![]() |
|
|
Vol. 62, Issue 3, 521-528, September 2002
Department of Pharmacology, University of North Carolina School of Medicine, Chapel Hill, North Carolina (C.A.-C., P.L.-Z., J.M., T.K.H., J.L.B.); and Inspire Pharmaceuticals, Inc., Durham, North Carolina (J.L.B.)
| |
Abstract |
|---|
|
|
|---|
To begin to address the functional interactions between constitutively
released nucleotides, ectonucleotidase activity, and P2Y
receptor-promoted signaling responses, we engineered the human P2Y1 receptor in a fusion protein with a member of the
ectonucleoside triphosphate diphosphohydrolase family, NTPDase1.
Membranes prepared from Chinese hamster ovary (CHO)-K1 cells
stably expressing either wild-type NTPDase1 or the P2Y1
receptor-NTPDase1 fusion protein exhibited nucleotide-hydrolytic
activities that were over 300-fold greater than activity measured in
membranes from empty vector-transfected cells. The molecular ratio for
nucleoside triphosphate versus diphosphate hydrolysis was approximately
1:0.4 for both the wild-type NTPDase1 and P2Y1-NTPDase1
fusion protein. Stable expression of the P2Y1-NTPDase1
fusion protein conferred an ADP and 2MeSADP-promoted Ca2+
response to CHO-K1 cells. Moreover, the maximal capacity of the nonhydrolyzable agonist ADP
S to stimulate inositol phosphate accumulation was similar, and the EC50 of ADP
S was lower
in the fusion protein than the wild-type receptor. In contrast, the
substantial nucleotide-hydrolyzing activity of the fusion protein
resulted in a greater than 50-fold shift to the right of the
concentration-effect curve of ADP for activation of phospholipase C
compared with the wild-type receptor. Heterologous expression of the
P2Y1 and other P2Y receptors results in marked increases in
basal inositol phosphate levels. Given the high nucleotidase activity
and apparently normal receptor signaling activity of the
P2Y1 receptor-NTPDase1 fusion protein, we quantitated basal
inositol phosphate accumulation in cells stably expressing either the
wild-type P2Y1 receptor or the fusion protein. Although
marked elevation of inositol phosphate levels occurred with wild-type
P2Y1 receptor expression, levels in cells expressing the
fusion protein were not different from those in wild-type CHO-K1 cells.
| |
Introduction |
|---|
|
|
|---|
The
regulated release of cellular nucleotides and nucleosides results in
myriad physiological responses through approximately 20 different G
protein-coupled and ligand-gated ion channel receptors (Harden et al.,
1998a
; Ralevic and Burnstock, 1998
; Khakh et al., 2000
). Hormone and
neurotransmitter signaling pathways require effective mechanisms for
removing or metabolizing extracellular signaling molecules, and in the
case of extracellular nucleotide signaling, a broad range of
nucleotide-degrading and interconverting ecto- or extracellular enzymes
have been identified (Zimmermann, 1996
, 2000
). These include the
ectonucleoside triphosphate diphosphohydrolase family, which is
composed of 1) ecto-ATP diphosphohydrolase (NTPDase1; also known as
ecto-ATPDase, apyrase, or CD39), which hydrolyzes nucleoside tri- and
diphosphates with similar rates; 2) ecto-ATPase (NTPDase2; also known
as CD39L1), which hydrolyzes nucleoside triphosphates with high
selectivity over diphosphates; and 3) NTPDase3 (also known as CD39L3),
which hydrolyzes nucleoside triphosphates with some selectivity over
nucleoside diphosphates. Other enzymes involved in the degradation and
interconversion of nucleotides include ectonucleotide
pyrophosphatases/phosphodiesterases, nucleoside diphosphokinase,
adenylate kinase, ecto-5'-nucleotidase, and other enzymes (Zimmermann,
1996
, 2000
).
The physiological significance of the NTPDase family and other
ectoenzymes is not fully understood. For example, no specific high-affinity inhibitors of molecularly defined ectonucleotidases are
available, and very few studies have directly considered the role of
metabolizing enzymes in regulation of P2 receptor-mediated responses.
Nonetheless, ubiquitous distribution and apparent colocalization of
metabolizing enzymes with nucleotide receptors suggest a primary role
of these enzymes in extracellular nucleotide signaling. Targeted disruption of the NTPDase1 gene resulted in severe alterations of
hemostasis, underscoring an important role previously proposed for P2
receptor signaling in platelet aggregation (Enjyoji et al., 1999
).
Marked transient elevation of extracellular nucleotides occurs as a
consequence of regulated release from both excitatory and nonexcitatory
cells (Dubyak and El-Moatassim, 1993
; Lazarowski et al., 1995
, 1997
;
Schlosser et al., 1996
; Grygorczyk and Hanrahan, 1997
). In addition,
basal constitutive release of nucleotides occurs from most if not all
cell types (Lazarowski et al., 2000
; Ostrom et al., 2000
). This
constitutive nucleotide release is counterbalanced by
ectonucleotidase-catalyzed degradation, and resting steady-state levels
of extracellular nucleotides range from 5 to 50 nM depending on the
nucleotide and cell type studied (Lazarowski and Harden, 1999
;
Lazarowski et al., 2000
). Evidence has accrued for an important role of
these resting levels of extracellular nucleotides in regulation of
cellular function (Mitchell et al., 1998
; Ostrom et al., 2000
;
Braunstein et al., 2001
; Fleischhauer et al., 2001
).
Most signaling pathways are probably efficiently organized as
multiprotein complexes in specific membrane microdomains. NTPDase1 and
possibly other ectoenzymes are associated with caveolae (Kittel et al.,
1999
; Koziak et al., 2000
), which suggests a plausible means by which
these metabolic enzymes might functionally associate with signaling
proteins involved in cellular responses to extracellular nucleotides.
To begin to directly address the functional relationship between nucleotide-metabolizing enzymes and P2Y receptor-mediated signaling, we have fused the human P2Y1 receptor in one-to-one stoichiometry with human NTPDase1. The stably expressed fusion protein recapitulates the surface membrane localization and functional characteristics of both the receptor and ectonucleotidase. Moreover, the receptor exhibits greater than 50-fold loss of sensitivity to exogenous ADP in assays of inositol phosphate accumulation, and in contradistinction to the wild-type P2Y1 receptor, expression of the fusion protein does not result in elevation of basal levels of inositol phosphates. Given that the fusion protein retains full responsiveness to hydrolysis-resistant nucleotides, this engineered protein should prove valuable in biochemical and pharmacological investigation of the functional relationships between constitutive and regulated nucleotide release, ectonucleotidase activity, and P2Y receptor-mediated signaling responses. To our knowledge, the P2Y1 receptor-NTPDase1 fusion protein represents the first example of a G protein-coupled receptor fused in a fully functional state with an enzyme that metabolizes its activating agonist.
| |
Materials and Methods |
|---|
|
|
|---|
Materials.
Potato apyrase (EC 3.6.1.5) grade 1, ATP, ADP,
and 2MeSADP were obtained from Sigma-Aldrich (St. Louis, MO);
ADP
S was purchased from Calbiochem-Novabiochem (San Diego, CA); and
hygromycin B was obtained from Roche Diagnostics (Indianapolis, IN).
The pcDNA4/myc-His mammalian expression vector and zeocin were
purchased from Invitrogen (Carlsbad, CA); anti-penta-his monoclonal
antibody was obtained from QIAGEN (Valencia, CA); anti-mouse
horseradish peroxidase-conjugated secondary antibody and enhanced
chemiluminescent substrate were obtained from Pierce Chemical
(Rockford, IL); LipofectAMINE Plus Reagent was purchased from
Invitrogen; myo-[3H]inositol (20 Ci/mmol) was obtained from American Radiolabeled Chemicals, Inc. (St.
Louis, MO);
-[32P]ATP was purchased from
PerkinElmer Life Sciences, Inc. (Boston, MA); and Fluo-3-acetoxymethyl
ester was obtained from Molecular Probes (Eugene, OR). All
tissue culture reagents were obtained from the Lineberger Comprehensive
Cancer Center tissue culture facility at the University of North Carolina.
Construction of P2Y1 Receptor, Human NTPDase1, and
P2Y1-NTPDase1 Expression Plasmids.
The human
P2Y1 receptor was prepared as described
previously (Schachter et al., 1996
). The construction of the
P2Y1 receptor with a hexahistidine tag in the N
terminus was generated by PCR amplification using as forward primer
5'-GAGAGAATTCTGGCCATGGGGGGTTCTCATCATCATCATCATCATACCGAGGTGCTGTGGCCGGCT-3' and reverse primer 5'-
GAGAGCGGCCGCTCACAGGCTTGTATCTCCATTCTGCTTG-3'. The forward
primer includes an EcoRI site, a start codon, and an
in-frame hexahistidine sequence added upstream of the second codon of
the P2Y1 receptor gene (the enzyme restriction
sites are in bold). The reverse primer added a NotI
restriction site after the stop codon. The PCR amplification product
was ligated into the retroviral vector pLXPIH previously digested with
EcoRI and NotI. The plasmid encoding the NTPDase1
was obtained by PCR from the pLXPIH-CD39. The forward primer
5'-GAGAGAATTCCGAGGAAAGAGGAGGAAAACAAAAGCTGC-3' was used to add an EcoRI site. The reverse primer
5'-GAGATCTAGAACCATATCTTTCCAGAAATATGAAGG-3' was used to
remove the stop codon, add a XbaI site, and maintain the
reading frame with the myc-his6 tags of the pcDNA4 vector (Invitrogen).
The plasmid encoding the P2Y1-NTPDase1 was
constructed by PCR amplification of the P2Y1
receptor and NTPDase1 vectors described above. The
P2Y1 receptor gene was amplified with the forward
primer
5'-GAGAGAATTCTGGCCATGGGGGGTTCTCATCATCATCATCATCATACCGAGGTGCTGTGGCCGGCT -3' and reverse primer
5'-TCTCGTCGACCAGGCTTGTATCTCCATTCTGCTTGA-3'. The
forward primer added an EcoRI site upstream of the start
codon, and the reverse primer omitted the stop codon and added a
SalI site. The NTPDase 1 was amplified from the
pcDNA4-NTPDase1 with the forward primer
5'-GAGAGTCGACATGGAAGATACAAAGGAGTCTAACGTG-3' and reverse
primer 5'-TCTCGGATCCTCAATGGTGATGGTGATGATGACC-3'. The forward
primer added a SalI site upstream of the start codon, and
the reverse primer added a BamHI site after the stop codon of the pcDNA4 myc-his6. The PCR amplification products were digested with the corresponding restriction enzymes and cloned by a three-way ligation into the retroviral vector pLXPIH previously digested with
EcoRI and BamHI. This construct resulted in an
in-frame sequence of the P2Y1 receptor and
NTPDase1 genes. The resulting plasmids were amplified, purified, and
sequenced at the University of North Carolina-Chapel Hill automated DNA
sequencing facility.
Generation of Stably Transfected Cell Lines. Purified plasmid DNA containing the P2Y1 receptor, NTPDase1, or P2Y1-NTPDase1 genes were stably transfected into CHO-K1 cells using LipofectAMINE 2000 (Invitrogen). Briefly, 8 µg of plasmid DNA were combined with 20 µl of LipofectAMINE 2000 in a final volume of 1 ml of OPTI-MEM reagent (Invitrogen). After incubation for 20 min at room temperature, the mixture was added to a 90% confluent monolayer of CHO-K1 cells in a 60-mm dish containing 5 ml of Ham's F-12 nutrient medium supplemented with 10% fetal bovine serum. After incubation for 12 h at 37°C, the medium was replaced with 5 ml of fresh F12-medium with 10% fetal bovine serum. Cell populations stably expressing these genes were obtained by selection with 0.4 mg/ml hygromycin B (Roche Diagnostics) for P2Y1 receptor and P2Y1-NTPDase1 and 0.4 mg/ml of zeocin (Invitrogen) for NTPDase1. Clonal cell lines were isolated, and P2Y1 receptor and NTPDase1 expression were evaluated by Western blot analysis.
Ectonucleotidase Activities.
CHO-K1 cells stably expressing
vector control, NTPDase1, or P2Y1-NTPDase1 fusion
protein were seeded into 48-well plates at 4 × 104 cells per well and assayed after cells
reached confluence. Briefly, the cells were washed once with 500 µl
of phosphate-free saline solution consisting of 125 mM NaCl, 5.2 mM
KCl, 20 mM HEPES, pH 7.4, 2 mM CaCl2, 1.2 mM
MgCl2, and 5 mM D-glucose and
incubated at 37°C in a 200-µl final volume of the same medium
containing the indicated concentrations of nucleotide. Incubations were
terminated by transferring 170 µl of the cell-free supernatants to a
new plate containing 170 µl of 20 mM EDTA at 4°C. Ectonucleotidase activity was measured as the release of inorganic phosphate from the
substrates ATP or ADP. Inorganic phosphate was determined colorimetrically using a modification of the malachite green-based assay (Lanzetta et al., 1979
). Cell supernatants (30 µl) were combined with 100 µl of malachite green reagent, mixed, and the absorbance at 590 nm was determined in a plate reader. In some experiments, ATP hydrolysis was measured as the release of
32Pi from
-[32P]ATP, using activated charcoal for separation.
P2Y1 Receptor-Promoted Phospholipase C Activity.
Agonist-stimulated inositol phosphate production was measured in CHO-K1
cells stably expressing the P2Y1 receptor, the
P2Y1-NTPDase1 fusion protein, or in vector
control cells. Cells were grown to confluence on 48-well plates. The
inositol lipid pool was radiolabeled by incubation for 24 h before
the assay in 200 µl of serum-free inositol-free Dulbecco's modified
Eagle's medium supplemented with
myo-[3H]inositol (2 µCi/ml) at 37°C in a
5% CO2 atmosphere. The cells were challenged
with receptor agonists (ADP or ADP
S) in assay buffer (10 mM LiCl, 20 mM HEPES, pH 7.4, and Hank's buffered saline solution) for 15 min, and
incubations were terminated by aspiration of the drug-containing medium
and addition of 450 µl of 50 mM ice-cold formic acid. After 15 min at
4°C, samples were neutralized with 150 µl of 150 mM
NH4OH. [3H]Inositol
phosphates were isolated by anion exchange chromatography by
transferring 600 µl of sample to Dowex AG 1-X8 (200-400 mesh) columns (Bio-Rad, Hercules, CA) containing 10 ml of
H2O. Columns were washed with 10 ml of 50 mM
ammonium formate, and the eluate was discarded.
[3H]Inositol phosphates were eluted with 2 ml
of 1.2 M ammonium formate and 100 mM formic acid and quantitated by
liquid scintillation spectrometry.
Intracellular Calcium Mobilization. CHO-K1 cells stably expressing the P2Y1 receptor and the P2Y1-NTPDase1 fusion protein were seeded in 96-well black wall/clear-bottomed culture plates (Corning Glassworks, Corning, NY), and assays were conducted 2 days later with the cells at confluence. On the day of the assay, the growth medium was aspirated, replaced with medium containing 2.5 µM Fluo-3-acetoxymethyl ester, and incubated for 1 h at 37°C before replacing the dye with assay buffer (10 mM KCl, 118 mM NaCl, 2.5 mM CaCl2, 1 mM MgCl2, 10 mM glucose, and 20 mM HEPES, pH 7.4). Intracellular Ca2+ levels were monitored as changes in fluorescence intensity using a fluorometric imaging plate reader from Molecular Devices Corp. (Sunnyvale, CA).
Immunoblot Analysis. CHO-K1 cells (3 × 106) expressing the human NTPDase1, P2Y1 receptor, or P2Y1-NTPDase1 fusion protein were seeded and grown on 60-mm dishes. After 2 days in culture, the medium was aspirated, and reducing Laemmli's sample buffer was added to the cells. The samples then were subjected to SDS-polyacrylamide gel electrophoresis on an 8% polyacrylamide gel, and the resolved proteins were transferred to nitrocellulose membranes. Proteins were identified using a monoclonal mouse anti-penta-His IgG (Invitrogen) in 5% milk in Tris-buffered saline, followed by visualization by chemiluminescence after incubation with horseradish peroxidase-conjugated goat anti-mouse IgG using SuperSignal West Pico chemiluminescent substrate (Pierce Chemicals) according to the manufacturer's instructions.
| |
Results |
|---|
|
|
|---|
Expression of the P2Y1 Receptor-NTPDase1 Fusion
Protein.
Wild-type CHO-K1 cells were infected with pLXPIH vector
containing either the human P2Y1 receptor gene or
a recombinant gene combining the P2Y1 receptor
and NTPDase1 genes, which resulted in expression of the
P2Y1 receptor fused at its carboxy terminus with
the amino terminus of NTPDase1 (Fig. 1).
CHO-K1 cells stably expressing wild-type NTPDase1 were obtained after
transfection of a pcDNA4 vector containing the NTPDase1 gene. A
hexahistidine tag was included at the amino terminus of the
P2Y1 receptor, and Myc and hexahistidine tags
were included at the carboxy terminus of NTPDase1 and the
P2Y1-NTPDase1 fusion protein. The presence of
these tags had no effect on the expression, targeting to the plasma
membrane, or biochemical or pharmacological properties of the
P2Y1 receptor or NTPDase1 (data not shown; see
below). Western blots of CHO-K1 cells stably expressing these proteins revealed species migrating at approximately 40, 100, and 135 kDa (Fig.
2), corresponding to the expected sizes
for the P2Y1 receptor, NTPDase1, and the
P2Y1-NTPDase1 fusion protein, respectively. No
immunoreactivity was observed in cells transfected with empty vector
alone.
|
|
Ectonucleotidase Activity of the P2Y1-NTPDase1 Fusion
Protein.
To assess whether ecto-ATPase and ecto- ADPase
activities were retained in the P2Y1-NTPDase1
fusion protein, membrane preparations from intact CHO-K1 cells
expressing wild-type NTPDase1 or P2Y1-NTPDase1 fusion protein were prepared and incubated with exogenous ADP or ATP as
described under Materials and Methods. Relatively little hydrolytic activity against ADP (5 nmol
Pi/min/mg) was observed under these assay
conditions in membranes prepared from wild-type CHO-K1 cells. We
anticipate that even this low activity comes primarily from
intracellular nucleotidases in the membrane preparation. In contrast,
hydrolytic activity against ADP in membranes from P2Y1-NTPDase1 expressing cells was 381 ± 79 nmol of Pi/min/mg (mean ± S.D.;
n = 4), whereas the wild-type NTPDase1-expressing cells
exhibited an activity of 398 ± 24 nmol of
Pi/min/mg (n = 4). Similarly,
whereas little hydrolytic activity was observed under these assay
conditions in membranes from wild-type cells, large hydrolytic
activities against ATP were observed in membranes from
P2Y1-NTPDase1 fusion protein-expressing (951 ± 76 nmol/min/mg; n = 4) and wild-type
NTPDase1-expressing (1015 ± 48 nmol/min/mg; n = 4) cells (Fig. 3). The substrate
selectivity of the ectonucleotidase fused to the
P2Y1 receptor was essentially identical to that
observed in the wild-type NTPDase1, with both proteins hydrolyzing
nucleoside triphosphates and nucleoside diphosphates with a 1:0.4
molecular ratio (Table 1).
|
|
|
Signaling Properties of the P2Y1 Receptor Fused to
NTPDase1.
To determine whether P2Y1 receptor
signaling properties were retained in the
P2Y1-NTPDase1 fusion protein, we measured
intracellular Ca2+ responses in intact CHO-K1
cells stably expressing the fusion protein. Although carbachol, acting
through an endogenous muscarinic receptor, promoted a marked
Ca2+ response in empty vector-transfected cells,
no response to ADP or 2MeSADP was observed. In contrast, both
diphosphate agonists produced robust responses in
P2Y1 receptor- and
P2Y1-NTPDase1 fusion protein-expressing cells
(Fig. 5). Thus, the G protein-coupled receptor component of the fusion protein is appropriately inserted into
the plasma membrane, and the observed responses to adenine diphosphates
are representative of those observed for activation of the wild-type
P2Y1 receptor observed in many other systems. These results also are consistent with those obtained with this (Vöhringer et al., 2000
) and other G protein-coupled receptors fused to different proteins, such as green fluorescent protein (Kallal
and Benovic, 2000
).
|
Relationship Between Ectonucleotidase Activity and P2Y1
Receptor Activation in the P2Y1-NTPDase1 Fusion
Protein.
To determine whether the catalytic presence of NTPDase1
in the fusion protein altered the capacity of agonists to activate the
P2Y1 receptor, we carried out a detailed
comparison of the activities of ADP and the nonhydrolyzable ADP analog,
ADP
S, using activation of phospholipase C as a proximal measure of
receptor activity. As illustrated in Fig.
6, the capacity of ADP
S to maximally promote inositol phosphate accumulation was similar between cells expressing the wild-type P2Y1 receptor and cells
expressing the P2Y1 receptor fused to NTPDase1.
The EC50 of ADP
S for activation of the
P2Y1-NTPDase1 fusion protein was 150 ± 28 nM (n = 4 experiments), whereas the
EC50 of ADP
S for stimulation of the wild-type
P2Y1 receptor was 530 ± 198 nM
(n = 4 experiments). Thus, the
P2Y1 receptor fused to NTPDase1 was at least as
effective as the wild-type receptor for activation of downstream
signaling responses. In contrast to the results obtained with the
nonhydrolyzable analog, the natural agonist ADP was 60-fold less potent
in cells expressing the P2Y1-NTPDase1 fusion
protein (EC50 = 10 ± 4 µM;
n = 4 experiments) than in cells expressing the
wild-type P2Y1 receptor
(EC50 = 0.17 ± 0.06 µM; n = 4 experiments) (Fig. 6). Thus, nucleotide-hydrolytic activity
contributed by the ADPase activity of NTPDase1 in the fusion protein
has remarkable functional consequences on the stimulatory activity of
the cognate agonist of the P2Y1 receptor.
|
Loss of Basal Signaling Activity in the P2Y1-NTPDase1 Fusion
Protein.
Heterologous expression of the P2Y1
receptor (Filtz et al., 1994
; Schachter et al., 1996
) or other P2Y
receptors (Lazarowski et al., 1995
; Boyer et al., 1997
) typically
results in an increase in basal inositol phosphate levels. Although
such a result could follow from constitutive phospholipase
C-stimulating activity of the expressed receptor, a more plausible
explanation follows from the observation that basal or constitutive
release of nucleotides occurs from many cell types (Lazarowski et al.,
2000
, 2001
; Ostrom et al., 2000
). A role for released nucleotides in
the cellular response to expressed P2Y receptors is supported by the
observations from several studies (Lazarowski et al., 1995
, 1997
; Boyer
et al., 1997
; Watt et al., 1998
; Ostrom et al., 2000
) that addition of
apyrase to the medium reduces, but does not eliminate, the elevation of
inositol phosphate levels after receptor expression. A major reason for
the construction of a fusion protein of the P2Y1
receptor and NTPDase1 was to address more directly the role of released
nucleotide in the elevation of inositol phosphates that occurs during
heterologous expression of the P2Y1 receptor in
the absence of added agonist. As illustrated above, the response to the
nonhydrolyzable nucleotide, ADP
S, of the
P2Y1-NTPDase1 fusion protein was at least as
great as that of the wild-type receptor, whereas the
concentration-effect curve of ADP for stimulation of inositol phosphate
accumulation was shifted to the right by greater than 50-fold. Thus,
the P2Y1 receptor fusion protein seems to be
similarly active to the wild-type receptor, but the tethering of
nucleotidase activity to the receptor makes it much less responsive to
ADP added to the bulk medium. Given these results, we compared basal
levels of inositol phosphates in cells expressing the
P2Y1-NTPDase1 fusion protein versus cells
expressing the wild-type P2Y1 receptor. Similar
amounts of immunoreactive protein and similar maximal levels of
2MeSADP-stimulated inositol phosphate accumulation were observed with
the wild-type receptor versus the P2Y1
receptor/NTPDase1 fusion protein, suggesting that equivalent levels of
active receptor were expressed under each condition. As illustrated in
Fig. 7, the basal accumulation of
[3H]inositol phosphates in cells expressing the
wild-type P2Y1 receptor was markedly higher than
accumulation in cells expressing the P2Y1-NTPDase1 fusion protein. These elevated
levels of inositol phosphates in cells expressing wild-type
P2Y1 receptor were even higher (by approximately
2-fold) if 10 mM LiCl was added to the medium for 20 min to inhibit
inositol phosphate breakdown. Although addition of a maximally
effective concentration of apyrase partially reduced the elevated
levels of [3H]inositol phosphates in
P2Y1 receptor-expressing cells, levels remained
significantly elevated above that observed in wild-type CHO-KI cells.
In contrast to the results obtained with expression of the wild-type
P2Y1 receptor, expression of the
P2Y1-NTPDase1 fusion protein did not result in
elevated [3H]inositol phosphate levels compared
with wild-type CHO-KI cells, and addition of apyrase had no effect.
Furthermore, addition of 10 mM LiCl to the medium did not result in a
reproducible increase in [3H]inositol phosphate
levels in P2Y1-NTPDase1-expressing cells (Fig.
7). Taken together, these observations strongly support the idea that
basally released nucleotide accounts for the increase in basal
activation of phospholipase C in P2Y receptor-expressing cells.
Moreover, they indicate that no basal signaling responses occur with
expression of the P2Y1-NTPDase1 fusion protein.
|
| |
Discussion |
|---|
|
|
|---|
The P2Y1-NTPDase1 fusion protein studied here retained the signaling properties of the native P2Y1 receptor and the catalytic properties of the native ectoenzyme. Cellular expression of this P2Y1 receptor in a form tethered with a nucleotide-hydrolyzing enzyme reduced the apparent potency of ADP for stimulation of phospholipase C by over 50-fold, without reducing the potency of a nonhydrolyzable agonist. Moreover, no basal signaling responses occurred with expression of the P2Y1-NTPDase1 fusion protein. These results indicate that we have engineered a modified P2Y receptor that, when expressed in a cellular context, is activated less favorably by hydrolyzable nucleotides but retains full responsiveness to exogenous agonists that are resistant to the action of the nucleotidase.
The P2Y receptor family of signaling proteins is essentially
ubiquitously expressed on nonexcitatory cells, such as fibroblasts and
hepatocytes, as well as endothelial, epithelial, glial, and smooth
muscle cells (Dubyak and El-Moatassim, 1993
; Harden et al., 1995
;
Ralevic and Burnstock, 1998
). The source of nucleotide regulating these
receptors has not been unambiguously established. Although ATP is
released in a Ca2+-dependent manner from neurons
and other excitatory cells, paracrine/autocrine stimulation of P2Y
receptors by nucleotide released from nonexcitable cells probably
provides the predominant form of regulation of these receptors. Many if
not most cell types release nucleotides as a consequence of mechanical
stimulation [e.g., shear stress, hypotonic swelling, stretch, or other
physical stimuli (Dubyak and El-Moatassim, 1993
; Lazarowski et al.,
1995
, 1997
, 2001
; Schlosser et al., 1996
; Grygorczyk and Hanrahan,
1997
; Lazarowski and Harden, 1999
)].
Extracellular ATP and other nucleotides also are characteristically
present under resting cell conditions. Indeed, basal or "constitutive" release of ATP has been illustrated to occur with several cell types (Lazarowski et al., 2000
, 2001
; Ostrom et al., 2000
), and extracellular levels of nucleotides at rest reflect a steady
state in which the extent of basal release is balanced by the extent of
nucleotide hydrolysis. Nucleotide release occurring as a consequence of
mechanical stimulation (e.g., a change of medium) has been shown to
contribute to the elevated inositol phosphate levels found associated
with overexpression of several different P2Y receptor subtypes.
Similarly, signaling activities of P2Y receptors observed under
conditions that were carefully controlled to reduce any contribution of
stimulated release of nucleotide may involve contribution of receptor
activation occurring as a consequence of basally released nucleotide.
For example, addition of apyrase or hexokinase to resting P2Y
receptor-expressing 1321N1 cells resulted in a decrease in the basal
level of inositol phosphates (Lazarowski et al., 1995
, 1997
; Boyer et
al., 1997
; Watt et al., 1998
; Ostrom et al., 2000
), suggesting that
local nucleotide levels were sufficient to promote a basal activity of
these receptors. Indeed, these and other studies suggest that quantification of the bulk concentration of nucleotides considerably underestimates the nucleotide mass that accumulates transiently at the
level of the P2Y receptor on the cell surface. Dubyak and colleagues
(Beigi et al., 1999
) used cell surface-bound luciferase to illustrate
that ATP concentrations in the bulk medium of thrombin-stimulated platelets underestimated concentration at the cell surface by at least
10-fold.
Results obtained with the P2Y1 receptor-NTPDase1 fusion protein studied here illustrate that, by fixing a P2Y receptor in one-to-one apposition with its related agonist-metabolizing nucleotidase, basal activation of phospholipase C no longer occurs, although the receptor remains fully responsive to added nonhydrolyzable agonists. Thus, we conclude that the enhanced basal activity previously observed with overexpression of the P2Y1 receptor followed from constitutive or mechanically induced release of nucleotide rather than through any constitutive activity of the receptor per se. Interestingly, we have not observed any elevation of inositol phosphate levels by expression of the P2Y1 receptor/NTPDase1 fusion protein to high levels under a number of conditions. In contrast, expression of the wild-type P2Y1 receptor resulted in elevation of inositol phosphates under all of the conditions we have studied. Moreover, although addition of apyrase resulted in a decrease in inositol phosphate levels in P2Y1 receptor-expressing cells, conditions have not been identified under which addition of a maximally effective concentration of apyrase consistently reversed elevated levels completely to basal levels. These observations lead us to speculate that nucleotide is released in close apposition to the P2Y1 receptor such that high concentrations of apyrase in the bulk medium fail to access the nucleotide, and therefore, fail to fully prevent receptor activation.
The large differences in ADP concentration-effect curves for the wild-type P2Y1 receptor versus P2Y1 receptor fusion protein were observed in 15-min assays of inositol phosphate accumulation. In contrast, in preliminary experiments, little difference in ADP concentration-effect curves was observed between the wild-type P2Y1 receptor and P2Y1 fusion protein in rapid (i.e., 1-2 s) measurements of ADP-promoted Ca2+ mobilization. The physiological significance of rapid Ca2+ measurements after addition of agonist to the bulk solution of a cultured cell is uncertain, because endogenous release of nucleotides occurs into a limited pericellular space in predictable close proximity to nucleotide-hydrolyzing enzymes, which may have dramatic effects on agonist concentration. Thus, our results are of clear relevance to physiological responses (i.e., cell growth and proliferation) that occur downstream to sustained release of nucleotides, and given the realities of a small pericellular space, also are probably relevant to acute responses to nucleotides in vivo.
The cellular architecture of the proteins responsible for signaling
responses promoted by extracellular nucleotides has not been
established. The P2Y receptors individually exhibit strict agonist
selectivity among nucleotides, with some of these receptors activated
by triphosphates and others by diphosphates, and with only the
P2Y2 receptor not exhibiting absolute specificity
for either adenine or uridine nucleotides (Harden et al., 1998b
). Thus,
ectonucleotidases, nucleoside diphosphokinase, and potentially, other
ectoenzymes carry out enzymatic reactions that inactivate the agonist
for certain P2Y receptors while coincidentally producing the cognate
agonist for another P2Y receptor. We envision that the cellular levels
of individual P2Y receptors are tightly coordinated with the expression
of the enzymes important for nucleotide metabolism and interconversion.
Similarly, although the mechanism(s) of basal and regulated release of
nucleotides from nonexcitable cells remains undefined, structures
responsible for this process also may lie in close apposition to the
receptors responding to the released nucleotides as well as to the
important metabolic enzymes (Huang et al., 2001
). NTPDdase1 is
associated with caveolae (Kittel et al., 1999
; Koziak et al., 2000
),
and thus caveolae, lipid rafts, or similar domain-defining
macromolecular structures may play critical roles in organizing
nucleotide-promoted signaling processes. The P2Y1
receptor contains a strong PDZ domain-binding motif at its carboxy
terminus, and multiprotein scaffolding of the receptor with other
components of the nucleotide signaling apparatus can be envisioned.
An ectoenzyme on a target cell potentially could regulate an associated
P2Y receptor through a receptor-mediated process. For example,
ecto-ATPase converts ATP to ADP, the cognate agonist of the
P2Y1 receptor. Thus, constitutive release of ATP
in the presence of ecto-ATPase may result in extracellular ADP
concentrations that both activate the P2Y1
receptor as well as cause a time-dependent down-regulation of the
receptor. In turn, a relatively constant basal signaling response might
occur, whereas the maximally attainable response to ADP is blunted by
receptor desensitization. In a cell lacking ecto-ATPase, the
P2Y1 receptor would not promote a "basal" signal upon release of cellular ATP but would respond more robustly to
increases in extracellular ADP. We speculate that a similar phenomenon
accounts for the 3-fold decrease in EC50 observed
for ADP
S at the P2Y1-NTPDase fusion protein
relative to the wild-type P2Y1 receptor. That is,
the presence of the ectoapyrase in one-to-one stoichiometry with the
receptor in the fusion protein substantially reduces the basal
concentration of ADP at the level of the receptor. Thus, whereas basal
down-regulation of the wild-type P2Y1 receptor occurs, this is not the case (or is less so) for the receptor in the
fusion protein, which is "protected" from ADP by its metabolic enzyme. It will be important to establish whether the opposite holds
true for a P2Y1 receptor fused with NTPDase2
(ecto-ATPase) rather than with NTPDase1. That is, we hypothesize that
fusion with ecto-ATPase will result in substantial production of the cognate agonist (i.e., ADP) for the P2Y1
receptor. Construction of such a P2Y1
receptor-ATPase fusion protein is underway to test this idea.
In summary, we have introduced a fusion protein that places the P2Y1 receptor in intimate association with an enzyme that hydrolyzes its activating agonist. This protein apparently retains the full function of both component proteins and was used to illustrate that the basal activity previously observed upon expression of the P2Y1 receptor, and probably other P2Y receptors, occurred as a consequence of released cellular nucleotide. Thus, the P2Y1 receptor-NTPDase1 should prove highly useful for studying the biology of the P2Y1 receptor under conditions where its activated state can be precisely regulated by exogenous addition of nonhydrolyzable agonists.
| |
Acknowledgments |
|---|
We are indebted to Dr. Eduardo Lazarowski for many helpful discussions and for comments on the manuscript, Katie Radick for assistance in the Ca2+ measurements, and David Rinker for help in preparing the manuscript.
| |
Footnotes |
|---|
Received March 15, 2002; Accepted June 10, 2002
This work was supported by U.S. Public Health Service grants HL54889, GM38213, and HL34322. C. A-C. was supported by a fellowship from Fondo Nacional de Ciencia, Tecnología e Innovación, Caracas, Venezuela.
Address correspondence to: T. K. Harden, Department of Pharmacology, University of North Carolina School of Medicine, Chapel Hill, NC 27599. E-mail: tkh{at}med.unc.edu
| |
Abbreviations |
|---|
NTPDase, ectonucleoside triphosphate
diphosphohydrolase;
2MeSADP, 2-methylthio-ADP;
ADP
S, adenosine-5'-O-(2-thiodiphosphate);
PCR, polymerase
chain reaction;
CHO, Chinese hamster ovary.
| |
References |
|---|
|
|
|---|
channels in pigmented ciliary epithelial cells.
Am J Physiol Cell Physiol
281:
C1614-C1623This article has been cited by other articles:
![]() |
C. Alvarado-Castillo, T. K. Harden, and J. L. Boyer Regulation of P2Y1 Receptor-Mediated Signaling by the Ectonucleoside Triphosphate Diphosphohydrolase Isozymes NTPDase1 and NTPDase2 Mol. Pharmacol., January 1, 2005; 67(1): 114 - 122. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. L. Waldo, J. Corbitt, J. L. Boyer, G. Ravi, H. S. Kim, X.-d. Ji, J. Lacy, K. A. Jacobson, and T. K. Harden Quantitation of the P2Y1 Receptor with a High Affinity Radiolabeled Antagonist Mol. Pharmacol., November 1, 2002; 62(5): 1249 - 1257. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||