![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
Vol. 62, Issue 5, 1128-1136, November 2002
Zentrum für Physiologie und Pathophysiologie, Abt. Vegetative Physiologie, Universität Göttingen, Göttingen, Germany (A.B., M.K., Y.H., M.R., S.G., G.B.); Department of Physiology, College of Medicine, University of Arizona, Tucson, Arizona (D.S.G., K.K.E., S.H.W.)
 |
Abstract |
|---|
 Top
 Abstract
 Introduction
Materials and Methods
Results
Discussion
References
|
|---|
The metal chelator DMPS (2,3-dimercapto-1-propanesulfonate) is used to
treat heavy metal intoxication because it increases renal excretion of
these toxins, which are accumulated in proximal tubule cells. To
evaluate the involvement of the organic anion transporter 1 (OAT1) in
the renal flux of DMPS, we examined the effect of DMPS on transport
mediated by the rabbit ortholog of OAT1 and compared these
characteristics with those observed in intact isolated rabbit proximal
tubules. The rabbit OAT1 (rbOAT1) cDNA consisted of 2124 base pairs
encoding a protein of 551 amino acids. Heterologous expression in COS-7
cells revealed rbOAT1-mediated transport of
p-aminohippurate (PAH; Kt = 16 µM). A
1 mM concentration of unlabeled PAH, 
-ketoglutarate, urate, or
probenecid inhibited [3H]PAH uptake by 70 to 90%.
cis-Inhibition and trans-stimulation experiments using several Krebs cycle intermediates implicated -ketoglutarate as the main intracellular exchange anion. Reduced DMPS inhibited rbOAT1-mediated fluorescein transport with an apparent Ki of 102 µM. These characteristics
paralleled those observed in isolated rabbit proximal tubules. PAH was
transported into nonperfused single proximal tubule S2
segments with a Kt of 76 µM. DMPS
inhibited FL uptake into single tubule segments with a
Ki-app of 71 µM. Fluorescein efflux from
preloaded tubules was trans-stimulated by 1 mM PAH and 1 mM DMPS, consistent with DMPS entry into tubule cells by rbOAT1. In
summary, rbOAT1 mediates basolateral uptake of DMPS into proximal
tubule cells, implicating this process in the detoxification process of
heavy metals in the kidneys.
| |
Introduction |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
An
important task of renal proximal tubules is the secretion of endogenous
and exogenous metabolic products and water-soluble xenobiotics.
Consequently, the kidney is a main site for the excretion of many
drugs, leading in some cases to nephrotoxicity (Burckhardt and Wolff,
2000
; Dresser et al., 2001). A substantial fraction of such compounds
carries a net negative charge at physiological pH and hence are
referred to as organic anions (OAs). p-Aminohippurate (PAH)
is the prototypic substrate for what is frequently referred to as the
"classic" process of renal organic anion secretion
(Pritchard and Miller, 1993). Recently, two PAH-transporters [organic
anion transporter (OAT) 1 and OAT3] were identified and functionally characterized on the molecular level (Sekine et al., 1997; Sweet et
al., 1997; Reid et al., 1998; Kusuhara et al., 1999; Cha et al., 2001).
The overlapping substrate specificity and localization at the
basolateral membrane of renal proximal tubules (Tojo et al., 1999; Cha
et al., 2001) supports the assumption that both transport proteins may
play a role in the secretion of PAH and other OAs.
The kidney is also a site for accumulation of toxic heavy metals,
including mercury, cadmium, and arsenic (Welborn et al., 1998). Several
mechanisms have been proposed for the entry of these toxins, especially
mercury, into the proximal tubule cell (Zalups, 2000). An established
therapy for the reduction of the renal burden of heavy metals is the
treatment of patients with 2,3-dimercapto-1-propanesulfonic acid (DMPS;
Dimaval). Under physiological conditions, this organic anion
efficiently mobilizes mercury in the kidneys with comparatively low
toxicity (Aposhian et al., 1995). An investigation on the transport,
disposition, and toxicity of inorganic mercury in the presence of DMPS
was performed on isolated perfused segments of rabbit proximal tubules
(Zalups et al., 1998). The authors reported that exposing tubules
preloaded with mercury to a bathing solution containing DMPS resulted
in clearance of the mercury from the cells into the luminal filtrate. This effect was blocked by adding PAH to the DMPS-containing bath, implicating OA transport as a means of entry of the chelator into the
cells. However, because PAH is known to interact with multiple basolateral transporters in proximal cells, the molecular mode of
operation of DMPS in proximal tubule cells that finally leads to a
chelation and rapid excretion of heavy metals is still far from clear.
DMPS has been shown to interact with the human ortholog of OAT1.
Islinger et al. (2001) showed that hOAT1 has comparatively high
affinities for both reduced DMPS (Ki
of 22.4 µM) and oxidized DMPS (Ki of
66 µM). They also demonstrated that DMPS can
trans-stimulate PAH flux across cells expressing hOAT1,
suggesting that the transporter accepts the chelator as a substrate.
However, evidence integrating the activity of the cloned transporter
with that occurring in physiologically intact renal tubules has been
lacking. The present report has a 2-fold purpose. First, we report the
cloning and functional characterization of the rabbit ortholog of OAT1,
enabling comparison of the anion-transporting activity of this cloned
transporter with that seen in physiologically intact, isolated renal
proximal tubules. Second, to extend the functional comparison of a
cloned transporter with activity in the native tubule, we characterize the interaction of DMPS with rbOAT1 and with single isolated rabbit proximal tubules. The results support the conclusion that OAT1 represents an important avenue of DMPS entry into renal cells.
| |
Materials and Methods |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Materials.
Materials used included fetal bovine serum,
trypsin, phosphate-buffered saline from Invitrogen (Groningen,
the Netherlands), buffer ingredients, unlabeled substrates, such as
PAH, tetraethylammonium (TEA), -ketoglutarate, DMPS, malate,
fumarate, succinate, citrate, oxalacetate, urate, pyruvate, and
probenecid (Sigma-Aldrich, Deisenhofen, Germany), and fluorescein from
Molecular Probes (Leiden, Netherlands). [3H]PAH
(3.25 Ci/mmol) was purchased from PerkinElmer Life Sciences (Boston, MA).
Total RNA Extraction and RT-PCR. Approximately 100 mg of rabbit renal cortical tissue was homogenized with a mortar and pestle in liquid nitrogen and transferred to the extraction buffer of the RNeasy total RNA extraction kit (QIAGEN, Hilden, Germany). Total RNA was extracted according to the manufacturer's protocol. One microgram of this RNA was used for reverse transcription with omniscript reverse transcriptase (QIAGEN) and an oligo(dT)-anchor primer [5'-GACCACGCGTATCGATGTCGAC (T)18(AGC)-3'] at 37°C for 1 h. Four microliters of the RT reaction was taken for a standard PCR (94°C for 2 min, 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, for 35 cycles) with degenerate primers (sense primer, 5' CCTCYTTCAACTGCATCTTCCTG 3'; antisense primer, 5' CTTCTCTTGTGYTGAGGCCTG 3'). After visualization of the PCR product in an agarose gel by ethidium bromide, it was cut out of the gel, extracted with the Nucleotrap-kit (Macherey and Nagel, Düren, Germany) and subcloned into the pUC57-plasmid (MBI Fermentas, St. Leon-Rot, Germany). Positive clones were screened by standard PCR with plasmid primers (M13 universe/reverse). To amplify the entire rbOAT1-ORF, 4 µl of an RT-reaction was taken for a standard PCR using 1.2 units of the proofreading polymerase powerscript (PAN Biotech, Aidenbach, Germany) and specific primers (sense primer, 5'-GAAGATCTATGGCCTTCAATG-3'; antisense primer, 5'-GATCTAGATCAGAGTCCATTC-3'). The primers were constructed from sequence information using 5'- and 3'-RACE. The PCR product was cloned into pcDNA3.1 with the TOPO-pcDNA3.1 cloning kit (Invitrogen, Groningen, Netherlands).
5'- and 3'-RACE. The RT of the kidney total RNA was purified with the High Pure PCR purification kit (Roche Applied Science, Mannheim, Germany) and eluted in 25 µl of H2O, pH 8.0. A part of this purified RT was used for a 5'-tailing reaction with 25 mM dATP and 30 units of a terminal transferase (Invitrogen) for 1.5 h at 37°C. 5'-RACE was performed with a specific OAT1 primer derived from the human sequence (antisense, 5'-CAGTGTCATGCAGTTGAG-3') to anneal within the first part of the open reading frame. An oligo(dT)-anchor primer was taken in the first PCR and a RACE primer (5' GACCACGCGTATCGATGTCGAC 3') was used in the second ("nested") PCR, applying 1.2 units of powerscript polymerase (PAN Biotech, Aidenbach, Germany) at 55°C annealing temperature. The 3'-RACE was carried out from the same purified RT with a specific OAT1 forward primer (5'-CTGGGACAGCCTCTACCG-3') and the RACE primer. The resulting PCR-products were cloned with the TOPO-XL-cloning kit (Invitrogen, Groningen, Netherlands).
Sequencing. Positive clones were sequenced with different synthesized oligonucleotide primers derived from the hOAT1-cDNA and rbOAT1 by the dye-termination method using an automatic sequencer (ABI 377; Applied Biosystems, Weiterstadt, Germany). Sequence analysis was performed with several online services [e.g., CAP3 (http://pbil.univ-lyon1.fr/cap3.html), MAP (http://genome.cs.mtu.edu/map.html), FASTA (http://www.ebi.ac.uk/fasta33/)].
Cell Culture and Uptake Experiments.
The monkey kidney cell
line COS-7 was cultivated in plastic flasks or Petri dishes (Sarstedt,
Nümbrecht, Germany) in Dulbecco's modified Eagle's medium
(Invitrogen) with 580 mg/l glutamine, 110 mg/l Na-pyruvate and with
10% heat-inactivated fetal calf serum in 8.5%
CO2 at 37°C. Five micrograms of rbOAT1-pcDNA3.1 construct was transiently transfected into COS-7 cells by
electroporation (GenePulser II; Bio-Rad, München, Germany) at 250 V and 300 µF. Twenty-four hours after transfection, the cells were
plated in six-well plastic dishes (Sarstedt) at a density of 2 × 105 cells/well. Transport assays were performed
48 h after transfection in buffer (110 mM NaCl, 3 mM KCl, 1 mM
CaCl2, 0.5 mM MgSO4, 1 mM
KH2PO4, 10 mM HEPES, and 5 mM glucose, pH 7.5). In the trans-stimulation experiments,
the cells were preloaded for 2 to 3 h with each of the tested
substances. The cells were washed twice with buffer and incubated at
room temperature in buffer containing 1 µM fluorescein (FL) or 0.2 µM [3H]PAH. In some cases, the test solutions
also included additional test substances (as described in the figure
legends). The incubation was stopped and the extracellular tracer was
removed by washing the monolayer two to three times with ice-cold
phosphate-buffered saline. Cells were dissolved in 0.5 to 1 ml of 0.5 N
NaOH. To assess FL accumulation, fluorescence was measured in a
fluorescence spectrophotometer (Hitachi, Tokyo, Japan) at 492/512 nm
(excitation/emission). [3H]PAH content was
determined by scintillation counting (Canberra-Packard, Dreieich,
Germany). The protein content of each well was determined according to
the Bradford (1976) procedure.
Preparation of Intact S2 Segments of Rabbit Kidney
Cortex and Flux Measurements.
S2 segments of
proximal tubules, ~1.5 mm in length, were isolated from kidneys of
New Zealand White rabbits (Myrtle's Rabbitry, Thompson Station, TN)
applying previously published methods (Welborn et al., 1998). Tubules
were dissected in the lid of a plastic Petri dish that was kept on ice
and contained dissection buffer (110 mM NaCl, 25 mM
NaHCO3, 5 mM KCl, 2 mM
Na2HPO4, 1.8 mM
CaCl2, 1 mM MgSO4, 10 mM
sodium acetate, 8.3 mM D-glucose, 5 mM
L-alanine, 4 mM lactate, and 0.9 mM glycine, adjusted
to pH 7.4 with HCl or NaOH, and gassed continuously with 95%
O2/5% CO2 to maintain the
pH; osmolality was ~290 mOsmol/kg H2O).
Segments of proximal tubules were individually dissected from the
cortical zone and a segment was transferred to a glass-bottomed
aluminum superfusion chamber containing superfusion buffer. The chamber
was transferred to the stage of an Olympus IMT microscope and
superfused with buffer at 5 ml/min. The chamber was water-jacketed and
its temperature, as well as that of the incoming superfusion buffers,
was maintained at 37°C. Superfusion buffers could be changed in a few
seconds while maintaining a constant flow rate and temperature. A small vacuum line on the side of the chamber removed overflow.
. Tubules were observed
with an Olympus IMT microscope equipped with a 40× oil-immersion fluor
objective (1.3 numerical aperture; Nikon, Tokyo, Japan). Excitation
light (490 nm) from a 75-W xenon lamp coupled with a monochromator
(Photon Technology International, Brunswick, NJ) was directed on the
tubule section with a 490-nm dichroic mirror (model 490DCLP; Omega
Optical, Brattleboro, VT). Emitted light (collected as photons per
second) was measured at 1-s intervals using a photomultiplier tube
(model HC120; Hamamatsu, Bridgewater, NJ) coupled to a 520-nm long-pass
filter (Omega Optical). The signal from tubule autofluorescence at this
wavelength was <1% of the signal arising from exposure to 1 µM FL
(Welborn et al., 1998).
All tests for FL uptake into intact tubules were performed at an
external concentration of 1 µM. Data from the first 5 to 7 s
after the shift from control buffer to buffer containing FL was ignored
(owing to the exchange kinetics of the chamber solution), and the rate
of FL uptake was calculated by linear regression of the next 30-s
period representing the initial rate. After exposure to FL, the
superfusion solution was shifted to a FL-free bath and FL was allowed
to clear from the tubule for 10 min (sufficient to return to within a
few percentage points of background), after which another uptake trial
could be performed. A single tubule could usually be used for a period
of >2 h, which allowed for multiple uptake trials.
[3H]PAH uptake into intact tubules was studied
using 5 µM [3H]PAH over an incubation period
of 15 s.
FL efflux was measured by loading tubules for a longer period, usually
60 s, and then monitoring the decrease in tubule fluorescence over
a 90-s period after exposure to a FL-free medium. Efflux data are
expressed as percentage of fluorescence measured at time 0 (when FL
efflux commenced). Because tubules were loaded for a longer period, the
intervals between trails were also lengthened (to approximately 20 min)
to permit accumulated FL to washout from the tubule.
Kinetic and Statistical Analysis. Unless indicated otherwise, data are the mean (± S.E.) of three independent experiments with three repeats each. Kinetic constants were calculated using SigmaPlot 2001 (SPSS Science, Chicago, IL).
| |
Results |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Cloning of Rabbit Organic Anion Transporter 1 (rbOAT1).
Cloning the rabbit ortholog of OAT1 (rbOAT1) started with a reverse
transcription of total RNA extracted out of rabbit kidney cortex. A PCR
approach, using degenerate primers derived from the human and rat cDNA
sequences, was performed yielding a rabbit-specific 350-bp fragment
(data not shown). To complete the ORF and parts of the untranslated
regions (UTR), 5' and 3' RACEs were carried out. The RACE products were
subcloned into TOPO-XL plasmid and sequenced. This resulted in the
final cDNA sequence that consisted of a 1656-bp ORF coding for 551 amino acids and the complete 5' and 3' UTR region with 278 and 190 bp,
respectively.1 A sequence alignment
(Fig. 1) with the known OAT1 orthologs
showed a high identity of rbOAT1 to the human (89%), rat (88%), pig
(87%), and mouse (85%) OAT1 proteins. Further studies of the
expression of rbOAT1 in kidney using OAT1-specific primers and a RACE
reverse primer revealed an alternative OAT1-specific 3' UTR product of 874 bp (data not shown), illustrating that OAT1 is alternatively spliced in the kidney. ScanProsite analysis
(http://us.expasy.org/tools/scanprosite/; Fig.
2) for putative phosphorylation sites
resulted in five protein kinase C phosphorylation sites at positions
129, 190, 271, 284, and 521, including three highly conserved
positions, and five casein kinase II phosphorylation sites at positions
83, 122, 325, 515, and 544. Consistent with the other OAT1 orthologs,
analysis (TopPred2;
http://bioweb.pasteur.fr/seqanal/interfaces/toppred.html) of the rbOAT1
sequence suggested the presence of twelve putative transmembrane
spanning domains.
|
|
Functional Characterization of rbOAT1.
Fig.
3 shows the time course of
[3H]PAH uptake into COS-7 cells transiently
transfected with the cDNA for rbOAT1. Substrate accumulation increased
with time for at least 10 min, and 2-min incubations were used in
subsequent experiments to provide estimates of the initial rate of
transport of [3H]PAH. Figure
4 shows the effect of increasing
concentrations of unlabeled PAH on the uptake of
[3H]PAH into either wild-type COS-7 cells or
cells transfected with rbOAT1. In the absence of unlabeled PAH (which
competitively blocks transport of the labeled substrate), uptake of
[3H]PAH into cells transfected with rbOAT1 was
increased 10-fold over that measured in the nontransfected cells.
Whereas addition of unlabeled PAH profoundly inhibited uptake of
[3H]PAH into the rbOAT1 cells, the unlabeled
substrate had virtually no effect on transport into the wild type
cells. The rbOAT1-specific uptake of PAH (i.e., transport in
transfected cells minus that observed in nontransfected cells) was a
saturable function of substrate concentration that was adequately
described by the Michaelis-Menten equation for competitive interaction
of labeled and nonlabeled substrate (Malo and Berteloot, 1991):
![J=<FR><NU>J<SUB><UP>max</UP></SUB>[<UP>∗PAH</UP>]</NU><DE>K<SUB><UP>t</UP></SUB>+[∗<UP>PAH</UP>]+[<UP>PAH</UP>]</DE></FR>+C](/content/vol62/issue5/fulltext/1128/img001.gif)
|
(1) |
|
|
-ketoglutarate, urate,
or TEA. All tested substances reduced [3H]PAH
uptake by 70 to 90%, except the cationic substance TEA, which showed
no effect (Fig. 5). In situ, OAT1
supports concentrative accumulation of exogenous anions through
exchange with endogenous intracellular dicarboxylates such as
-ketoglutarate (Sekine et al., 1997; Sweet et al., 1997). Therefore,
the anion selectivity of rbOAT1 was examined by measuring
cis-inhibition produced by 1 mM concentrations of PAH,
probenecid, pyruvate, citrate, -ketoglutarate, succinate, fumarate,
malate, and oxalacetate (Fig. 6A) or
trans-stimulation induced by 1 mM preload with PAH, urate,
pyruvate, citrate, glutarate, -ketoglutarate, succinate, fumarate,
malate, and oxalacetate (Fig. 6B). Except for glutarate,
-ketoglurate, urate, and PAH, none of these substances had an effect
on rbOAT1-mediated transport of fluorescein.
|
|
Influence of Reduced DMPS on FL Uptake by rbOAT1 Compared with
PAH.
Intact tubules also accumulate FL by a process with the
physiological characteristics of OAT1, including inhibition by PAH and
probenecid (Sullivan et al., 1990) and trans-stimulation by oppositely oriented gradients of -ketoglutarate (Welborn et al., 1998) and glutarate (Sullivan and Grantham, 1992).
trans-Stimulation studies with cells preloaded with 1 mM PAH
revealed that PAH is able to drive FL uptake 1.6-fold over control,
demonstrating that rbOAT1 supports PAH/FL exchange (Fig. 6B). FL is
commonly used as a test substrate of OA transport in intact tubules
(Sullivan et al., 1990; Welborn et al., 1998), including experiments
described in an upcoming section of the present report. Consequently,
we characterized the interaction of PAH and DMPS with rbOAT1-mediated FL transport. PAH inhibition of FL transport was adequately described by the kinetics of competitive inhibition, according to the
relationship (Groves et al., 1998):
![J=<FR><NU>J<SUB><UP>m-app</UP></SUB>[<UP>S</UP>]</NU><DE>K<SUB><UP>i-app</UP></SUB>+[<UP>I</UP>]</DE></FR>+C](/content/vol62/issue5/fulltext/1128/img002.gif)
|
(2) |
|
Peritubular OA Transport in Isolated S2 Segments of
Rabbit Renal Proximal Tubules
Interaction with DMPS.
Peritubular
PAH transport is generally acknowledged as reflecting, at least in
part, activity of OAT1 in the intact tubule. Consequently, we first
confirmed the characteristics of peritubular PAH transport into
S2 segments of rabbit proximal tubule. This transport was saturable, with a Kt of
75.8 ± 20.5 µM and a Jmax of
6.7 ± 2.3 pmol/mm/min (Fig. 8).
Application of 1 mM TEA had no effect on this transport (Fig.
9). We tested the degree to which reduced
DMPS interacts with rabbit OAT1, as expressed in the native tubule, by
gauging its effect on FL uptake and efflux in single, isolated
S2 segments of rabbit proximal tubule. The initial rate of FL accumulation into single tubules was inhibited by
increasing concentrations of reduced DMPS with a
Ki-app of 71 µM (Fig.
10). To obtain evidence that DMPS can
serve as a transported substrate of basolateral rbOAT1 in intact
tubules, we examined the effect of trans-substrate gradients
on efflux of FL from preloaded tubules. Figure
11A shows that an inwardly directed PAH
gradient resulted in a marked stimulation in the basolateral efflux of FL from single proximal tubules. At 60 s, addition of 1 mM PAH in
the superfusate increased FL efflux by 84% compared with control efflux measured in the absence of an exogenous organic anion. When 1 mM
DMPS was added to the superfusate, FL efflux was also stimulated (Fig.
11B), with efflux at 60 s being increased by 41% over the
parallel control efflux. These data are consistent with the conclusion
that reduced DMPS can both bind to and be transported by rbOAT1.
|
|
|
|
| |
Discussion |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Renal OA secretion arises from peritubular and luminal transport
processes arranged in series. Although the luminal efflux step remains
poorly characterized, the peritubular transport processes, which
involves uptake from the blood into proximal tubule cells, has received
extensive study. Indeed, it is generally viewed as both the active and
rate-limiting step in tubular OA secretion (Pritchard and Miller,
1993). Peritubular transport of PAH and other OAs (including
fluorescein) has been used to characterize what is frequently referred
to as the "classic" renal OA transport pathway. The physiological
hallmarks of this process include its marked selectivity of OAs over
other structural classes of compounds, and catalysis of the mediated
exchange of selected dicarboxylates (e.g., glutarate and
-ketoglutarate) for PAH and other OAs. OAT1 shares both of these
general characteristics, leading to the speculation that OAT1 is the
molecular identity of the classical pathway (Sekine et al., 1997; Sweet
et al., 1997). Immunocytochemical localization of rat OAT1 to the
basolateral membrane of cells in the S2 segment of proximal tubule (Tojo et al., 1999) further supports this
suggestion, in light of evidence that peritubular PAH transport is
greatest in this segment (Shimomura et al., 1981).
Transport in intact proximal tubules reflects the net activity of all
associated transport processes. Three related OATs (OAT2, OAT3, and
OAT4; Sekine et al., 2000) have been found in the kidney; one of
these, OAT3, transports PAH and is highly expressed in the basolateral
membrane of proximal tubules (Motohashi et al., 2002). Thus, although
it is evident that OAT1 can play an important role in renal OA
transport, it is premature to conclude that OAT1 accounts for all
peritubular transport associated with OA secretion in the proximal tubule.
Characterization of Rabbit OAT1.
The decision to clone the
rabbit ortholog of OAT1 was made, in part, to facilitate comparison of
the molecular characteristics of OAT1 to the functional characteristics
of OA transport in intact renal proximal tubules. Peritubular OA
transport has been studied extensively in the rabbit, in large part due
to the comparatively unique ability to make measurements in single
isolated renal tubules, thereby permitting direct assessment of
transport function of defined nephron segments. The general
characteristics of rbOAT1-mediated transport reported here matched
closely those of other OAT1 orthologs. The
Kt for rbOAT1-mediated PAH transport
in COS-7 cells was 16 µM (Fig. 4), which is within the range reported
for OAT1 orthologs cloned from human (5-10 µM; Hosoyamada et al.,
1999; Lu et al., 1999), rat (14-70 µM; Sekine et al., 1997; Sweet et
al., 1997), pig (12.4 µM; Y. Hagos, A. Bahn, A. R. Asif, W. Krick, M. Sendler, and G. Burckhardt, submitted), mouse (37-160 µM;
Lopez-Nieto et al., 1997; You et al., 2000), and flounder (20-60 µM;
Wolff et al., 1997; Burckhardt et al., 2000). rbOAT1 activity was
inhibited by an array of OAs, but not by the organic cation TEA (Fig.
5). Preloading rbOAT1-expressing cells with PAH and glutarate
trans-stimulated uptake of [3H]PAH
(compare Figure 6), consistent with the anion exchanger mode of
activity routinely observed for OAT1. The absence of a trans-effect in cells preloaded with -ketoglutarate,
although somewhat surprising, may well reflect rapid metabolism of this substrate within COS 7 cells.
Comparison of rbOAT1 Activity with OA Transport in Intact Rabbit
Proximal Tubules.
The study of rbOAT1 permitted quantitative
comparisons of the characteristics of a single transporter to those
expressed in the native tubule (which may reflect activity of suite of
parallel processes). Interestingly, the kinetics of PAH transport in
intact tubules and in COS-7 cells transiently transfected with rbOAT1 were rather different. The Kt for PAH
transport into nonperfused single proximal tubules measured in the
present study was 76 ± 21 µM (n = 5) (Fig. 8),
which corresponds reasonably to the value of 108 µM reported in a
previous study (Dantzler et al., 1995). Kt values for PAH transport measured
in other preparations of isolated rabbit proximal tubules include 165 µM (tubule suspension; Groves et al., 1998) and 195 µM (for
transepithelial secretion in isolated S2
segments; Shimomura et al., 1981). All of these values are
substantially higher than the 16 µM
Kt measured for rbOAT1-mediated PAH
transport (Fig. 4). There are at least two possible explanations for
this discrepancy. The first is that PAH uptake could involve one or
more pathways other than OAT1. To this end, it is notable that, in the
human cortex, OAT3 and OAT1 are coexpressed in the basolateral membrane
of proximal cells, and hOAT3 mRNA expression in cortical tissue is two
to three times that of hOAT1 (Motohashi et al., 2002). Also, the
Kt for hOAT3-mediated PAH transport is
substantially higher than that for hOAT1-mediated transport (~90 µM
versus ~5-9 µM, respectively; Hosoyamada et al., 1999; Cha et al.,
2001), which correlates with the higher Kt for PAH uptake into tubules
compared with rbOAT1-expressing cells. It is remarkable that PAH uptake
is markedly reduced into renal slices from OAT3-knockout mice, compared
with wild-type littermates (Sweet et al., 2002), implicating OAT3 as a
significant contributor to total renal PAH (and organic anion) secretion.
Interaction of DMPS with rbOAT1 and Intact Rabbit Proximal
Tubules.
DMPS applied for several days significantly increases
renal heavy metal excretion and reduces the renal burden of heavy
metals (Aposhian et al., 1997). The pathways in proximal cells for
entry and exit of DMPS and its metal chelates are not clear. However, the principal site of entry of DMPS is likely to be across the basolateral membrane (Zalups, 2000). Because coexposure to PAH or
probenecid reduces DMPS-induced clearance of metal from kidneys, the
classic OA transport system is believed to play an important role in
DMPS entry (Klotzbach and Diamond, 1988; Diamond and Zalups, 1998;
Zalups, 2000). Thus, as noted earlier, the presence of multiple OATs in
proximal tubule cells underscores the importance of the direct
assessment of the interaction of DMPS with these OATs.
provided the first evidence that OAT1 is
involved in the renal uptake of DMPS. Using the human ortholog of OAT1,
they demonstrated an interaction with both reduced and oxidized DMPS
(Ki values of 22.4 µM and 66 µM,
respectively). They also showed that both forms of DMPS
trans-stimulate PAH efflux from hOAT1-expressing HeLa cells,
supporting the contention that these substances are substrates for
OAT1. We extended these observations by comparing the interaction of
DMPS with rbOAT1 and with peritubular OA transport in intact rabbit
proximal tubules. FL transport mediated by rbOAT1 was inhibited by DMPS
with an apparent Ki of 102 µM (Fig.
7B). The similarity between this value and the
Ki-app of 71 µM measured in intact
rabbit proximal tubules (Fig. 10) is consistent with the conclusion
that rbOAT1 plays a significant role in mediating DMPS entry into
proximal tubule cells. As expected, and consistent with previous
observations, inwardly directed gradients of PAH resulted in a marked
trans-stimulation of FL efflux from tubules preloaded with
the fluorescent substrate (Fig. 11A). A trans-gradient of
DMPS also stimulated FL transport in intact rabbit tubules, suggesting
that DMPS is a transportable substrate of OAT1 in intact proximal
tubules (Fig. 11B). The fact that DMPS is a substrate for OAT1 is
further underlined by the recent findings of Pombrio et al. (Pombrio et
al., 2001). They concluded that selected mercapturic acids serve as
high affinity substrates for OAT1.
In summary, we established a "clone/tubule" model system to
characterize renal OA transport and the role it can play in
DMPS-mediated detoxification of renal heavy metal poisoning. The rabbit
ortholog of OAT1 was cloned and showed the same functional
characteristics as its human ortholog (hOAT1). rbOAT1 interacted with
the heavy metal chelator, DMPS. Comparison with the interaction of DMPS with OA transport in physiologically intact isolated rabbit renal proximal tubules supported the conclusion that rbOAT1 plays a central
role in the peritubular entry of DMPS into intact renal proximal tubule cells.
| |
Acknowledgments |
|---|
We thank A. Hillemann for excellent technical assistance, A. Nolte (Dept. of Biochemistry, Universität Göttingen, Göttingen, Germany) for nucleotide sequencing, and E. Thelen for expert help with the preparation of the illustrations.
| |
Footnotes |
|---|
Received April 18, 2002; Accepted July 30, 2002
1 The nucleotide sequence reported in this article has been submitted to EMBL/GenBank with accession number AJ242871.
This work was supported by National Institutes of Health grants DK56224 and ES04940.
Address correspondence to: Dr. Andrew Bahn, Zentrum für Physiologie und Pathophysiologie, Abt. Vegetative Physiologie und Pathophysiologie, Universität Göttingen, Humboldtallee 23, 37073 Göttingen, Germany. E-mail: abahn{at}veg-physiol.med.uni-goettingen.de
| |
Abbreviations |
|---|
OA, organic anion; PAH, p-aminohippuric acid; OAT, organic anion transporter; DMPS, 2,3-dimercapto-1-propanesulfonic acid; TEA, tetraethylammonium; RT, reverse transcription; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; FL, fluorescein; rbOAT1, rabbit ortholog of the organic anion transporter 1; bp, base pair(s); ORF, open reading frame; UTR, untranslated region.
| |
References |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
-ketoglutarate on organic anion transport in single rabbit renal proximal tubules.
Am J Physiol
274:
F165-F174This article has been cited by other articles:
|
|
 |
|
  C. C. Bridges, L. Joshee, and R. K. Zalups MRP2 and the DMPS- and DMSA-Mediated Elimination of Mercury in TR- and Control Rats Exposed to Thiol S-Conjugates of Inorganic Mercury Toxicol. Sci., September 1, 2008; 105(1): 211 - 220. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bahn, Y. Hagos, S. Reuter, D. Balen, H. Brzica, W. Krick, B. C. Burckhardt, I. Sabolic, and G. Burckhardt Identification of a New Urate and High Affinity Nicotinate Transporter, hOAT10 (SLC22A13) J. Biol. Chem., June 13, 2008; 283(24): 16332 - 16341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. C. Bridges, L. Joshee, and R. K. Zalups Multidrug Resistance Proteins and the Renal Elimination of Inorganic Mercury Mediated by 2,3-Dimercaptopropane-1-Sulfonic Acid and Meso-2,3-dimercaptosuccinic Acid J. Pharmacol. Exp. Ther., January 1, 2008; 324(1): 383 - 390. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. G. Aslamkhan, D. M. Thompson, J. L. Perry, K. Bleasby, N. A. Wolff, S. Barros, D. S. Miller, and J. B. Pritchard The flounder organic anion transporter fOat has sequence, function, and substrate specificity similarity to both mammalian Oat1 and Oat3 Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2006; 291(6): R1773 - R1780. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Groves, W. B. Suhre, N. J. Cherrington, and S. H. Wright Sex Differences in the mRNA, Protein, and Functional Expression of Organic Anion Transporter (Oat) 1, Oat3, and Organic Cation Transporter (Oct) 2 in Rabbit Renal Proximal Tubules J. Pharmacol. Exp. Ther., February 1, 2006; 316(2): 743 - 752. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhang, C. E. Groves, A. Bahn, W. M. Barendt, M. D. Prado, M. Rodiger, V. Chatsudthipong, G. Burckhardt, and S. H. Wright Relative contribution of OAT and OCT transporters to organic electrolyte transport in rabbit proximal tubule Am J Physiol Renal Physiol, November 1, 2004; 287(5): F999 - F1010. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. H. Wright and W. H. Dantzler Molecular and Cellular Physiology of Renal Organic Cation and Anion Transport Physiol Rev, July 1, 2004; 84(3): 987 - 1049. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bahn, C. Ebbinghaus, D. Ebbinghaus, E. G. Ponimaskin, L. Fuzesi, G. Burckhardt, and Y. Hagos EXPRESSION STUDIES AND FUNCTIONAL CHARACTERIZATION OF RENAL HUMAN ORGANIC ANION TRANSPORTER 1 ISOFORMS Drug Metab. Dispos., April 1, 2004; 32(4): 424 - 430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Lungkaphin, V. Chatsudthipong, K. K. Evans, C. E. Groves, S. H. Wright, and W. H. Dantzler Interaction of the metal chelator DMPS with OAT1 and OAT3 in intact isolated rabbit renal proximal tubules Am J Physiol Renal Physiol, January 1, 2004; 286(1): F68 - F76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. E. Groves, L. Munoz, A. Bahn, G. Burckhardt, and S. H. Wright Interaction of Cysteine Conjugates with Human and Rabbit Organic Anion Transporter 1 J. Pharmacol. Exp. Ther., February 1, 2003; 304(2): 560 - 566. [Abstract] [Full Text] [PDF]
|
|
| ||||||
). The transport of 0.2 µM [3H]PAH over 2 min
incubation time was determined in absence or presence of 1 mM of each
of these substances in comparison to nontransfected cells (
). The
length of each horizontal column is a mean uptake of two independent
transfections with three repeats. Each column is calculated as
percentage of radiolabel accumulation under control conditions (100%)
measured without inhibitor. *, p < 0.05; 
