Institut de Chimie Biologique and Institut National de la
Santé et de la Recherche Médicale U-338, Faculty of
Medicine, Strasbourg, France (C.A., C.M., C.S.-M., S.G., D.A., M.M.)
and Institut de Recherche International Servier, Neuilly-sur-Seine,
France (M.S.)
Differential display reverse transcription-polymerase chain
reaction was used to identify mRNAs that are differentially expressed in the brain of rats treated chronically with the reference tricyclic antidepressant, imipramine, in comparison with control rats. The gene
encoding for a mutation suppressor for Sec4-8 yeast
(Mss4) transcript is overexpressed in the amygdala of
treated rats after 3 weeks of daily administration. This overexpression
is also found in the hippocampus of rats treated chronically with
either tianeptine or fluoxetine. Mss4 protein has the properties of a
guanine nucleotide exchange factor, interacting with several members of
the Rab family implicated in Ca2+-dependent exocytosis of
neurotransmitters. Mss4 was also overexpressed in other brain
structures as judged by in situ hybridization. The kinetics of the
up-regulation of Mss4 gene expression measured by Northern blot during
the imipramine, tianeptine, or fluoxetine treatments are consistent
with an antidepressant effect that occurs after 3 weeks. In rats in
which anhedonia was induced by chronic mild stress during 3 weeks, Mss4 transcripts were specifically down-regulated in
hippocampus and amygdala compared with control rats. It is proposed
that Mss4 protein, which stimulates exocytosis in vivo, participates in
the potentiation of the activity of neurotransmitter pathways
implicated in the action of several antidepressants and constitutes one
of the common functional molecules induced after chronic antidepressant treatment.
 |
Introduction |
Imipramine
is a representative member of the family of tricyclic antidepressant
drugs and is currently used in the treatment of depression. The
immediate effect of antidepressant drugs consists either in the
inhibition of the reuptake of biogenic amines or in the decrease of
monoamine oxidase activity; these effects form the basis of the
monoamine hypothesis of depression. However, one of the strongest
arguments against this theory is the slow onset of the action of
antidepressant drugs: the beneficial therapeutic effects are seen only
after 2 to 3 weeks of treatment. In addition, several drugs that
neither inhibit the uptake of serotonin/noradrenaline nor decrease
monoamine oxidase activity possess real antidepressant properties
(Leonard, 1994
). At the present time, the mechanism of mood disorders
and the mode of action of antidepressants are far from being completely
understood. The slow onset of action of these drugs probably reflects
neuronal adaptive changes and plasticity of synaptic activity.
Consequently, dysfunction of basic mechanisms underlying gene
expression and neural plasticity is likely to play a significant role
in the pathogenesis of depression. Antidepressant drugs may produce a
therapeutic response by correcting or compensating these adaptive
mechanisms (Duman et al., 1999). Up to now, several laboratories have
demonstrated a role of chronic antidepressant treatment in
up-regulating the cyclic AMP signal transduction cascade linked to the
stimulation of many norepinephrine and serotonin receptors (Montminy,
1997). In this cascade, the transcription factor cyclic AMP response
element binding (CREB), which controls expression of many genes, seems
to play a pivotal role (Nibuya et al., 1996). However, other currently
unidentified genes are probably involved in the mechanism of the
therapeutic effect of antidepressants.
We have used differential display reverse transcriptase PCR
(DD-RT-PCR) to identify changes in gene expression that occur in the
amygdala, a crucial limbic structure of the brain, of rats treated for
up to 3 weeks with a daily injection of a therapeutic dose of
imipramine. The amygdala is thought to be largely involved in mood
regulation and homeostasis and plays a fundamental role in the control
of emotions (Maren, 1999). Differential display patterns were examined
21 days after chronic imipramine treatment and compared with
saline-injected control rats. A specific gene product, Mss4, involved
in the regulation of exocytose in brain, was found to be overexpressed
in amygdala of rats treated with imipramine. cDNA probes were used to
study this specific gene expression in other brain regions, including
the hippocampus. Limbic regions of the brain, particularly the
hippocampus, have been reported to show atrophy and loss of neurons in
response to chronic stress (Gould et al., 1992; Sheline et al., 1996). Moreover, the volume of the hippocampus is reduced in humans suffering from depression (Ongur et al., 1998; Bremner et al., 2000). Finally, given that the up-regulation of this gene by chronic imipramine administration indicates its possible implication in the regulation of
mood, a study was undertaken to examine its level of expression in
anhedonic rats. Interestingly, this subsensitivity to reward is
reversed by chronic treatment with antidepressant drug, including imipramine (Willner et al., 1987), and the chronic mild stress model
used fulfills many validating criteria as an animal model for
depression (Willner, 1997). We demonstrate that, in this model, Mss4 is down-regulated in limbic structures of the
rat brain.
| |
Materials and Methods |
Chronic Administration of Antidepressant.
Six adult male
Wistar rats (250-300 g) were injected i.p. with imipramine
hydrochloride (10 mg/kg; Sigma, St. Louis, MO) or tianeptine sodium
salt (15 mg/kg; batch 43275; Institut de Recherche International,
SERVIER, France) or administered orally with fluoxetine (15 mg/kg;
Sigma) at 10 AM each day for 21 days. A similar volume of
0.9% NaCl was administered to six control animals. All the animals
were killed 24 h after the last injection. Their brains were
removed and the amygdalae and hippocampi were rapidly dissected under
sterile conditions and stored in liquid nitrogen until used.
RNA Isolation.
Total cellular RNA was extracted from pooled
frozen tissue obtained either from six treated or six control animals,
using a previously described protocol (Chomczynski and Sacchi, 1987). The isolated RNA pellet was dissolved in 50 µl of diethyl
polycarbonate (DEPC)-water and treated with DNase-I RNase-free
(Promega, Madison, WI) to remove contaminating DNA.
DD-RT-PCR Analysis.
DNA-free total RNA (3 µg) was used for
RT reactions using 12 different oligo(dT)11VN (V
represents A, G, or C, and N represents A, T, G, or C), extended at
their 5' ends with a 17-mer oligonucleotide corresponding to the 3' end
of T7 promoter, as anchored primers. In combination with 20 different
arbitrary primers, each constituted of a 10-mer core annealing sequence
and a 16-base portion of an M13 reverse priming sequence, differential
display analyses were performed in duplicate as described previously
(Liang et al., 1993) modified according to the protocol from
Genomyx/Beckman (Foster City, CA). Total amygdala RNA (1 µl; 250 ng)
was added to each RT tube containing 3 µl of each 25 µM
oligo(dT)11VN primer and 9.5 µl of DEPC-water.
The RNA was denatured at 70°C for 10 min and immediately cooled in
ice. The RT master-mix (16.5 µl of 5× RT buffer containing 50 mM DTT
and 250 µM concentrations of each dNTP in DEPC-water) and 1.5 µl of
Moloney murine leukemia virus RT (300 U) were added to the sample and
annealed for 10 min at room temperature before incubation at 40°C for
1 h. Samples were then heated at 95°C for 5 min to inactivate
the RT and cooled in ice if used immediately or kept at 
20°C for
later use. Each DD-RT-PCR tube contained 1× PCR buffer containing 1.5 mM of MgCl2, 50 µM concentrations of each dNTP,
0.5 µl of [
-33P]dATP (10 µCi/µl), 4 µM oligo(dT)11VN primer, 4 µM arbitrary primer, 1.5 µl of the corresponding RT product, and 0.05 units/µl of Taq polymerase in a total volume of 20 µl. PCR was
started at 95°C for 2 min followed by four cycles at low annealing
temperature (92°C for 15 s, 46°C for 30 s, 72°C for 2 min) and 35 cycles at high annealing temperature (92°C for 15 s,
60°C for 30 s, and 72°C for 2 min). The DD-RT-PCR was
terminated by an elongation step of 7 min at 72°C. DD-RT-PCR products
were separated on 6% denaturing Tris-borate-EDTA/polyacrylamide gel
electrophoresis gels (HR-1000; Genomyx, Foster City, CA) for
2.5 h at 100 W, 2500 V, and 40°C. After the electrophoresis, the
gel was dried and autoradiographed (BioMax MR, 33 × 61 cm;
Eastman Kodak, Rochester, NY). After developing the film, the patterns
of amplified cDNA bands were compared. The autoradiogram and the gel
were oriented with needle punches and only DD-PCR bands with higher
intensity, suggesting a significant overexpression of the gene
represented in the band, were collected and PCR-reamplified. Because
PCR is a semiquantitative method, modest differences in band intensity may not necessarily be attributable to differences in gene expression. The gel band PCR reamplification was performed with the full-length M13
reverse primer (AGCGGATAACAATTTCACACAGGA) and the T7 promoter sites
(GTAAATACGACTCACTATAGGGC) as primers. This procedure provides experimentally useful amounts of each cDNA for sequencing without subcloning.
Probe Labeling.
A PCR-amplified 184-bp fragment from Mss4
cDNA using 5'CAGCAATCCTGATGGTGATG3' and 5'CTCCAAGGCCACATAGAAGC3' as
left and right primers was either 33P- or
35S-labeled by random priming. The amplified cDNA
fragment was added to a mixture of hexanucleotide primers and
heat-denatured for 5 min. The incubation was conducted in a 30-µl
total volume in the presence of 3× random buffer containing dATP,
dGTP, and dTTP, 1 µl of Klenow fragment (5 units/µl) and 5 µl of [-33P]dCTP (3000 Ci/mmol) or
[-35S]dCTP (800 Ci/mmol) for 4 h at
room temperature. The labeled probe was purified by centrifugation
through a G-50 Sephadex column and stored at 70°C.
The antisense and sense mRNA probes were generated by in vitro
transcription reaction. PCR was first run using the combination of the
5' end 10-mer oligonucleotide of the 184-bp cDNA fragment extended with
a 16-mer oligonucleotide corresponding to the 3' end of T3 promoter
(5'GGGAGACTAGTGTCAGCAGCAATCCT3') and the 3' end 10-mer oligonucleotide
of the 184-bp cDNA extended with a 17-mer oligonucleotide corresponding
to the 3' end of the T7 promoter (5'ACGACTCACTATAGGGCCTCCAAGGCC3') as
primers. The PCR product was then reamplified with the complete
sequences of T3 and T7 promoter. In vitro transcription reaction was
performed in a total volume of 25 µl [containing 5 µl of 5×
transcription buffer, 40 mM dithiothreitol (DTT), 1 µl of recombinant
RNasin ribonuclease inhibitor, 1 µg of PCR-extended cDNA, 1 µl of
10 mM rATP, 1 µl of 10 mM rUTP, 1 µl of 10 mM rGTP, 1 µl of 1 mM
rCTP, 1 µl of 1 M DTT, 1 µl of RNase block inhibitor, 5 µl of
[-35S]CTP (800 Ci/mmol), 10 units of T3 or
T7 RNA polymerase, and DEPC-treated water] and incubated at 37°C for
1 h. The DNA template was removed by incubating the transcript
with 10 units of RNase-free DNase/µg of DNA at 37°C for 15 min. The
RNA probe was extracted with phenol/chloroform and precipitated with
ethanol in the presence of 3 M sodium acetate, resuspended in 20 µl
of water and stored at 70°C.
Northern Blot.
Pooled hippocampus total RNA (10 µg) from
six treated rats and six controls was subjected to electrophoresis in
1.0% agarose-formaldehyde gel and transferred to Hybond membranes
(Amersham Biosciences). Hybridization and washing conditions were
carried out as described previously (Kalinyak and Perlman, 1987).
In Situ Hybridization on Frozen Brain Sections.
Three rats
were injected with imipramine or saline as described above for 3 weeks.
Twenty-four hours after the last injection, animals were intracardially
perfused with paraformaldehyde. The brains were collected, frozen in
nitrogen liquid, and cryostat-sectioned (20 µm sections). Frozen
slides with sections were immediately immersed in an acetone bath for 3 to 5 min to remove lipids, incubated in a solution of 0.1 M
triethanolamine, pH 8.0, and finally, in a triethanolamine/0.25%
anhydride acetic acid bath. After two rinses with 2× SSC, the slides
were prehybridized and hybridized with the appropriate probe as
described previously (Andriamampandry et al., 1998). Slides were
incubated in prewarmed 1× SSC containing 50% formamide at 60°C for
10 min and dehydrated successively with 50, 75, and 100% cold ethanol
solutions. The slides were finally dried at room temperature.
A 35S-labeled probe (25,000 cpm/µl) was diluted
with the following medium: 50% formamide, 0.6 M NaCl, 10 mM Tris
buffer, pH 7.5, 10 mM Denhardt's solution, 1 mM EDTA, 500 µg/ml
t-RNA, 1 mM DTT, 500 mg/ml dextran sulfate, and salmon sperm DNA and
incubated at 50°C for 2 h. Fifty microliters of this dilution
was added to each slide and incubation was performed at 52°C
overnight. The slides were washed twice with 1× SSC containing 50%
formamide at 55°C for 1 h followed by two rinses at room
temperature for 5 min. They were then incubated in a 1× NaCl-Tris-EDTA
solution in the presence of 3 µg/ml of RNase at 37°C for 30 min.
Finally, the slides were washed twice with 2× SSC, 50% formamide at
55°C for 1 h, 0.1× SSC at 55°C for 15 min and dehydrated
successively with 50%, 75%, and chilled absolute ethanol
solution. Once the slides were dried, they were autoradiographed at
room temperature for 3 to 7 days. Autoradiographic microscales were
used for calibration of autoradiographs.
Chronic Mild Stress Model of Depression in Rats.
The
protocol of Willner et al. (1987) was used for these experiments.
Briefly, seven adult male Wistar rats (250-300 g) were submitted to
chronic sequential exposure of a variety of mild unpredictable
stressors for 21 days (food or water deprivation, continuous lighting,
cage tilt, grouped housing, etc.). Chronic mild stress-induced
anhedonia was estimated by measuring the decrease in the consumption of
a palatable (1%) sucrose solution, compared with seven control rats
housed under normal conditions. After 3 weeks, the stressed rats
presented a significant decrease in sucrose consumption and were
sacrificed together with their corresponding controls. The brains were
removed and several brain regions of interest (including amygdalae and
hippocampi) were rapidly dissected under sterile conditions and stored
in liquid nitrogen until use.
Sequence Analysis.
The sequences were analyzed by using the
GCG Winsconsin Software package including Fasta, Bestfit, and Fetch
(Genetic Computer) and the GenBank/EMBL database.
| |
Results |
Differential Expression of Mss4 mRNA in the Amygdalae of Rats
Undergoing Long-Term Treatment with Imipramine.
Differential display analysis was performed in duplicate on total RNA
from amygdala to identify specific changes in gene expression in
response to chronic imipramine administration to rats. We
systematically compared mRNA display patterns between saline-injected
rats, as controls, and imipramine-treated rats. Thirty-nine bands
exhibited consistent differential expression between control and
treated rats; 18 bands indicated mRNA overexpression, but only those
that showed at least 2-fold higher relative densitometric intensity were selected. Five bands with these selection criteria were
reamplified and sequenced. Under these conditions, a 330-bp cDNA
fragment was identified (Fig. 1) and the
sequence analysis revealed 100% homology with the Rattus
norvegicus mRNA for Mss4 protein (Fig. 2). This cDNA fragment was barely
detectable in control animals injected with saline. In
imipramine-treated rats, two bands were seen to be up-regulated (Fig.
1A). The upper band corresponded to Mss4, whereas the lower one did not
correspond to a known sequence and was therefore not selected for
further analysis. To confirm the overexpression of Mss4 gene
by long-term imipramine treatment, we performed Northern blot analyses
using a 35S-labeled antisense probe generated
from the isolated cDNA fragment (Fig. 1B).
View larger version (55K):
[in this window]
[in a new window]
|
Fig. 1.
A, representative autoradiogram resulting from PCR
differential display of Mss4 gene expression in rat brain amygdala
between chronically imipramine treated animals (Im) and controls (C).
Differential displays were performed in duplicate using
ACGACTCACTATAGGGCTTTTTTTTTTTTAA as the oligo(dT) anchored primer and
ACAATTTCACACAGGAGACCATTGCA as arbitrary primer. The reaction products
were run on a denaturing gel and bands showing intensity differences
were excised, eluted from the gel. The arrow indicates two reproducible
PCR-amplified cDNA fragments that seem to be induced in imipramine
treated rats. The upper band, which corresponds to Mss4 cDNA, was
subjected to PCR reamplification, whereas the lower band, which
represents an unknown gene, was not selected for further analysis. B,
Northern blot analysis of amygdala total RNA samples from control and
imipramine-treated rats confirm the overexpression of Mss4 gene in
treated rats. An equal amount (10 µg) of total RNA from each sample
was loaded on the gel as shown by 28S (4.9 kb) and 18S (1.9 kb) rRNA
bands and transferred to a Hybond membrane. The antisense
35S-labeled probe was obtained by in vitro transcription
using the complete T7 promoter sequence in the PCR-amplified cDNA
fragment.
|
|
View larger version (40K):
[in this window]
[in a new window]
|
Fig. 2.
Search for homology by FASTA in Genbank/EMBL
database. The 330-bp cDNA (dd17.s) isolated by DD-RT-PCR showed 100%
identity with R. norvegicus mRNA for Mss4 (2.5 kb;
gb_ro:rnMss4).
|
|
Overexpression of Mss4 Gene in the Hippocampus:
Effects of Imipramine, Tianeptine and Fluoxetine.
These studies
aimed to demonstrate that the Mss4 gene was also
overexpressed in the hippocampus after long-term imipramine, tianeptine, or fluoxetine treatment for 3 weeks. For each compound, total RNA were prepared from three control rats and three treated rats
and Northern blots were run using the isolated
33P-labeled Mss4 cDNA fragment as probe. In Fig.
3, densitometry analysis showed that the
expression of Mss4 mRNA was increased by +104% with imipramine, +220%
with tianeptine, and +189% with fluoxetine compared with untreated
rats. These results indicate that the up-regulation of Mss4
gene expression also occurs in the hippocampus of treated rats.
However, fluoxetine also potentiated Mss4 expression in the olfactory
bulbs (+35%), whereas no significant effect was noted in the amygdala
(data not shown).
View larger version (54K):
[in this window]
[in a new window]
|
Fig. 3.
Effects of imipramine, tianeptine or fluoxetine on
Mss4 gene expression. An equal amount (10 µg) of total
RNA from each sample was loaded on the gel as shown by 28S (4.9 kb) and
18S (1.9 kb) rRNA bands and transferred to a Hybond membrane. A, spot
densitometry of the blot (percentage integrated density ± S.D.).
B, Northern blot of pooled hippocampus total RNA from control rats and
rats treated for 3 weeks with imipramine, tianeptine, or fluoxetine,
labeled with [33P]Mss4 cDNA probe. Three control rats and
three rats treated with imipramine, tianeptine, or fluoxetine were used
for each time point and experiments were performed in triplicate.
Student's t test was applied for the significance of
data. ***, p < 0.001; **, p < 0.01.
|
|
The pattern of expression of Mss4 gene was also studied
during the time course of imipramine or tianeptine effects, in the hippocampus of rats treated for 7, 14, and 21 days. Under these conditions, the expression of Mss4 mRNA was similar to the control values after the first week of treatment and increased after the second
and the third week [+67 and +104% with imipramine, respectively; +180% and +220% with tianeptine, respectively, as judged by
densitometry analysis (Fig. 4)].
View larger version (48K):
[in this window]
[in a new window]
|
Fig. 4.
Kinetics of Mss4 gene expression. A, spot
densitometry of the blot (percentage integrated density ± S.D.).
B, Northern blot of pooled hippocampus total RNA from control rats (C)
and rats treated with imipramine (Im) and tianeptine (Ti) for 1, 2, and
3 weeks labeled with [33P]Mss4 cDNA probe. Three control
rats, three rats treated with imipramine, and three rats treated with
tianeptine were used for each time point and experiments were performed
in duplicates. An equal amount (10 µg) of total RNA from each sample
was loaded on the gel as shown by 28S (4.9 kb) and 18S (1.9 kb) rRNA
bands. Student's t test was applied for the
significance of data. ***, p < 0.001; **,
p < 0.01.
|
|
In Situ Hybridization.
In situ hybridization experiments were
performed to explore the distribution of Mss4 expression in the brain
of rats treated for 3 weeks with imipramine rats versus controls using
the 184-bp cDNA or sense mRNA as probes. As shown in Fig.
5i, the 35S-sense
mRNA probe did not label any specific region. On the other hand, a
quantitative autoradiography analysis showed significant increases in
Mss4 expression in olfactory bulbs (+550%), striatum (+400%),
cerebellum (+377%), ventral hippocampus (+345%), dorsal hippocampus
(+311%), amygdala (+165%), and cortex (+160%). These values
represent the percentage increases of Mss4 gene expression in imipramine-treated rats (Fig. 5, a-d) compared with nontreated rats
(Fig. 5, e-h) using four independent measures per brain region. The
S.E.M. on each percentage was always below 35%. These experiments confirmed the overexpression of Mss4 gene in hippocampus
(dorsal and ventral) and in the amygdala. However, this overexpression was also important in the cortex, olfactory tractus, striatum, and
cerebellar cortex. The other brain regions exhibited a very low level
of Mss4 gene expression.
View larger version (49K):
[in this window]
[in a new window]
|
Fig. 5.
Brain regional distribution of Mss4 overexpression.
In situ hybridization was performed on brain sections of untreated rats
(a-d) and rats treated for 3 weeks with imipramine (e-g). A
35S-labeled, PCR-amplified cDNA fragment specific to Mss4
was used as probe. Films were analyzed by quantitative autoradiography.
A 35S-labeled sense mRNA probe was used as control (i).
|
|
Mss4 Gene Expression in Anhedonic Rats.
The
level of expression of Mss4 was studied in several brain regions of
rats submitted to mild repetitive stress for 3 weeks. These rats
exhibited an anhedonic behavior (subsensitivity to rewards)
characterized by a decrease in the consumption of sucrose (Monleon et
al., 1995). Anhedonia is the core symptom of depressive illness and the
chronic mild stress model of depression possesses a good validity
(Willner et al., 1997), in particular because it is sensitive to
imipramine at the doses we used; i.e., the attenuation of sucrose
consumption in mice by chronic mild stress is restored by long-term
administration of several antidepressants, including imipramine
(Monleon et al., 1995). Under our conditions, the stressed rats
exhibited a decrease of body weight and of sugared water consumption of
20 and 35%, respectively, compared with control rats, but the total
intake of water remained stable (Fig. 6). A significant decrease in the signal obtained with the Mss4 probe was
detected by Northern blotting of total RNA from the amygdalae and
hippocampi of anhedonic rats (minus 55 and 50%, respectively). Other
brain regions tested show no significant changes (Fig.
7). Thus, Mss4 expression is
down-regulated in the hippocampi and amygdalae of anhedonic rats,
whereas long-term administration of the antidepressant drug imipramine
induced overexpression of this gene in the same brain regions.
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 6.
A, effects of chronic mild stress on body weight
( , control rats; n = 7;  , stressed rats;
n = 7). Results are mean ± S.E.M. (unpaired
t test; ***, p < 0.001;
significantly different from control). B, effects of chronic mild
stress on water and sucrose consumption (, control rats, day 0;
n = 14; , nonstressed rats, day 21;
n = 7;  , stressed rats day 21;
n = 7). Results are means ± S.E.M. (analysis
of variance followed by Dunnett multiple comparison test; *,
p < 0.05; significantly different from control).
|
|
View larger version (72K):
[in this window]
[in a new window]
|
Fig. 7.
Brain regional distribution of Mss4
gene expression in chronically stressed rats. A, spot densitometry
(percentage of control ± S.D.). B, Northern blot of the following
brain regions: prefrontal cortex (PFrCx), olfactory bulb (BO),
hippocampus (Hi), substantia nigra and ventral tegmental area (SN/VTA),
amygdala (Am), cerebellum (C), thalamus (Th), hypothalamus (Hy),
striatum (Str), and nucleus accumbens (Nac). Seven control rats and
seven imipramine-treated rats were used. Total RNA from each region was
pooled and 10 µg was loaded on the gel as shown by 28S (4.9 kb) and
18S (1.9 kb) rRNA bands. Experiments were run in duplicate. Student's
t test was applied for the significance of data (***,
p < 0.001).
|
|
| |
Discussion |
Mss4, a homolog of the yeast dominant suppressor of Sec4 (Dss4),
was cloned from a rat brain cDNA library on the basis of its ability to
suppress Sec4 defects when expressed in the sec4-8 yeast secretory
mutant (Burton et al., 1993). Dss4 was identified as a spontaneous
suppressor of temperature sensitive, secretory defects in Sec4 protein,
a yeast Rab required for vesicle transport from the Golgi to the plasma
membrane (Moya et al., 1993). Rab GTPases comprise a large family
regulating discrete steps in exocytic and endocytic trafficking
pathways (Novick and Zerial, 1997; Olkkonen and Stenmark, 1997) and
their activation is tightly regulated by guanine nucleotide exchange
factors, which promote exchange of GTP for GDP in response to
extracellular and intracellular signals (Südhof, 1997). More
generally, members of the Rab branch of the Ras GTPase superfamily are
required for late event in the exocytic process, probably to facilitate
attachment of the synaptic vesicle at the active site of the
presynaptic membrane, followed by docking and by an ATP-dependent
priming step (Geppert et al., 1997; Zhu et al., 2001). It has been
shown that Mss4 coimmunoprecipitates with Rab3a in rat brain extracts
and that a tight interaction exists between Mss4 and Rab3a that
includes a conserved subdomain containing the invariant cysteine
residues required for Zn2+ binding as well as the
residues implicated in the interactions with Rab GTPases (Burton et
al., 1994). Mss4 stimulates GDP release activity for exocytic Rab
GTPases (Rab1, Rab3a, Rab8 and Rab10, Sec4, and Ypt1) and facilitates
neurotransmitter release as shown in giant squid nerve termini
(Convit et al., 1997). The up-regulation of Mss4 after chronic
administration of imipramine in rats could then be one of the major
steps in the regulation of the release of neurotransmitters and
therefore could contribute to the adaptation of synaptic events
underlying the mechanism of action of many antidepressants, including
imipramine, tianeptine, and fluoxetine. The expression of the cysteine
string protein (CSP), which is localized to synaptic vesicles in the
neurons, was reported to be induced in the rat frontal cortex after
chronic imipramine and sertraline treatment (Yamada et al., 2001).
Given that the CSP binds to the secretory vesicle and enhances the
activity of presynaptic calcium channels upon docking of the vesicle,
it is suggested that CSP could activate the neurotransmitter release at
nerve terminal (Chen et al., 2002). Moreover, it is reported that the
CSP N-terminal J-domain, which is involved in the interaction with
chaperone proteins of the heat-shock protein family and central cystine-rich region may serve to anchor the protein to membranes and
intervene in the late events of exocytosis (Magga et al., 2000). All
steps in the synaptic vesicle life cycle are regulated by a cascade of
protein-protein and lipid-protein interactions and Mss4 may play a
central role in the events controlled by the SNARE proteins VAMP-2,
SNAP-25, and syntaxin, which are essential for membrane fusion;
synaptotagmin is the major Ca2+ sensor for
Ca2+-regulated exocytosis at the synapse. Other
antidepressant-induced changes in the expression of specific genes in
selected brain areas have been described. These include the cAMP
phosphodiesterase (Takahashi et al., 1999), mineralo- and
glucocorticoid receptors (Vedder et al., 1999; Semont et al., 2000),
dopamine receptors (Lammers et al., 2000), serotonin or norepinephrine
transporters (Benmansour et al., 1999), immediate early gene
transcription factors [including c-fos (Torres et al., 1998), zif268
(Dahmen et al., 1997), NGF1-A (Bjartmar et al., 2000)], and
expression/phosphorylation of CREB as mentioned earlier (Thome et al.,
2000). It is tempting to postulate that the potentiation of serotonin
and/or norepinephrine release via sustained activity of Mss4 could
represent a phenomenon that participates in the plastic adaptation of
the cAMP cascade and CREB with specific target genes, such as
brain-derived nerve growth factor. Moreover, the effects of Mss4
overexpression may be not limited to monoaminergic terminals and could
concern other neurotransmitters and pathways in brain, including those
that release trophic substances. Depression and chronic stress could involve dystrophic responses that occur in brain limbic regions involved in the control of basic affective functions. Synaptic plasticity has been reported to be implicated in the atrophy of the
human hippocampus in mild cognitive impairment in aging (Gurvits et
al., 1996), post-traumatic stress disorders (Sheline et al., 1999), and
recurrent depressive illness (Duman and Charney, 1999). Hippocampal
atrophy in depression may be associated with repeated stress (Andersen
and Soleng, 1998). Decreases or increases in expression of a protein
that regulates the efficiency of synaptic transmission may be very
important in long-term effects on atrophy and depression, because
neurotrophic effects may be activity-dependent (Duman et al., 1997).
Our results provide new data that support a role of Mss4 overexpression
in the mechanism of action of imipramine. Interestingly, the present
studies also showed a stimulatory effect of tianeptine and fluoxetine
on Mss4 expression in hippocampus. This suggests that this phenomenon
is common for a tricyclic antidepressant (imipramine), a serotonin
uptake inhibitor (fluoxetine), and an atypical antidepressant
(tianeptine). Possible links between Mss4 up-regulation and the
therapeutic benefits induced by chronic antidepressant treatment can be
drawn from the present experiments. First, at least in the hippocampus,
the time course of Mss4 mRNA increase is consistent with a delay of 3 weeks before the appearance of a therapeutic effect. Secondly, chronic
imipramine treatment, which leads to the induction of Mss4 in several
regions of the brain of normal rats, reverses the depression induced by
chronic mild stress in rats (Willner et al., 1987). In fact, all
clinically effective antidepressants tested in the chronic mild stress
model reverse the induced reduction in sweet intake. The face and
predictive validity of this model seem to be high and it is usually
considered a valid model of depression. In our present experiments, the
anhedonic rats exhibit a down-regulation of Mss4 in their amygdala and
hippocampus. Thus, it may be assumed that chronic administration of
imipramine or fluoxetine may produce some elements of the therapeutic
response by correcting Mss4 underexpression, which could reflect some
part of the adaptive mechanisms to chronic stress. However, the
potential relevance of Mss4 in the pathophysiology and treatment of
depression does not exclude the probable involvement of a variety of
molecular disorders in different forms of depression (Duman and
Charney, 1999).
We thank C. Stutz for excellent technical assistance and Dr.
Keith Langley for careful reading of the manuscript.
CREB, cyclic AMP response element binding;
Dss4, dominant suppressor of Sec4;
Mss4, mutation suppressor for Sec4-8
yeast;
DD-RT-PCR, differential display reverse transcriptase polymerase
chain reaction;
DEPC, diethyl polycarbonate;
DTT, dithiothreitol;
SSC, standard saline citrate;
bp, base pair;
CSP, cysteine string protein;
kb, kilobase pair(s).
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
