2, 297-303, August 2002
Immunoscience Department, Pharmaceutical Discovery Division, Abbott Laboratories, Abbott Park, Illinois (C.W.L., M.N., M.S., D.F., J.K., L. M., R.H., P.K., G.C., B.C.L.); Ligand Pharmaceuticals, San Diego, California (C.T., J.N.M., J.R.); and Eli Lilly and Co., Lilly Corporate Center, Indianapolis, Indiana (M.J.C.)
| |
Abstract |
|---|
|
|
|---|
Glucocorticoids are potent anti-inflammatory and immunosuppressant
agents. However, they also produce serious side effects that limit
their usage. It has been proposed that anti-inflammatory properties of
glucocorticoids are caused mostly by repression of activator protein 1- and nuclear factor 
-stimulated synthesis of inflammatory
mediators, whereas most of their adverse effects are associated with
trans-activation of genes involved with metabolic processes. Our laboratories have sought to discover novel
glucocorticoid receptor (GR) ligands that have high repression but low
trans-activation activities. We describe here cellular
properties of
2,5-dihydro-9-hydroxy-10-methoxy-2,2,4-trimethyl-5-(1-methylcyclohexen-3-y1)-1H-[1]benzopyrano[3,4-f]quinoline (A276575) and its four enantiomers. Similar to dexamethasone, A276575
exhibited high affinity for GR and potently repressed interleukin (IL)
1
-stimulated IL-6 production in human skin fibroblasts, prostaglandin (PG) E2 production in A549 human lung
epithelial cells, and concanavalin A-induced monocyte proliferation. In
contrast to dexamethasone, A276575 caused smaller induction of
aromatase activity in human skin fibroblasts and antagonized
dexamethasone-induced activation of an mouse mammary tumor
virus-glucocorticoid-response element (GRE) reporter gene construct.
Among the four enantiomers of A276575, the two (
)-enantiomers showed
10- to 30-fold higher affinities for GR than their respective
(+)-enantiomers. Both (
)-Syn and (
)-Anti enantiomers of A276575
were potent inhibitors of IL-1
-stimulated PGE2 production in A549
lung epithelial cells; unexpectedly, however, only the (
)-Anti
enantiomer inhibited regulated on T-cell activation, normal T-cell
expressed and secreted (RANTES) production in A549 cells. In summary,
A276575 is a novel, nonsteroidal GR ligand that possesses high
repression activities against inflammatory mediator production but has
lower GRE trans-activation activities than traditional
steroids. Differential repression of RANTES and PGE2 production in a
cell by the two (
)-enantiomers of A276575 illustrates the complexity
of repression by GR.
| |
Introduction |
|---|
|
|
|---|
Glucocorticoids
(GCs) are highly effective and frequently prescribed anti-inflammatory
and immunosuppressive agents for the treatments of rheumatoid
arthritis, asthma, and transplantation (Schimmer and Parker, 1996
).
However, chronic GC usage is known to cause serious side effects such
as osteoporosis, hyperglycemia, hypertension, hypothalamic-pituitary
axis suppression, growth retardation, behavioral changes, and fat
redistribution. These serious side effects have hampered the use of GCs
for the treatment of inflammatory diseases. Therefore, it is highly
desirable to identify novel GC ligands that retain anti-inflammatory
activities of the steroids but have less undesirable side effects.
Glucocorticoid receptor (GR) is a member of the intracellular receptor
superfamily of ligand-activated transcription factors (Karin, 1998
).
GCs binds GR in the cytosol and the GR-ligand complex translocates into
the nucleus, where receptor-ligand complex dimerizes, binds to specific
DNA sequences termed glucocorticoid-response elements (GRE), and
increases the transcription of a number of genes involved with
gluconeogenesis, fatty acid metabolism and metabolic processes. This
GRE-activation activity has been implicated in many of the adverse
events associated with GC therapy. In addition to
trans-activation, GCs also inhibits the synthesis of a
number of pro-inflammatory mediators by interfering with AP-1- or
NF-
B-directed proinflammatory gene transcription (Cato and Wade,
1996
). The mechanism of repression is probably via direct
protein-protein interaction and does not involve
trans-activation (Yang-Yen et al., 1990
; Ray and
Prefontaine, 1994
). In some cells, GCs also induces I
B synthesis
(Auphan et al., 1995
; Scheinman et al., 1995
). Evidence for a genetic
dissociation between trans-activation and repression
activities includes mutational studies of GR in vitro and transgenic
mice expressing dimerization mutants in vivo (Caldenhoven et al., 1995
;
Reichardt et al., 1998
). In addition, synthetic glucocorticoids that
dissociate trans-activation and AP-1
trans-repression have also been described previously
(Vayssiere et al., 1997
).
Our laboratories have developed a new series of high affinity GR
ligands, such as A276575 (Fig. 1). Unlike
traditional GCs, such as dexamethasone (Dex) and prednisolone, these
compounds do not contain the terpenoid structure. Although they repress proinflammatory mediator synthesis in cells, they show antagonistic activity at the MMTV-GRE reporter gene assays and lower activation of
GRE-regulated aromatase enzyme induction in nontransfected human skin
fibroblast cells. We describe here in vitro properties of A276575.
A276575 contains two chiral centers and is a mixture of four
enantiomers. To better understand the stereoselectivity of their
interaction with GR, we synthesized all four of the enantiomers and
characterized their GR activities as well.
|
| |
Experimental Procedures |
|---|
|
|
|---|
Materials.
[3H]Dex (specific
activity, 82-86 Ci/mmol) and [3H]progesterone
(Prog; specific activity, 97-102 Ci/mmol), EIA kit for PGE2 were
purchased from Amersham Biosciences (Piscataway, NJ). Glass fiber type
C multiscreen MAFC NOB plates were from Millipore (Burlington, MA). Hydroxyapatite Bio-Gel HTP gel was from Bio-Rad Laboratories (Hercules, CA). [3H]Androstenedione and
[3H]thymidine were from PerkinElmer Life
Sciences (Boston, MA). Histopaque-1077, Tris, EDTA, glycerol,
dithiothreitol, protease-free bovine serum albumin, and sodium
molybdate were obtained from Sigma-Aldrich (St. Louis, MO).
Charcoal-stripped fetal bovine serum was from Hyclone (Logan, UT).
Microscint-20 scintillation fluid was from Packard BioScience (Meriden,
CT). Human skin fibroblasts (HSF) and human lung epithelial A549 cells
were obtained from American Type Culture Collection (Manassas, VA).
Primary HSF cells were from Clonetics (San Diego, CA). IL-1
was
purchased from Roche Applied Science (Indianapolis, IN). Matched
antibody pairs for human IL-6 were obtained from Endogen (Woburn, MA).
Matched antibody pairs for human RANTES were from R & D Systems
(Minneapolis, MN). All cell culture media and reagents were from
Invitrogen (Carlsbad, CA). AmpliTaq Gold DNA polymerase was from
Applied Biosystems (Foster City, CA). Synthesis and purification of the core of these compounds was performed as described previously (Coghlan
et al., 2001
).
GR and PR Radioligand Binding Assay.
Cytosolic preparations
of human GR-
isoform and human progesterone receptor (PR)-A isoform
were prepared at Ligand Pharmaceuticals. Both receptor cDNAs were
cloned into baculovirus expression vectors and expressed in insect Sf21
cells (Vegeto et al., 1992
; Guido et al., 1996
). Human GR-
and PR-A
binding reactions were performed in Millipore Multiscreen plates. For
GR binding assays, [3H]Dex [~35,000 dpm
(~0.9 nM)], GR cytosol (~35 µg of protein), test compounds, and
binding buffer (10 mM Tris-HCl, 1.5 mM EDTA, 10% glycerol, 1 mM
dithiothreitol, and 20 mM sodium molybdate, pH 7.6 at 4°C) were mixed
in a total volume of 200 µl and incubated at 4°C overnight in a
plate shaker. Specific binding was defined as the difference between
binding of [3H]Dex in the absence and in the
presence of 1 µM unlabeled Dex. For PR binding assays,
[3H]Prog [~36,000 dpm (~0.8 nM)] and PR-A
cytosol (~40 µg of protein) were used. Specific binding was defined
as the difference between binding of [3H]Prog
in the absence and in the presence of 1 µM unlabeled Prog. The amount
of protein used in binding assays was in the linear range of binding
versus protein experiments. After an overnight incubation, 50 µl of
hydroxyapatite (25%, w/v) slurry were added to each well and plates
were incubated for 15 min at 4°C in a plate shaker. Plates were
suctioned with a Millipore vacuum manifold and each well was rinsed
with 300 µl of ice-cold binding buffer. Packard Microscint-20 (250 µl) was added to each well and shaken at room temperature for 20 min.
The amount of radioactivity was determined with a Packard TopCount
plate reader.
, KL of
[3H]Dex was 1.1 nM, and
[3H]Prog was 4.5 nM. Competitive binding curves
for Fig. 2 were analyzed by a nonlinear
sigmoidal curve-fitting program by GradPad Prism Version 3 (San Diego,
CA).
|
IL-6 Production in Nontransfected HSF Cells.
HSF cells were
cultured in 96-well plates to full confluence in DMEM plus 10% FCS and
antibiotics. After removing the culture medium, test compounds prepared
in 1.75% bovine serum albumin, DMEM, and antibiotics were added for
1 h at 37°C. IL-1
(1 ng/ml) was added to cells for overnight
at 37°C, under 5% CO2/95%
O2 atmosphere. Stock solutions of test compounds
were prepared in 100% dimethyl sulfoxide and the final concentration
of dimethyl sulfoxide in the assay was kept at 0.1%. Cell media were
collected and the amount of IL-6 was determined by EIA protocols as
described by Endogen.
MMTV-GRE Reporter Gene Cotransfection Assay.
African green
monkey CV-1 kidney cells were cultured in 12-well plates in DMEM
containing 10% charcoal stripped FBS (Hyclone) and were transiently
transfected using the calcium phosphate coprecipitation method (Truss
et al., 1995
). In brief, 5 µg/ml of human GR-expression plasmid
vector (RSVhGR), 5 µg/ml of MMTV-LUC reporter plasmid, 2.5 µg/ml of
pRS-
-galactosidase, and 7.5 µg of pGEM4 at a final concentration
of 20 µg/ml were precipitated then added to cells. The MMTV-GRE
promoter construct contains four GRE sequence, one NF2 sequence, and
one OCT sequence. After 6 h, the media were changed to DMEM
containing 5% charcoal-stripped FBS and test compounds for
approximately 40 h. Cells were lysed in Triton X-100. Luciferase and
-galactosidase activity in cell lysate were measured.
Cotransfection studies with the human PR-B, human mineralocorticoid
receptor with the MMTV-LUC reporter were carried out in CV-1 cells as
described above to determine cross-reactivity of compounds (Arriza et
al., 1987
; Berger et al., 1992
).
Native Cell GRE Assay Based on Aromatase Activity in
Nontransfected HSF Cells.
The aromatase gene contains one GRE
element in its promoter and was selected for the evaluation of GRE
activities of compounds (Zhao et al., 1995
). Primary HSF cells were
cultured in DMEM containing 10% FBS in 48-well plates until
confluence. Culture media were removed and replaced with 250 µl of
fresh media containing test compounds for 24 h. Aromatase activity
in cells were determined as described previously (Iida et al., 1990
).
Con A-Induced Proliferation of Nontransfected Human PBMC.
PBMC were isolated using procedures described previously (Wasik et al.,
1990
) and plated in 96-well plates at 50,000 cells per well. Test
compounds and ConA (1 µg/ml) were added and cells were incubated at
37°C for 3 days. [3H]Thymidine (0.5 Ci/well)
was added to each well for 6 h. Cells were harvested onto a glass
fiber mat, and after 24 h, radioactivity was determined with a
Packard Matrix 9600.
PGE2 and RANTES Production in Nontransfected Human A549 Lung
Epithelial Cells.
A549 cells were grown to full confluence in F-6
medium containing 10% FCS and antibiotics. One day before compound
treatment, cell medium was replaced with F-6 medium containing
antibiotics but without FCS. Test compounds were added to cells for 40 min before IL-1
(1 ng/ml) addition. After an overnight incubation at
37°C under 95% O2/5%
CO2, cell media were collected for determination of PGE2 and RANTES, a chemokine, by EIA procedures described by suppliers.
Reverse Transcription Polymerase Chain Reaction Study in
Nontransfected A549 Cells.
Messenger RNA levels for RANTES and
COX-2 were measured after A549 cells were treated for 24 h with
IL1
alone and IL1
plus (
)-Anti- or (
)-Syn-stereoisomer of
A276575. Total RNA was isolated by the TRIzol method (Invitrogen) and
levels of RANTES and COX-2 messages were determined by RT-PCR. The
primers used for COX-2 were: TTCAAATGAGATTGTGGGAAAATTGCT (bases
574-600, sense) and AGATCATCTCTGCCTGAGTATCTTT (bases 878-855,
antisense) (Newton et al., 1997
); the primers used for RANTES were:
CCCTGCTGCTTTGCCTACAT (bases 120-139, sense) and CAAGAGCAAGCAGAAACAGG
(bases 359-340, antisense). Cycling parameters were: denaturing,
94°C, 1 min; annealing, 54°C, 1 min; extension, 72°C, 1 min.
Several aliquots were taken after 20 cycles to monitor the appearance
of the COX-2 and RANTES messages.
| |
Results |
|---|
|
|
|---|
Affinities of A276575 and Its Four Enantiomers for GR and PR.
A276575 showed high affinity (Ki = 1.1 nM) for GR and approximately 15-fold selectivity for GR over PR
(Ki = 18 nM) (Table 1). Dex showed affinity similar to that
of A276575 for GR and greater than 6000-fold selectivity for GR over
PR. Of the four enantiomers of A276575, (
)-Syn and (
)-Anti
enantiomers exhibited GR affinities similar to those of A276575 and 10- and 30-fold higher GR affinity than their corresponding
(+)-enantiomers. The competition curves for both Dex and A276575
against [3H]Dex binding showed Hill slopes near
unity, consistent with binding to a single noncooperative population of
GR (Fig. 2).
|
Repression Activities of A276575 and Its Four Enantiomers against
IL-1
-Stimulated IL-6 Production in Nontransfected HSF Cells.
Consistent with their high affinities for GR, A276575 and its (
)-Anti
and (
)-Syn enantiomers repressed IL-1
-stimulated IL-6 production
in HSF cells with high potencies (EC50, 10-50 nM) and efficacies (>85% of Dex) (Table
2). Although (+)-Syn and (+)-Anti
enantiomers of A276575 also repressed IL-6 production, they were
~10-fold less potent than their respective (
)-enantiomers.
|
Repression Activities of A276575 and Its Four Enantiomers against
Con A-Induced Proliferation of PBMC.
A276575 and its two (
)-enantiomers showed high potencies
(EC50, 15-25 nM) and efficacies (> 85% of Dex)
in inhibiting Con A-induced proliferation of PBMCs (Table
3). Their potencies in inhibiting PBMC
proliferation were approximately 10-fold weaker than that of
Dex. The two (+)-enantiomers again showed approximately 10- to
30-fold lower potencies than their respective (
)-enantiomers.
|
MMTV-GRE Reporter Gene Assay in CV-1 Cells.
In contrast to
their high repression activities against IL-6 production and
proliferation of PBMCs, A276575 and its four enantiomers exhibited
minimal efficacies (< 5% of Dex) in activating the MMTV-GRE promoter
in transfected CV-1 cells (Table 4). In
fact, A276575 antagonized Dex-induced GRE activation (Fig.
3A).
|
|
MMTV-PR-B and MMTV-MR Reporter Gene Assay in CV-1 Cells. In contrast to its antagonistic activity at the MMTV-GR reporter construct, A276575 behaved as a superagonist in the MMTV-PR-B luciferase assay (Fig. 3B), eliciting >300% of the response generated by progesterone. Its potency (EC50, ~20 nM) at the PR-B construct was approximately the same as progesterone. On the MR-MMTV promoter, A276575 behaved as a partial agonist, exhibiting 50% of the response shown by aldosterone. Its potency was >100- to 1000-fold weaker than aldosterone (Fig. 3C).
Aromatase Activity in Nontrasfected Human Skin Fibroblasts.
In
contrast to their minimal activities in MMTV-GRE reporter gene
construct, in primary HSF, A276575 and its four enantiomers showed
significant but lower efficacies (56-81%) than Dex in the induction
of aromatase expression (Table 5).
Potencies of the (
)-Syn and (
)-Anti enantiomers were approximately
10- to 16-fold higher than their corresponding (+)-enantiomers.
Therefore, A276575 induced greater GRE activation of aromatase than the
MMTV-GRE reporter.
|
Differential Regulation of RANTES and PGE2 Production by
(
)-Anti-and (
)-Syn-Enantiomers of A276575.
Upon IL-1
challenge, the human A549 lung epithelial cells secrete a number of
inflammatory mediators such as RANTES, PGE2, IL-8, and granulocyte
macrophage-colony stimulating factor. GCs are known to suppress the
production of these mediators (Newton et al., 1997
). A276575 and
its two (
)-enantiomers suppressed the
production of PGE2 with potencies and
efficacies similar to those of Dex (Table 6 and Fig.
4A). The two (+)-enantiomers of A276575
showed 5- to 10-fold lower potencies than their respective (
)-enantiomers. In contrast to their high PGE2 suppression
activities, both A276575 (a 7:1 mixture of Syn- to Anti-diasteromers)
and its (
)-Syn enantiomer were inactive against IL-1
-stimulated RANTES production in A549 cells. By contrast, the (
)-Anti enantiomer of A276575 showed high efficacy and potency in repressing RANTES production (Fig. 4B).
|
|
-induced RANTES and COX-2 transcripts,
we performed RT-PCR and assessed the effects of the two
(
)-enantiomers. Figure 5 shows that
IL-1
-induced RANTES was preferentially suppressed by the (
)-Anti
enantiomer, whereas IL-1
-induced COX-2 message was equally
suppressed by (
)-Anti and (
)-Syn enantiomers.
|
| |
Discussion |
|---|
|
|
|---|
Glucocorticoids are highly effective and widely prescribed
anti-inflammatory agents. However, serious metabolic side effects associated with GC treatment have limited their use. It has been proposed that anti-inflammatory properties of GCs are attributable to
inhibition of inflammatory mediators and metabolic side effects of GCs
are related to GRE activation (Cato and Wade, 1996
). GC ligands that
maintain repression activity but have lower GRE activity may be safer
than traditional steroidal GCs. Our efforts to develop such an agent
led to A276575, an example of such a new class of nonsteroid GC ligand.
A276575 has high affinity for GR and, similar to Dex, strongly
represses the production of inflammatory mediators in several cellular
systems, including IL-1
-stimulated IL-6 production in HSF cells,
ConA-induced proliferation of PBMC, and IL-1
-stimulated PGE2
production in human A549 lung epithelial cells. In contrast, A276575
antagonizes Dex-induced activation of an MMTV-GRE reporter gene
construct. However, compared with Dex, A276575 and its active enantiomers exhibit significant but lower induction of aromatase activity in nontransfected human skin fibroblasts. The efficacy of
A276575 in the aromatase assay in HSF is much greater in its efficacy
in the induction of the MMTV-GRE promoter construct. Possible
explanations include differences of host cells, the transfected nature
of the MMTV construct and the more complex transcriptional regulation
of the aromatase gene.
A276575 contains two chiral centers and is a racemic mixture of
7:1 Syn- to Anti-diastereomers. To determine the
stereospecificity of its interaction with GR, all four enantiomers were
prepared and evaluated for GR affinity and activities in repression and GRE activation assays. As shown in Tables 1 to 3, the (
)-Anti and
(
)-Syn enantiomers of A276575 exhibit high GR affinity and strong
repression activity against IL-6 production in HSF, Con-A-induced proliferation of PBMC, and PGE2 production in A549 lung epithelial cells (Table 6). The two (
)-enantiomers also show similar potencies in activating aromatase activity in HSF and are devoid of any MMTV-GRE
activity (Table 4). The (+)-enantiomers of A276575 are about 10-fold
weaker in potency than their respective (
)-enantiomers. Surprisingly,
the (
)-Anti enantiomer of A276575 is highly active against RANTES
production in 549 cells, whereas the (
)-Syn enantiomers of A276575
and A276575 are inactive in repressing RANTES production (Table 6).
Because PGE2 production is suppressed equally by (
)-Syn and (
)-Anti
enantiomers of A276575, the inability of (
)-Syn enantiomer to repress
RANTES production is unexpected. This result suggests that the
(
)-Anti and (
)-Syn enantiomers of A276575 generate different
conformations with the receptor. As shown by RT-PCR, the (
)-Anti
enantiomer, not the (
)-Syn enantiomer, was able to suppress
IL-1
-induced mRNA for RANTES. The promoter region of RANTES message
contains a 12-O-tetradecanoylphorbol-13-acetate response element as well as several NF-
B binding sites, whereas COX-2 promoter contains only NF-
B sites. After binding to GC receptor, the (
)-Syn enantiomer may have a weaker interaction with
the 12-O-tetradecanoylphorbol-13-acetate response
element or NF-
B sites of RANTES promoter than the (
)-Anti
enantiomer. The differences may also reflect differential interactions
with corepressors and coactivators of RANTES and COX-2 message.
In summary, we have demonstrated that A276575 and its (
)-enantiomers
have similar repression activities and lower GRE activities compared
with Dex. The remarkable differences between enantiomers suggest that
even subtle effects of ligand can impact receptor function. Given their
in vitro profile, it is possible that these novel ligands possess good
anti-inflammatory activities and lower metabolic side effects than
traditional GCs. Because the (
)-Anti enantiomer is more effective
than the (
)-Syn enantiomer in repression of RANTES, it is possible
that the (
)-Anti enantiomer of this class of GR ligands will exhibit
greater anti-inflammatory efficacy in vivo than the (
)-Syn enantiomer.
A-276575 exhibits high PR affinity and superagonist activity in the
MMTV-PR-B transfection assays (Fig. 3B). These properties, which are
undesirable and are not seen with dexamethasone, therefore limit its
utility as an anti-inflammatory agent. Additional modifications of its
structure led to analogs (e.g., compound 13) with high affinity for GR
and low PR affinity and efficacy (Coghlan et al., 2001
). Compound 13 also exhibits anti-inflammatory activity in Sephadex-induced eosinophil
influx in rat lung (Coghlan et al., 2001
).
| |
Footnotes |
|---|
Received January 14, 2002; Accepted April 19, 2002
Address correspondence to: Chun Wel Lin, Ph.D., R4CB, AP9A, Metabolic Disease Research, 100 Abbott Park Road, Abbott Laboratories, Abbott Park, IL 60064-6117. E-mail: chun.lin{at}abbott.com
| |
Abbreviations |
|---|
GC, glucocorticoid;
GR, glucocorticoid
receptor;
GRE, glucocorticoid response element;
AP-1, activator protein
1;
NF-
B, nuclear factor
B;
A276575, 2,5-dihydro-9-hydroxy-10-methoxy-2,2,4-trimethyl-5-(1-methylcyclohexen-3-y1)-1H-[1]benzopyrano[3,4-f]quinoline;
Dex, dexamethasone;
MMTV, mouse mammary tumor virus;
EIA, enzyme
immunoassay;
PGE2, prostaglandin E2;
HSF, human skin fibroblast;
IL, interleukin;
PR, progesterone receptor;
Prog, progesterone;
DMEM, Dulbecco's modified Eagle's medium;
FBS, fetal bovine serum;
FCS, fetal calf serum;
PBMC, peripheral blood mononuclear cells;
ConA, concanavalin A;
RANTES, regulated on T-cell activation, normal T-cell
expressed and secreted;
RT-PCR, reverse transcriptase-polymerase chain
reaction;
COX-2, inducible cyclooxygenase.
| |
References |
|---|
|
|
|---|
B activity through induction of I
B synthesis.
Science (Wash DC)
270:
286-290
B
by glucocorticoids.
Science (Wash DC)
270:
283-286This article has been cited by other articles:
![]() |
F. J. Lopez, R. J. Ardecky, B. Bebo, K. Benbatoul, L. De Grandpre, S. Liu, M. D. Leibowitz, K. Marschke, J. Rosen, D. Rungta, et al. LGD-5552, an Antiinflammatory Glucocorticoid Receptor Ligand with Reduced Side Effects, in Vivo Endocrinology, May 1, 2008; 149(5): 2080 - 2089. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Miner, B. Ardecky, K. Benbatoul, K. Griffiths, C. J. Larson, D. E. Mais, K. Marschke, J. Rosen, E. Vajda, L. Zhi, et al. Antiinflammatory glucocorticoid receptor ligand with reduced side effects exhibits an altered protein protein interaction profile PNAS, December 4, 2007; 104(49): 19244 - 19249. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-J. Kim, G.-S. Lee, Y.-K. Ji, K.-C. Choi, and E.-B. Jeung Differential expression of uterine calcium transporter 1 and plasma membrane Ca2+ ATPase 1b during rat estrous cycle. Am J Physiol Endocrinol Metab, August 1, 2006; 291(2): E234 - E241. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Hochhaus New Developments in Corticosteroids Proceedings of the ATS, November 1, 2004; 1(3): 269 - 274. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. De Bosscher, W. Vanden Berghe, and G. Haegeman The Interplay between the Glucocorticoid Receptor and Nuclear Factor-{kappa}B or Activator Protein-1: Molecular Mechanisms for Gene Repression Endocr. Rev., August 1, 2003; 24(4): 488 - 522. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||