![]() |
|
|
Vol. 62, Issue 5, 1119-1127, November 2002
Departments of Pharmacology (R.A.A., B.R.J., B.B.W., R.P.Y.) and Physiology (Z.F., S.V.), Interdisciplinary Program in Neuroscience (R.A.A., S.V., B.B.W., R.P.Y.), Georgetown University Medical Center, Washington DC
| |
Abstract |
|---|
|
|
|---|
The NR3A subunit of the N-methyl-D-aspartate receptor has been shown to form glutamatergic receptor complexes with NR1 and NR2 subunits and excitatory glycinergic receptor complexes with NR1 alone. We developed an antibody to NR3A and, using quantitative immunoblotting techniques, determined the degree of association between the NR3A subunit and the NR1 and NR2 subunits as well as changes in these associations during development. NR3A expression peaks between postnatal days 7 and 10 in the cortex, midbrain, and hippocampus and reaches higher maximal expression levels in these areas than in the olfactory bulb and cerebellum. Immunoprecipitation experiments with an anti-NR1 antibody demonstrated that the majority of NR3A is associated with NR1 in postnatal day 10 rat cortex (80 ± 8%), decreasing by half (38 ± 4%) in the adult rat cortex. Using the anti-NR3A antibody in immunoprecipitation studies, we find that 9.7 ± 0.8% of NR1, 8.7 ± 1.8% of NR2A, and 5.0 ± 0.6% of NR2B are associated with NR3A at postnatal day 10. These values decrease by about half in adult rat cortex. The results of this study demonstrate that NR3A is expressed, distributed, and associated with other subunits in a manner that supports its role in synaptic transmission throughout the rat brain, perhaps playing different roles during development.
| |
Introduction |
|---|
|
|
|---|
The
glutamate receptor family mediates the majority of fast excitatory
synaptic transmission in the mammalian central nervous system. The
ionotropic glutamate receptors are divided pharmacologically into three
major groups: the N-methyl-D-aspartate
(NMDA) receptor (NMDAR), the
-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor, and
the kainate receptor. The NMDAR has received much attention because of
its involvement in neuronal development, a variety of neurodegenerative
diseases, and certain types of excitotoxicity (Dingledine et al., 1999
;
Cull-Candy et al., 2001
). A voltage-dependent magnesium block and
relatively high calcium permeability have implicated the NMDAR in a
mechanism thought to be critical for certain types of learning and
memory, namely long-term potentiation (McBain and Mayer, 1994
).
The NMDAR complex is a tetrameric or pentameric structure composed of
at least two NR1 subunits and two or three subunits from the NR2 family
(NR2A-D) (for review, see McBain and Mayer, 1994
; Dingledine et al.,
1999
). The NR1 subunit is expressed throughout the central nervous
system and is required for the formation of functional receptors. Three
alternatively spliced cassettes (for review, see Zukin and Bennett,
1995
) in NR1 determine various properties of the ion channel
(Dingledine et al., 1999
) and are spatio-temporally regulated (Laurie
and Seeburg, 1994
; Zhong et al., 1995
; Prybylowski and Wolfe, 2000
).
Similarly, each NR2 subunit confers upon the receptor different
functional properties (Monyer et al., 1992
), and its proper expression
is regulated temporally and spatially (Watanabe et al., 1992
; Ishii et
al., 1993
; Monyer et al., 1994
; Dunah et al., 1996
). The role of the
more recently identified NR3 family of subunits (NR3A and NR3B)
(Ciabarra et al., 1995
; Sucher et al., 1995
; Sun et al., 1998
; Hayashi
et al., 2000
; Chatterton et al., 2002
; Matsuda et al., 2002
) has yet to be clearly determined. Two functions have been identified: first, incorporation of an NR3 subunit into NR1/NR2 receptor complexes results
in an NMDAR of decreased functionality (Ciabarra et al., 1995
; Sucher
et al., 1995
; Das et al., 1998
; Pérez-Otaño et al., 2001
);
second, an NR1/NR3 excitatory glycinergic receptor channel has more
recently been identified (Chatterton et al., 2002
).
Regulation of the expression of the various NMDAR subunits is critical
in forming a receptor channel with the desired properties. Messenger
RNA studies on NR3A (previously named
-1 or NMDAR-L) and NR3B also
report spatial and temporal regulation (Ciabarra et al., 1995
; Sucher
et al., 1995
; Goebel and Poosch, 1999
; Sun et al., 2000
;
Nishi et al., 2001
; Chatterton et al., 2002
). Furthermore, a long
splice variant form of NR3A has been identified (NR3A-l), exhibiting an
overlapping but unique mRNA expression pattern relative to the short
splice variant form (NR3A-s) (Sun et al., 1998
).
Reports that the NR3A subunit is enriched at the postsynaptic density
and coimmunoprecipitates with NR1 and NR2B (Das et al., 1998
) suggest a
role for the subunit at the synapse. Direct evidence for a role in
synaptic transmission in vivo comes from NR3A knock-out mice in which
the NMDA-induced current density in cerebrocortical cells was found to
be 2.8-fold greater than in wild-type cells (Das et al., 1998
).
Furthermore, the cells were morphologically altered and had a greater
number of dendritic spines. These findings are supported by functional
studies in Xenopus laevis oocytes reporting a decrease in
the current amplitude when NR3A is cotransfected with NR1, or NR1 and
NR2B or NR2D (Ciabarra et al., 1995
; Sucher et al., 1995
). Moreover,
single-channel recordings in X. laevis oocytes and human
embryonic kidney (HEK) 293T cells reported a smaller unitary
conductance, altered mean open time, and 5-fold lower calcium
permeability when NR1 and NR2A are coexpressed with NR3A (Das et al.,
1998
; Pérez-Otaño et al., 2001
; Chatterton et al., 2002
).
Finally, cotransfection of NR3B, which is restricted to motor neurons
of the spinal cord and the brainstem (Nishi et al., 2001
; Chatterton et
al., 2002
), with NR2A and NR1 altered the magnesium sensitivity of the
NMDAR (Chatterton et al., 2002
).
The NR3A and NR3B subunits act as dominant negative regulators of the NMDAR current and have been shown to alter the two most prominent properties of the NMDAR: calcium permeability and magnesium sensitivity. Although this suggests that NR3A may play an important regulatory role, much work remains to be done on the function of the subunit in vivo. We developed an antibody to NR3A and set out to determine the association of NR3A with the other NMDA receptor subunits as well as the regional and developmental expression of NR3A in rat brain. To begin to investigate the role of NR3A, immunoprecipitation experiments were conducted to determine the levels of NR3A associated with other NMDAR subunits from P10 and adult rat cortex and, importantly, the amounts of NR1 and NR2 associated with NR3A.
| |
Materials and Methods |
|---|
|
|
|---|
Antibody Production and Affinity Purification.
An antibody
against the peptide CSRKTELEEYQKTNR was made based on the report by
Ciabarra and Sevarino (1997)
. This peptide corresponds to the amino
acids 1098 to 1111 (sequence 17 to 4 amino acids upstream of the
carboxyl terminus of NR3A). The peptide, coupled to keyhole limpet
hemocyanin (KLH), was synthesized by Research Genetics (Huntsville,
NJ). Two rabbits were immunized by Lampire Biologicals (Pipersville,
PA) subcutaneously with 0.2 mg of KLH-peptide conjugate in Complete
Freund's adjuvant and boosted 1 and 2 weeks later with 0.2 mg of
KLH-peptide conjugate in Incomplete Freund's adjuvant. This was
followed by the first test bleed 2 weeks later. After this time,
immunizations and production bleeds were alternated every 2 weeks.
Purification of Total RNA. Rat occipital cortex, midbrain, and olfactory bulb were harvested from rats on P7. For every 100 µg of tissue, 1 ml of TRIzol (Invitrogen, Carlsbad, CA) was added. The tubes were incubated at 30°C for 1 min, vortexed, and incubated at 30°C for 5 min. Chloroform was added at 200 µl per 1 ml of TRIzol and shaken vigorously by hand for 15 s. The solution was incubated at room temperature for 3 min and centrifuged at 7800gmax in a Sorvall microcentrifuge for 15 min at 4°C. The aqueous phase was transferred to a fresh tube, and 500 µl of isopropyl alcohol was added (per 1 ml of original TRIzol). The solution was mixed and centrifuged at 7800gmax for 10 min at 4°C. The supernatant was discarded, and 1 ml of 75% ethanol (per milliliter of original TRIzol) was added. The sample was centrifuged at 3800gmax for 5 min at 4°C, the supernatant was discarded, and the tube was inverted continuously for 10 min. The RNA was then resuspended in DEPC-treated water, and the RNA concentration was determined based on the absorbance at 260 nm.
Production of NR3A Long Construct.
Primers corresponding to
bases 2829 to 2845 (CATCATCCTTCTCAAGG) and 3804 to 3822 (AAAGGGCCCTAGGAATTCACAAGTCCG) (GenBank accession number AF073379) and
containing EcoNI and ApaI sites, respectively, were synthesized by Invitrogen. The RNA samples purified from rat brain
were reverse transcribed and the cDNA amplified using a SuperScript II
kit (Invitrogen) according to the manufacturer's instructions. Thirty
cycles were set at 94°C for 15 s, 55°C for 15 s, and
72°C for 2 min, with a final 72°C incubation for 10 min, followed
by a 4°C incubation overnight. Both the PCR product and the NR3A
short construct were digested using EcoNI and
ApaI and separated on a 1.2% agarose gel. The appropriate
bands were excised, purified by the gel extraction kit (QIAGEN,
Valencia, CA), ligated using T4 DNA Ligase, and transformed into DH5
competent cells (Invitrogen). The construct was purified using the
QIAPrep Miniprep Kit (QIAGEN) and digested with SapI to
confirm the presence of the insert. The DNA was then sequenced for verification.
Cell Transfection and Crude Membrane Preparation.
Dishes
(100 mm) of HEK293 cells (Invitrogen) were transfected and harvested as
described previously(Al-Hallaq et al., 2001
). Protein concentrations
were determined using the bicinchoninic acid method (Pierce). The
NR1011 and NR2A cDNAs were a gift of Dr. S. Nakanishi (Kyoto University, Japan) and were ligated into pcDNA I/AMP,
as described previously (Wang et al., 1995
). NR2B pRK5 was a gift of
Dr. R. Huganir (Johns Hopkins University, Baltimore, MD). NR2C was a
gift of Dr. S. Heinemann (Salk Institute, La Jolla, CA) and was ligated
into pcDNA I/Amp. NR2D pCDM8 was a gift of Dr. P. Seeburg (Max-Planck
Institute, Heidelberg, Germany). NR3A pBK was a gift of Dr. S. Lipton
(Burnam Institute, La Jolla, CA). HA-NR3B pTrace was a gift from Dr. M. Yuzaki (St. Jude Children's Research Hospital, Memphis, TN). This NR3B
construct is tagged with a hemagglutinin epitope at the carboxyl
terminus. Fyn kinase (fyn) pBK was a gift of Dr. S. Swope (Georgetown
University Medical Center, Washington, DC).
70°C. For
immunoblots, samples were thawed for 2 min in a 37°C water bath and
sonicated. One volume of 4× treatment buffer (0.25 M Tris-HCl, pH 6.8, 8% SDS, 200 mM dithiothreitol, 30% glycerol) was added to three
volumes of sample, and the resulting samples were placed in a boiling water bath for 5 min and divided into aliquots for immunoblotting.
Coupling of Antibodies to Protein A Sepharose Beads.
Protein
A Sepharose CL-4B beads (Sigma, St. Louis, MO) were washed three times
in 1 ml of 0.2 M sodium borate, pH 8.0. Beads were then incubated with
antibodies to either anti-NR1 (Luo et al., 1997
) or anti-NR3A in a 1:2
ratio of micrograms of antibody to microliters of beads at room
temperature for 1 h with constant rotation, followed by three
washes in 1 ml of immunoprecipitation buffer (0.1% Triton X-100 and 50 mM Tris-HCl, pH 7.4) and centrifugation between each wash at
7800gmax for 15 s.
Solubilization and Immunoprecipitation. Membrane fractions from transfected HEK293 cells, P10 cortex, or adult cortex were diluted in TFEE buffer to 1 mg of total protein per milliliter. For every 100 µl of membrane preparation, 10 µl of deoxycholate (DOC) stock (10% DOC, 500 mM Tris-HCl, pH 9) was added, and the solution was incubated at 37°C for 30 min with regular mixing by inversion. After incubation, 10 µl of solution (containing 1% Triton X-100, 500 mM Tris-HCl, pH 9, and 1% DOC) was added for each 100 µl of original sample, and the solution was centrifuged at 30,000gmax for 30 min. For each reaction, 20 µl of washed protein A Sepharose beads coupled to anti-NR1 or anti-NR3A antibody (see above) in 102 µl of immunoprecipitation buffer (0.1% Triton X-100 and 50 mM Tris-HCl, pH 7.4) was added to 48 µl (40 µg) of solubilized protein to a final volume of 150 µl. After this incubation with constant rotation at 4°C for 2 h, samples were centrifuged at 7800gmax for 15 s, the supernatant (150 µl) was removed and added to 50 µl of 4× treatment buffer. The pellets were washed three times in 1 ml of immunoprecipitation buffer, and the beads were brought up in 75 µl of immunoprecipitation buffer and 25 µl of 4× treatment buffer and boiled. Supernatant and pellet samples were loaded onto 7.5% SDS-polyacrylamide gels and subjected to electrophoresis.
Immunoblotting.
Immunoblotting was carried out as described
previously (Al-Hallaq et al., 2001
) with the following modifications.
Standard curves using membranes prepared either from HEK293 cells
transfected with NR3A cDNA or adult rat cortex were loaded at 1.6-fold
dilutions. Immunoblots were probed with anti-NR3A or with Pan NR1,
NR2A, and NR2B antibodies, which have been previously characterized in
this laboratory (Wang et al., 1995
; Luo et al., 1997
). To recognize the
HA-NR3B, the anti-hemagglutinin mouse monoclonal antibody, 12CA5, was
purchased from Roche Molecular Biochemicals (Indianapolis, IN).
SuperSignal West pico chemiluminescent and West femto maximum sensitivity substrates were obtained from Pierce.
Peptide Blockade of the NR3A Antibody. The CSRKTELEEYQKTNR and CRVEKRSNLGPQQ peptide affinity resins were used to demonstrate the specificity of the NR3A antibody. Ten micrograms of the affinity-purified NR3A antibody in 350 µl of binding buffer and 150 µl of either the CSRKTELEEYQKTNR or the CRVEKRSNLGPQQ peptide affinity resin were incubated at 22°C with rotation (30 rpm) for 2 h in a microcentrifuge tube. Each tube was centrifuged for 15 s at ~8000g and the supernatant was transferred to another tube. The resin pellets were washed 2× with 325 µl of Tris-buffered saline/Tween 20 (50 mM Tris-HCl, pH 7.6, 137 mM NaCl, and 0.1% Tween 20). The washes were pooled with the initial supernatant for each peptide affinity resin. Two hundred and fifty microliters of each was added to 25 ml of Tris-buffered saline/Tween 20 with 5% nonfat dried milk to make a antibody concentration of about 1 µg/ml if no antibody bound to the peptide affinity resin.
| |
Results |
|---|
|
|
|---|
Anti-NR3A Specifically Recognizes NR3A.
An antibody was raised
to a peptide sequence four amino acids upstream of the carboxyl
terminus of NR3A. HEK293, P7 cortex, and P7 thalamus membrane fractions
were used to test the specificity of the NR3A antibody. Lanes 5 to 16 of Fig. 1 show an immunoblot probed with
the affinity-purified anti-NR3A antibody at 1 µg/ml and developed
with the SuperSignal West pico chemiluminescent substrate. A band was
detected at the size expected for the glycosylated form of NR3A (135 kDa) (Ciabarra and Sevarino, 1997
) only in those lanes containing
HEK293 cells transfected with the short (NR3A-s) or long (NR3A-l)
splice variant form cDNA. Cells transfected with an unrelated protein,
fyn kinase, or the NMDAR NR1 or NR2 cDNA show no signal at the expected
molecular mass. This was true even when the more sensitive
SuperSignal West femto was used (data not shown). Parallel immunoblots
were probed with antibodies to NR1, NR2A, NR2B, and fyn kinase to
verify the expression of these subunits (data not shown). Membrane
fractions from P7 thalamus (lane 15) and cortex (lane 16) were
immunopositive at 135 kDa, as expected from previous studies (Ciabarra
and Sevarino, 1997
). The molecular mass of NR3A does not seem to differ
in HEK293 cells and in P7 brain, suggesting that NR3A is glycosylated
in HEK293 cells, as reported previously (Ciabarra and Sevarino, 1997
).
|
|
Developmental and Regional Expression of NR3A.
To determine
the spatial and temporal expression patterns of NR3A, a series of
immunoblotting experiments with membrane fractions from various rat
brain regions at varying ages was carried out. The signal was
quantified relative to a standard curve in which membranes from HEK293
cells transfected with NR3A-s were loaded at 1.6-fold dilutions as
described previously by Wang et al. (1995)
.
|
NR3A Associates with the NR1 Subunit. The assembly of NMDAR subunits into a heteromeric receptor is required for the formation of a functional receptor channel. For NR3A to have a functional effect, it presumably must be associated with other NMDAR subunits. To determine the level of NR3A associated with other NMDAR subunits, we carried out a series of nondenaturing immunoprecipitation experiments. After membrane fractions were gently solubilized, the protein complex was immunoprecipitated with either antibodies to NR1 or NR3A to determine the level of associated subunits.
P10 and adult cortical membrane preparations were immunoprecipitated using protein A-Sepharose beads noncovalently coupled to anti-NR1 antibody. Although immunoprecipitations with covalently coupled anti-NR1/protein A-Sepharose beads were attempted, a high background signal resulted when the immunoblots were probed with the anti-NR3A antibody. Therefore, the anti-NR1 antibody was noncovalently coupled to protein A-Sepharose beads. However, the maximum immunoprecipitation efficiency of total NR1 that could be achieved with noncovalently coupled anti-NR1/protein A-Sepharose beads was 60 ± 2% (mean ± S.E.M.) in P10 and 70 ± 1% in adult. In this case, 40 ± 1% of NR2A, 52 ± 4% of NR2B, and 48 ± 4% of NR3A were pulled down with the NR1 subunit in P10 cortex. In the adult cortex, 45 ± 2% of NR2A, 49 ± 2% of NR2B, and 26 ± 3% of NR3A were pulled down with NR1. To determine the amount of NR2 and NR3A subunits that would have been pulled down with NR1 had the anti-NR1 antibody pulled down all NR1 subunits present in the samples, the NR1 immunoprecipitation efficiency was normalized to 100%. Thus, the percentages of NR2A, NR2B, and NR3A pulled down in these experiments were divided by the fraction of NR1 precipitated in P10 (0.6) or adult (0.7) tissue, resulting in a calculated estimate of the percentage of NR2A, NR2B, or NR3A associated with NR1 in the tissue. P10 cortex (Fig. 4B,
) yielded values of 68 ± 4%
of NR2A and 88 ± 7% of NR2B associated with NR1. Adult cortex
(Fig. 4B,
) resulted in corrected values of 65 ± 2% of NR2A
and 70 ± 4% of NR2B associated with NR1. These corrected values
are similar to our previously reported values of 56 ± 7% of NR2A
and 75 ± 5% of NR2B associated with NR1 in experiments in which
anti-NR1 was covalently coupled to protein A-Sepharose beads resulting
in 100% precipitation of NR1 (Luo et al., 1997
|
The Anti-NR3A Antibody Pulls down Other NMDAR Subunits.
Whereas the data presented in Fig. 4 are levels of NR2 and NR3A
associated with the NR1 subunit, the levels of NR1 and NR2 subunits
associated with the NR3A subunit remain to be determined. First, to
verify the specificity of the NR3A antibody in immunoprecipitation experiments, we used the antibody to immunoprecipitate solubilized membrane preparations from HEK293 cells transfected with NR1 and NR2
subunits with or without the NR3A subunit (Fig.
5). The SuperSignal West femto was used
to detect the signal in the pellets in immunoblots probed with
anti-NR3A. In the supernatants, bands for NR3A (as indicated by the
arrows) are seen only in those cells transfected with NR3A cDNA (Fig.
5, top left). Nonspecific bands are seen in lanes 1 and 4 (as seen
above the arrows). Similarly, in the pellets, NR3A signal is detected
only in cells transfected with NR1/NR2A/NR3A or NR1/NR2B/NR3A (Fig. 5,
top right).
|
|
| |
Discussion |
|---|
|
|
|---|
We have developed a rabbit polyclonal antibody that is specific for the NR3A subunit. In this investigation, it has been used to examine the expression pattern as well as the association of NR3A with the other NMDAR subunits in various brain regions throughout development. We found that expression in the forebrain peaks between P7 and P10, although it is less pronounced and differs temporally in other brain regions. In young animals, the majority of the NR3A subunit was associated with the NR1 subunit, indicating that the subunit is highly coassembled in the receptor complex. Conversely, a smaller fraction of total NR1, NR2A, and NR2B were associated with NR3A.
This polyclonal antibody shows no cross-reactivity with other NR1 or
NR2 subunit (Fig. 1, lanes 7-10). Importantly, it also shows no
cross-reactivity with the NR3B subunit (Fig. 1, compare lanes 1 and 4),
which has 62% homology with the NR3A subunit (Matsuda et al., 2002
).
Also, the immunizing peptide can block the immunoreactive band at 135 kDa in HEK293 cells transfected with NR3A. However, preincubation of
the NR3A antibody with another nonrelated peptide does not affect the
presence of the immunoreactive band at 135 kDa. Therefore, this
polyclonal antibody seems specific for the NR3A subunit.
Our finding that NR3A protein expression peaks between P7 and P10 in
the cortex, midbrain, and hippocampus is consistent with previous
reports on NR3A mRNA expression (Ciabarra et al., 1995
; Sun et al.,
1998
). In comparison with the expression patterns of the other NMDAR
subunits, NR3A expression most closely resembles that of NR2D in that
both subunits peak around P7 (Watanabe et al., 1992
; Monyer et al.,
1994
; Dunah et al., 1996
). In contrast, NR1 and NR2A-C increase with
developmental age and peak around the third postnatal week (Watanabe et
al., 1992
; Laurie and Seeburg, 1994
; Monyer et al., 1994
; Zhong et al.,
1995
). Significantly, however, whereas NR1, NR2B, and NR2C mRNA can be
detected by embryonic day 14 (NR1 and NR2B) or P1 (NR2C) (Watanabe et
al., 1992
; Monyer et al., 1994
), NR2A mRNA is not expressed until
around P7 and increases dramatically during the next 2 postnatal weeks
(Watanabe et al., 1992
; Williams et al., 1993
). This increase in
expression of NR2A results in a more rapid deactivation of the
NMDA-mediated synaptic current because of incorporation of this subunit
into synaptic NMDAR (Flint et al., 1997
; Kew et al., 1998
; Stocca and Vicini, 1998
; Rumbaugh and Vicini, 1999
; Tovar et al., 2000
).
Thus, at P7 to P10, a critical switch in the subunit composition of the
NMDAR begins with an up-regulation of the NR2A subunit and a decline in
NR3A and NR2D levels. The timing of the peak expression, as well as
previous reports demonstrating NR3-containing receptors exhibit a
decreased calcium permeability (Das et al., 1998
;
Pérez-Otaño et al., 2001
; Chatterton et al., 2002
), suggest that this subunit plays a role in early synaptic rearrangement by
causing a decrease in Ca+2 entry, similar to the
NR2A subunit. The resultant decrease in channel conductance (Ciabarra
et al., 1995
; Sucher et al., 1995
; Das et al., 1998
;
Pérez-Otaño et al., 2001
; Chatterton et al., 2002
) and
magnesium sensitivity (Chatterton et al., 2002
) of NR3-containing NMDAR
channels also supports this idea. Analogous to the NR2C- and
NR2D-containing receptors, which are implicated in the detection of low
synchronicity in the developing brain because of their resistance to
Mg+2 blockade relative to NR2A- and
NR2B-containing receptors (Monyer et al., 1992
, 1994
; Ishii et al.,
1993
), the NR3 subunits may also be involved in synaptic development
and maturation.
We found that the maximal expression level of NR3A is higher in the
hippocampus, cortex, and midbrain than in the olfactory bulb and
cerebellum. The reason for these differences may be that subunit
expression in the olfactory bulb and the cerebellum peaks prenatally.
Our findings are consistent with those reported by Ciabarra and
Sevarino (1997)
, in which NR3A proteins were shown to be expressed in
P7 rat cortex and thalamus. In their study, however, NR3A was not
detected in P7 cerebellum or striatum, perhaps because of a higher
threshold for detection. Thus, our findings suggest that NR3A may play
an important modulatory role throughout the brain.
Importantly, this study quantitates the association of NR3A with other
NMDAR subunits. We show that NR3A forms complexes containing NR1 and
NR2A or NR2B in rat cortex, as demonstrated previously (Das et al.,
1998
). The NR3A subunit is highly associated with NR1 at P10 (80 ± 8%), and this association decreases to 38 ± 4% in adult
cortex. These immunoprecipitation data suggest that although the
majority of NR3A is associated with the NMDAR complex, a small percentage of these complexes contain NR3A. It is possible that the
association of NR3A with NR1 in the adult cortex may be weaker than
that in P10 cortex and, therefore, more easily disrupted during the
solubilization and immunoprecipitation, resulting in lower levels of
NR3A being pulled down with NR1 because of experimental factors. The
spatial and temporal placement of the NR3A-containing NMDAR complexes
may be an important point of regulation at the synaptic level.
Furthermore, the temporal change in the amount of NR3A in the NMDAR
complex suggests that it plays distinct roles as a negative modulator
at the two times in development examined in this study.
A recent study reported that the NR3A and NR3B subunits form excitatory
glycinergic receptor channels when associated only with the NR1 subunit
(Chatterton et al., 2002
). This finding is consistent with a previous
study using heterologous systems in which NR1 and NR3A assemblies were
shown to reach the plasma membrane even in the absence of an NR2
subunit (Pérez-Otaño et al., 2001
); similarly, we were able
to show that NR3A coassembles with NR1 in HEK293 cells transfected with
only NR1 and NR3A (data not shown).
This article has demonstrated that the association of the NR3A subunit with other NMDAR subunits changed during development. Such changes seemed to be coordinated with other alterations that occured during synaptogenesis, such as the switch in NMDAR subunit composition. Changes in the ability of the NR3A subunit to negatively modulate the NMDAR complex or create a glycine-gated channel may underlie the importance of alterations in NR3A during development. Indeed, the presence of the NR3A subunit could play a pivotal role in whether or not a given synapse meets the necessary threshold to participate in long-lasting changes such as long-term potentiation.
| |
Acknowledgments |
|---|
We are grateful to Dr. S. Lipton (Burnam Institute, La Jolla, CA) for donating the NR3A-short cDNA NR3A. We are also grateful to Dr. M. Yuzaki (St. Jude Children's Hospital, Memphis, TN) for donating the HA-NR3B pTrace cDNA. We would like to thank Dr. S. Nakanishi (Kyoto University, Japan) for donating the NR1011 and NR2A cDNAs, Dr. R. Huganir (John Hopkins University, Baltimore, MD) for donating the NR2B pRK5, Dr. S. Heinemann (Salk Institute, La Jolla, CA) for donating the NR2C cDNA, Dr. P. Seeburg (Max-Planck Institute, Heidelberg, Germany) for donating the NR2D cDNA, and Dr. Sheridan Swope (Georgetown University Medical Center, Washington, DC) for providing fyn kinase cDNA. Finally, we would like to thank Ursula Staschen for excellent technical assistance with immunoblots.
| |
Footnotes |
|---|
Received March 22, 2002; Accepted July 29, 2002
This work was supported by National Institutes of Health grants
NS36246 and AA11284. Portions of this work were previously presented in
abstract form [Al-Hallaq RA, Yasuda RP, Jarabek BR, and Wolfe BB
(2001) Expression of the NR3A subunit of the NMDA receptor in
developing rat brain. Soc Neurosci Abstr 27(Pt 1):1274.
]
Address correspondence to: Robert Yasuda, Department of Pharmacology, Med-Dent 401, Georgetown University School of Medicine, 3900 Reservoir Road NW, Washington, DC 20007. E-mail: yasudar{at}georgetown.edu
| |
Abbreviations |
|---|
NMDA, N-methyl-D-aspartate; NMDAR, N-methyl-D-aspartate receptor; KLH, keyhole limpet hemocyanin; Px, postnatal day x; HEK, human embryonic kidney; TFEE, Tris-HCl/NaF/EDTA/EGTA; DOC, deoxycholate.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. A. Henson, A. C. Roberts, K. Salimi, S. Vadlamudi, R. M. Hamer, J. H. Gilmore, L. F. Jarskog, and B. D. Philpot Developmental Regulation of the NMDA Receptor Subunits, NR3A and NR1, in Human Prefrontal Cortex Cereb Cortex, February 21, 2008; (2008) bhn017v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Schuler, I. Mesic, C. Madry, I. Bartholomaus, and B. Laube Formation of NR1/NR2 and NR1/NR3 Heterodimers Constitutes the Initial Step in N-Methyl-D-aspartate Receptor Assembly J. Biol. Chem., January 4, 2008; 283(1): 37 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tong, H. Takahashi, S. Tu, Y. Shin, M. Talantova, W. Zago, P. Xia, Z. Nie, T. Goetz, D. Zhang, et al. Modulation of NMDA Receptor Properties and Synaptic Transmission by the NR3A Subunit in Mouse Hippocampal and Cerebrocortical Neurons J Neurophysiol, January 1, 2008; 99(1): 122 - 132. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Al-Hallaq, T. P. Conrads, T. D. Veenstra, and R. J. Wenthold NMDA Di-Heteromeric Receptor Populations and Associated Proteins in Rat Hippocampus J. Neurosci., August 1, 2007; 27(31): 8334 - 8343. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lu, Z. Fu, I. Karavanov, R. P. Yasuda, B. B. Wolfe, A. Buonanno, and S. Vicini NMDA Receptor Subtypes at Autaptic Synapses of Cerebellar Granule Neurons J Neurophysiol, November 1, 2006; 96(5): 2282 - 2294. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Simeone, R. M. Sanchez, and J. M. Rho Molecular Biology and Ontogeny of Glutamate Receptors in the Mammalian Central Nervous System J Child Neurol, May 1, 2004; 19(5): 343 - 360. [Abstract] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||