![]() |
|
|
Vol. 62, Issue 6, 1482-1491, December 2002
Isoform-Specific Effects in Cardiac
Myocytes Using Antisense Phosphorothioate Oligonucleotides
Departments of Pharmacology and Toxicology (R.K., S.P., H.T., H.R.) and Physiology (M.I., J.R., O.V., J.L.), Biocenter Oulu, University of Oulu, Finland
| |
Abstract |
|---|
|
|
|---|
Members of the mammalian protein kinase C (PKC) superfamily play key
regulatory roles in multiple cellular processes. In the heart, PKC
signaling is involved in hypertrophic agonist-induced gene expression
and hypertrophic growth. To investigate the specific function of PKC
signaling in regulating cardiomyocyte growth, we used antisense
oligonucleotides to inhibit PKC
, the major isozyme present in the
neonatal heart. Transfection of cultured neonatal cardiomyocytes with
antisense PKC
oligonucleotides resulted in a marked reduction in
both PKC
mRNA and protein levels. PKC
antisense treatment also
reduced phenylephrine (PE)-induced PKC activity and perinuclear
translocation of PKC
. Antisense inhibition of PKC
led to
reduction of PE-induced increase in skeletal
-actin mRNA levels and
atrial natriuretic peptide (ANP) secretion but had no significant
effects on PE-induced
-myosin heavy chain, ANP, or B-type
natriuretic peptide (BNP) gene expression. On the other hand, antisense
PKC
treatment attenuated endothelin-1-induced increase in ANP and
BNP peptide secretion, whereas endothelin-1-induced gene expression of
ANP and BNP remained unchanged. The hypertrophic agonist-induced growth
of cardiomyocytes, characterized by increased [3H]leucine
incorporation, was not affected with antisense PKC
treatment.
Furthermore, we found that PE-induced increase in extracellular signal-regulated kinase (ERK) activity was partially inhibited by
antisense PKC
treatment, implicating ERK as a downstream mediator for PKC
signaling. These results indicate that PKC
isozyme is involved in hypertrophic signaling in cardiomyocytes and provide novel
strategies for future studies to identify other cellular targets
controlled selectively by PKC
or other PKC isozymes.
| |
Introduction |
|---|
|
|
|---|
Hypertrophic
phenotype in neonatal cardiac myocytes is characterized by an increase
in cell size and protein synthesis, increased sarcomere organization,
and induction of genes, which largely recapitulate the fetal pattern of
gene expression; among those are skeletal
-actin
(
-SkA) and
-myosin heavy chain (
-MHC), and the natriuretic peptide genes atrial natriuretic peptide
(ANP) and B-type natriuretic peptide (BNP)
(Ruskoaho, 1992
; Sugden and Clerk, 1998
). Hypertrophic cardiac growth
is also characterized by the activation of various cell signaling
cascades, including protein kinase C (PKC), mitogen activated protein
kinases, and phosphatases, such as calcineurin (Sugden and Clerk, 1998
;
Molkentin and Dorn, 2001
). Activation of PKC and its various isoforms
has been shown to exert multiple cardiovascular functions, including regulation of ion channels, intracellular ion concentration,
contractility, activity of transcription factors (c-jun and c-fos),
gene expression, and hypertrophic cardiomyocyte growth (Shubeita et
al., 1992
; Clerk et al., 1994
; Naruse and King, 2000
). In cardiac
myocytes, several autocrine/paracrine growth factors and
neurotransmitters, such as angiotensin II, endothelin-1 (ET-1), and
1-adrenergic agonist phenylephrine (PE), can
activate PKC.
Cardiac myocytes express members of all three subfamilies of PKC: one
classic isoform (PKC
), two novel isoforms (PKC
and PKC
), two atypical isoforms (PKC
and PKC
/
), and possibly
PKC
I and PKC
II (Rybin and Steinberg, 1994
; Sugden and Clerk,
1998
; Mackay and Mochly-Rosen, 2001
). Direct activation of classic and novel PKCs by phorbol esters, mimicking the actions of ET-1 and PE, is
known to promote cardiomyocyte hypertrophy (Sugden and Clerk, 1998
).
Moreover, studies with pharmacological inhibitors of PKC have revealed
a major role for PKC in regulation of hypertrophic response in cardiac
myocytes (Uusimaa et al., 1992
; Hanford and Glembotski, 1996
). Despite
studies with transgenic mice and ventricular myocytes overexpressing
PKC isoforms (Sugden and Clerk, 1998
; Molkentin and Dorn, 2001
), the
downstream targets of the different isozymes remain largely unknown.
Translocation of PKC isoforms to distinct intracellular sites is
recognized as an essential step in activation of different PKC isoforms
(Mackay and Mochly-Rosen, 2001
). PKC
, the major calcium-dependent
PKC isozyme expressed in neonatal cardiac myocytes, is located in the
soluble fraction in resting cells, and an increase in calcium
concentration selectively translocates PKC
to the particulate
fraction (Rybin and Steinberg, 1994
). Exposure of cardiac myocytes to
phorbol 12-myristate 13-acetate (PMA) or the
-adrenergic receptor
agonist norepinephrine has been shown to translocate PKC
to the
perinuclear membrane (Disatnik et al., 1994
). Hypertrophic agonists PE
and ET-1, in turn, have been shown to increase the proportion of
membrane-associated PKC
and PKC
, whereas translocation of PKC
to the cell membrane has not been detected (Clerk et al., 1994
; Puceat
et al., 1994
). In previous studies, overexpression of PKC
has been
shown to induce hypertrophic growth in neonatal cardiac myocytes
(Shubeita et al., 1992
; Braz et al., 2002
). Calcium-independent isozyme
PKC
has a significant role in regulating hypertrophy in adult rat
cardiac myocytes, whereas the role of PKC
in adult cardiomyocytes is
less important (Sugden and Clerk, 1998
; Mackay and Mochly-Rosen, 2001
).
Antisense oligonucleotides (ODNs) can be used to disrupt gene function
in a variety of in vitro culture systems and in vivo, and they have
proven potential in clinical use [e.g., in treating AIDS and leukemias
(Beltinger et al., 1995
)]. In the present study, we used antisense
approach to inhibit PKC
, the major PKC isozyme present in neonatal
heart. To evaluate the significance of PKC
in cardiomyocyte
hypertrophy,
-SkA and
-MHC gene
expression, as well as natriuretic peptide secretion and gene
expression, was studied. To test the hypothesis of PKC
signaling
interconnecting with other signaling pathways, we also measured
possible downstream targets of PKC
, such as ERK (extracellular
signal-regulated kinase) and calcineurin. Our results indicate that
PKC
participates in hypertrophic signaling in cardiomyocytes and
that there is a high selectivity in the proximal signaling pathways
activated by hypertrophic agonists.
| |
Materials and Methods |
|---|
|
|
|---|
Cell Culture, Transfections, and Immunocytochemistry.
Ventricular cardiomyocytes were prepared from 2- to 4-day-old
Sprague-Dawley rats (Tokola et al., 1994
). Cells were plated at a
density of 2 × 105/cm2 onto Falcon wells
from 15 to 35 mm in diameter. After a 16-h incubation, myocytes were
subjected to liposome-mediated transfection with FuGENE 6 (Roche
Molecular Biochemicals, Mannheim, Germany), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium
methylsulfate (Roche), or Tfx-50 (Promega, Madison, WI) for
6 h. Oligonucleotides (20 bases) used were phosphorothioated to
increase nuclease resistance and support RNase H cleavage of
hybridizing RNA. Sequence for antisense PKC
ODN was
5'-ATTATCTCTGGTGATTTGGA-3' targeting to 3' untranslated sequence (As1)
on the rat PKC
cDNA, and for scrambled ODN,
5'-GTGATATGTGCAGTTATTTC-3'. Two other antisense PKC
oligonucleotides used were 5'-TAAACGTCAGCCATGGTCCC-3', targeting to 5' untranslated sequence (As2), and 5'-TTAGCGATGACCAGCTGATC-3', targeting to coding sequence (As3) on the rat PKC
cDNA. After transfection, cells were
washed twice with DMEM and cultured in complete serum-free medium. When
appropriate, 100 µM PE or 100 nM ET-1 (Sigma, St. Louis, MO) were
added to culture medium on the third day in culture. The doses of PE
(100 µM) and ET-1 (100 nM) (Kerkelä et al., 2002
) have
previously been shown to result in cardiomyocyte hypertrophy.
20°C. Cells were next
placed in ice bath, washed three times with cold PBS, and blocked in
PBS containing 10% fetal bovine serum and 0.02 M glycine. Sarcomeric
organization was visualized by labeling
-actin filaments with Alexa
Fluor 568 Phalloidin (Molecular Probes, Eugene, OR). PKC
was
assessed using antibody against PKC
(Upstate Biotechnology, Lake
Placid, NY) at a dilution of 1:400 in blocking solution. Subsequently,
cells were washed twice with cold PBS-glycine, and anti-mouse
3'-fluorescein isothiocyanate (FITC)-conjugated antibody (Santa Cruz
Biotechnology, Santa Cruz, CA) was added at a dilution of 1:200 in
blocking solution. Finally, cells were washed twice with PBS, once with
H2O, and subjected to fluorescence microscopy.
Confocal Microscopy. Cardiac myocytes were cultured on glass-bottomed wells and transfected with complexes of FITC-labeled ODNs and FuGENE 6 as described above. The localization of 3' FITC-labeled ODNs in spontaneously beating ventricular myocytes was examined using laser scanning confocal microscopy (LSM 510; Zeiss, Thornwood, NY) equipped with argon laser and attached to a Zeiss Axiovert 100 TV microscope. Differential interference contrast and green fluorescence channels were used.
Immunoblot Analysis.
Cells were washed twice with ice-cold
PBS and collected by scraping into 500 µl of lysis buffer, which
consisted of 20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1%
Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM
-glycerophosphate, 1 mM Na3VO4, 1 µg/ml
leupeptin, 1 µg/ml pepstatin, 1 µg/ml aprotinin, 2 mM benzamidine,
1 mM phenylmethylsulfonyl fluoride, 2 mM dithiothreitol, and 50 mM NaF.
Extracts were further lysed with sonication and supernatant was
collected after centrifugation. For western blot analysis, cell lysates
were matched for protein concentration (10-20 µg), loaded on
SDS-PAGE and transferred to nitrocellulose filters. The membranes were
blocked in 5% nonfat milk and then incubated with PKC
(Upstate
Biotechnology), PKC
, PKC
, PKC
or PKC
II (Sigma) antibodies
overnight at 4°C. Amount of protein was detected by enhanced
chemiluminescence using hyperfilm MP from Amersham
International (Amersham, Bucks, UK).
Kinase Assays.
After treatment with appropriate agonists,
myocytes (approximately 1 × 106) were
washed with ice-cold PBS at room temperature. Samples for PKC activity
and ERK activity assays were collected by scraping into 100 µl of
lysis buffer containing 10 mM Tris, pH 7.5, 150 mM NaCl, 2 mM EGTA, 2 mM dithiothreitol, 1 mM
Na3VO4, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 2 µg/ml pepstatin, and 5 mM
benzamidine. The extracts were sonicated and supernatant was collected
after centrifugation. Protein extract (15 µl) was incubated at 30°C for 15 min with 10 µl of substrate buffer containing specific substrate peptide in the presence of 1 µCi of
[
-32P]ATP. Each reaction was terminated and
blotted on separate peptide-binding paper discs, which were repeatedly
washed with 75 mM orthophosphoric acid. The incorporated radioactivity
was measured with a scintillation counter (Rackbeta II; PerkineElmer
Wallac, Turku, Finland). The Biotrak assays for PKC and ERK activity
were provided by Amersham Biosciences (Little Chalfont,
Buckinghamshire, UK). The PKC assay lysis buffer contains EGTA, but
calcium is added back to the assay buffer, which also includes lipid
cofactors. The Biotrak assays contain the substrates, which are
synthetic peptides specific for PKC and ERK, respectively.
Radioimmunoassay.
Assay of immunoreactive ANP and BNP was
performed as described previously (Pikkarainen et al., 2002
). The
sensitivity of both assays was 1 fmol/tube. The intra- and interassay
variations were <10 and <15%, respectively. Serial dilutions of the
tissue extracts showed parallelism with the standards. The ANP
antiserum fully cross-reacts with pro-ANP, but there is no
cross-reaction with BNP or C-type natriuretic peptide (< 0.1%). The
BNP antiserum does not cross-react with ANP or C-type natriuretic
peptide (< 0.1%).
RT-PCR Analysis.
PKC
mRNA levels for rat samples were
measured by quantitative reverse transcription-PCR analysis using
TaqMan chemistry. Forward and reverse primers for PKC
mRNA
detection were AGACCACAAATTCATCGCCC and CAAACCCCCAGATGAAGTCG,
respectively. PKC
amplicon was detected using fluorogenic probe
5'-5-carboxyfluorescein-CCCACCTTCTGCAGCCACTGCA-5-carboxytetramethylrhodamine-3'. The results were normalized to 18S RNA quantified from the same samples
using the forward and reverse primers TGGTTGCAAAGCTGAAACTTAAAG and
AGTCAAATTAAGCCGCAGGC, respectively. The probe for the 18S amplicon was
5'-VIC-CCTGGTGGTGCCCTTCCGTCA-5-carboxytetramethylrhodamine-3'.
RNA Extraction and Northern Blot Analysis.
RNA was
isolated from ventricular myocytes by the guanidine thiocyanate-CsCl
method. For Northern blot analysis, 6 µg of RNA sample was
transferred to nylon membrane. Full-length ANP and BNP probes were
labeled with [32P]dCTP using
T7 Quick Prime Kit (Amersham Biosciences). The
ANP Probe was a kind gift from Dr. Peter L. Davies (Queen's
University, Kingston, ON, Canada). cDNA probes for rat
-SkA and rat
-MHC were made by RT-PCR technique. Sequencing showed that the
probes correspond to bases 2950 to 3184 (GenBank/EMBL accession number
v01218) and 5794 to 5923 (GenBank/EMBL accession number x15939),
respectively. The membranes were hybridized overnight at 42°C in 5×
saline sodium citrate, 0.5% SDS, 5× Denhardt's solution, 50%
formamide, and 0.1 mg/ml sheared salmon sperm DNA. After
hybridizations, membranes were washed in 0.1× saline sodium citrate
and 0.1% SDS three times at 65°C and subjected to analysis with the
Molecular Imager FX (Bio-Rad, Hercules, CA).
Protein Synthesis.
[3H] Leucine
incorporation was measured as described previously (Kerkelä et
al., 2002
). When appropriate, PE (100 µM) and ET-1 (100 nM) were
added, and after 24 h, cells were lysed and processed for
measurement of incorporated [3H]leucine
(Amersham Biosciences) by liquid scintillation counting.
Statistics. Differences between data groups were evaluated for significance using a Student's t test of unpaired data or one-way analysis of variance and Bonferroni's post-test. Results are expressed as mean ± S.E.M.
| |
Results |
|---|
|
|
|---|
Antisense Delivery.
Transfecting cardiac myocytes has been
found difficult compared with many other cell types. Different
transfection methods, such as calcium phosphate precipitation and
electroporation, have been applied to transfect DNA into the cells.
Several different cationic liposome carriers have also been designed to
increase cellular uptake of ODNs, and they have been demonstrated to
increase the transfection efficiency up to 1000-fold (Bennett et al.,
1992
). In the current study, we used three different cationic lipids to
optimize the transfection method and to ensure that there was no
interference of the lipid treatment with the results. In multiple experiments, highest transfection efficiency was achieved with FuGENE
6, which also showed least toxicity analyzed with microscope imaging of
the cells. To examine the transfection efficiency of the antisense
PKC
ODNs using the cationic liposome delivery system, fluorescent-tagged ODNs (500 nM) corresponding to PKC
were added with FuGENE 6, and the cells were subjected to confocal microscopy. The
data in Fig. 1 demonstrate that in the
presence of FuGENE 6, both antisense and scrambled ODNs were
effectively delivered into the cells. Proportion of fluorescent-tagged
ODN transfected myocytes was ~60 to 80%. The strongest fluorescence
was seen in the areas around the nucleus. On the second day after the
transfection, fluorescence staining was decreased but still
substantial. In the absence of cationic liposome carrier, only minimal
transfection efficiency was observed (data not shown).
|
Effects of Antisense PKC
ODN Treatment on PKC.
Several oligonucleotides, each 20 bases in length, were designed
to hybridize to different regions of rat PKC
mRNA. Myocytes were
transfected by using FuGENE 6 as cationic lipid. To verify that the
results were not influenced by the lipid treatment, the experiments
were repeated using also
N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate and Tfx-50 as lipids. Treatment of myocytes with the
PKC
antisense ODN (0.5 µM) targeted to 3' untranslated sequence (As1) on rat PKC
cDNA reduced PKC
mRNA levels by 50% compared with scrambled ODN (Fig. 2A). The levels
of 18S RNA were unaffected by the PKC
antisense ODN treatment.
|
mRNA levels, treatment with
the antisense PKC
ODN reduced PKC
protein levels by more than 60%. Dose-response studies in multiple experiments revealed that maximal reduction in PKC
protein levels was achieved at 0.5 µM, whereas control ODN with the same base composition as the antisense ODN, but with a scrambled sequence, had no effect (Fig. 2B). On the
other hand, no difference was found between samples from antisense PKC
and scrambled ODN-treated myocytes when subjected to Western blot analysis using antibodies against PKC
, PKC
, PKC
, or
PKC
II (Fig. 2C). In untreated control cells, PKC
staining was
diffuse around the cell, and treatment with PE (100 µM) for 5 min
translocated PKC
to the perinuclear region (Fig.
3) as observed previously (Disatnik et
al., 1994
ODN-treated cells,
fluorescence staining for PKC
was dramatically decreased, whereas in
control ODN-treated cells significant amount of PKC
was seen around
the nucleus (Fig. 3).
|
antisense treatment on PE-induced PKC activity was
studied by measuring the transfer of a phosphate group to a peptide
substrate highly selective for protein kinase C. As reported previously
(Clerk et al., 1994
antisense ODNs (Fig. 4A). A
similar result was also seen at 30 min, although the response of PKC to
PE had already markedly decreased (Fig. 4B). The two other antisense
PKC
sequences targeting to 5' (As2) and coding (As3) sequence of the
rat PKC
cDNA had no effect on the PE-induced PKC activity (Fig. 4B).
|
Effect of Antisense ODN Inhibition of PKC
on Hypertrophic
Phenotype.
To assess whether treatment of myocytes with PKC
antisense oligonucleotide was sufficient to influence cardiomyocyte
hypertrophy, we measured expression of two hypertrophic genes,
-MHC and
-SkA. Treatment with PE for
48 h induced a 1.6-fold increase in
-SkA and a 2.1-fold
increase in
-MHC mRNA levels (Fig. 5,
A and B). Inhibition of PKC
was sufficient to inhibit
-SkA gene expression by 30% (p < 0.05),
whereas
-MHC gene expression was not affected.
|
-SkA gene expression (Bueno et al., 2002
is an upstream regulator of calcineurin, we next
determined the effect of PKC
inhibition on PE-induced calcineurin
activity. In agreement with previous findings (Taigen et al., 2000
antisense ODNs had no significant effect on calcineurin activity (data
not shown).
Increased ERK activity is associated with hypertrophic growth of
cardiomyocyte, and several studies have found ERK as a downstream target of PKC (Goldberg et al., 1997
subunit of PKC on PE-induced ERK activity, an assay measuring transfer
of phosphate by active ERK was used. We found that PE was a potent
activator of ERK. Antisense PKC
treatment did not have significant
effect on ERK activity at 4 min (Fig. 6A)
or at 30 min (data not shown). Interestingly, at 24 h, the
PE-induced increase in ERK activity was partially inhibited with
antisense PKC
ODN treatment (Fig. 6B).
|
ODN treatment had no effect on PE- or
ET-1-induced calcium concentration transients or spontaneous myocyte
beating rate (data not shown).
To study the effect of PKC
inhibition on protein synthesis, another
major hallmark of cardiac hypertrophy, we measured
[3H]leucine incorporation into myocytes and
total protein content of the myocytes. Treatment of myocytes with PE
for 24 h induced a 2.7-fold increase in leucine incorporation and
a 1.5-fold increase in total protein content. As shown in Fig.
7, treatment of cells with antisense
PKC
ODNs had no effect on PE-induced increase in protein synthesis
or total protein content. In agreement with previous studies, ET-1
induced a 2.5-fold increase in [3H]leucine
incorporation that was not affected by antisense PKC
ODN treatment
(Kerkelä et al., 2002
ODN treatment had no
effect on PE- or ET-1-induced increase in myocyte size and myofilament
organization (data not shown).
|
Effect of Antisense PKC
Treatment on Hypertrophic
Agonist-Induced Natriuretic Peptide Secretion and Gene Expression.
Under basal conditions, natriuretic peptide secretion from cultured
neonatal ventricular myocytes is low compared with atrial myocytes and
gradually decreases over time (Tokola et al., 1994
). Treatment of
myocytes with antisense PKC
ODNs had no effect on basal ANP or BNP
secretion (data not shown). PE (100 µM) treatment increased ANP and
BNP release by up to 32- and 15-fold, respectively, associated with
3.1- and 1.8-fold increase in ANP and BNP mRNA levels, respectively
(Figs. 8 and
9). Inhibition of PKC
with antisense
ODNs significantly inhibited PE-induced ANP release (Fig. 8A), whereas
it had no effect on PE-induced BNP release (Fig. 8B). Antisense
treatment had no effect on PE-induced increase in ANP (Fig. 9A) or BNP
(Fig. 9B) mRNA levels.
|
|
on hypertrophic
signaling, we also studied effects of PKC
inhibition on ET-1-induced natriuretic peptide release and gene expression. ET-1
(100 nM) increased ANP and BNP secretion up to 3- and 10-fold, respectively. Interestingly, antisense inhibition of PKC
resulted in
a marked decrease in both ET-1-induced ANP and BNP secretion (Fig. 8,
C and D). Similar to PE stimulus, inhibition of PKC
had no effect on
ET-induced increase in ANP or BNP mRNA levels (data not shown).
| |
Discussion |
|---|
|
|
|---|
Several studies have previously shown that hypertrophic phenotype
of cardiomyocytes can be regulated by PKC (Shubeita et al., 1992
; Clerk
et al., 1994
; Sugden and Clerk, 1998
; Braz et al., 2002
), yet only
limited data exist concerning the roles of different PKC isozymes in
hypertrophic signaling and in the development of hypertrophic
phenotype. Because of the lack of specific pharmacological inhibitors,
studies concerning the role of different isozymes of PKC in development
of cardiac hypertrophy have been accomplished by using antisense
strategy or dominant negative constructs (Sugden and Clerk, 1998
;
Molkentin and Dorn, 2001
; Strait et al., 2001
). Indirect evidence of
PKC participation in hypertrophic signaling has been obtained by
studying translocation of PKC isozymes. In two studies using an aortic
banding-induced pressure overload model, increased PKC
, PKC
, and
PKC
translocation and up-regulation of total PKC
were observed
(Gu and Bishop, 1994
; Jalili et al., 1999
). In a genetic
G
q-mediated hypertrophy model, up-regulation of PKC
and PKC
activation were also noted (D'Angelo et al., 1997
; Dorn et al., 2000
). In transgenic animals, overexpression of
PKC
II under truncated
-myosin heavy chain promoter was
sufficient to produce hypertrophic phenotype (Wakasaki et al., 1997
). A
recent study using wild-type and dominant-negative mutant of PKC
isozymes also implied a necessary role for PKC
in hypertrophic
cardiomyocyte growth (Braz et al., 2002
). In contrast, results of the
current study suggest that PKC
plays a highly selective role in the
induction of cardiomyocyte hypertrophy.
Antisense oligonucleotides hybridizing to different sites of mRNA have
been shown to effectively block gene expression (Dean et al., 1994
). In
the current study, antisense oligonucleotide targeting 3'-untranslated
sequence on the rat PKC
cDNA was most effective in inhibiting PKC
protein synthesis, which is similar to findings in previous studies
using antisense PKC
oligonucleotides (Dean et al., 1994
;
Benimetskaya et al., 2001
). The specificity of antisense treatment was
also shown, because other cardiac isozymes of PKC were not affected by
antisense PKC
treatment. The PKC activity assay also revealed a
significant decrease in agonist-induced PKC activity in PKC
antisense ODN-treated cells. Antisense PKC
treatment had no effect
on PKC activity in resting cells, probably because of low basal PKC activity.
Increased protein synthesis is a major hallmark of hypertrophic
phenotype in cardiac myocytes. In the current study, inhibition of
PKC
had no effect on PE- or ET-1-induced increase in protein synthesis or total protein content of the cells. Previously, PE-induced protein synthesis was not affected by pretreatment of cultured myocytes
with TPA, also suggesting that conventional PKC activation might not be
essential for mediating hypertrophic growth (Kondo et al., 1999
). On
the other hand, in myotropin-induced hypertrophic model both PKC
and
PKC
isoforms were shown to participate in cardiomyocyte growth (Sil
et al., 1998
). In a recent study, overexpression of dominant-negative
PKC
attenuated PE-induced protein synthesis, favoring the role of
PKC
in hypertrophic cardiomyocyte growth (Braz et al., 2002
). The
reasons for these contradictory results are not clear, but may be
attributable to different cell culture conditions and unequal duration
of experiments (6 h versus 24 h). Treatment of myocytes with
dominant-negative PKC
may also produce a longer lasting effect than
antisense treatment, although the effect of dominant-negative PKC
treatment on PKC activity was not measured in the previous study (Braz
et al., 2002
). The reduction in PKC
achieved in the current study
was approximately 60%, which may also explain the failure to block the
PE-induced protein synthesis as well as PE-induced increases in
-MHC, ANP. and BNP gene expression.
The expression of several sarcomeric protein encoding genes is switched
to expression of fetal isoforms in response to hypertrophic stimuli
[e.g., transition from cardiac
-actin to
-SkA and
from the
-form of myosin heavy chain to the
-MHC form
(Sugden and Clerk, 1998
)]. In our studies, PE induced a significant
increase in both
-SkA and
-MHC mRNA levels. Antisense ODN
inhibition of PKC
was sufficient to decrease PE-induced increase in
-SkA mRNA levels, but it had no effect on
-MHC gene expression.
Previous studies have suggested a role for calcineurin in the
regulation of
-SkA gene expression, but not in the regulation of
-MHC gene expression, implying a difference in mechanisms regulating
these genes (Bueno et al., 2002
). Our results suggest that the
regulation of
-SkA gene expression involves PKC
, whereas
calcineurin is not a downstream mediator of PKC
. The PKC
signaling pathway regulating
-SkA gene expression is
likely to involve other mechanisms, possibly transcription factors
regulated by ERK.
The ability of PKC to induce Ras and Raf, upstream activators of ERK,
has previously been demonstrated (Sugden and Clerk, 1998
), but the
physiological significance remains unclear. In the current study,
inhibition of PKC
with antisense PKC
ODNs also resulted in a
modest but significant decrease in PE-induced ERK activity. Role of ERK
in the development of hypertrophic phenotype remains a controversy (Yue
et al., 2000
; Kerkelä et al., 2002
). Current data shows that
antisense PKC
inhibition of ERK pathway is not sufficient to prevent
hypertrophic agonist-induced protein synthesis. A previous study using
a pharmacological inhibitor of ERK, PD98059 (50 and 20 µM,
respectively), agrees with these findings (Kerkelä et al., 2002
).
Treatment of cells with PKC-activating phorbol esters, such as PMA, has
revealed a pivotal role for PKC in the regulation of ANP and BNP gene
expression and secretion (Ruskoaho, 1992
; LaPointe and Sitkins, 1993
).
Studies using pharmacological inhibitors of PKC, staurosporine, and
GF109203X have further supported a role for PKC in regulation of the
natriuretic peptide system (Uusimaa et al., 1992
; Hanford and
Glembotski, 1996
). Previously, transient overexpression of
constitutively active PKC
and PKC
in neonatal ventricular
myocytes has led to increased activity of ANP and myosin light chain-2
promoter constructs (Shubeita et al., 1992
). Recently, overexpression
of dominant-negative mutants of PKC
was sufficient to block
PE-induced ANP protein expression (Braz et al., 2002
). Surprisingly, we
found that transient inhibition of PKC
only led to the reduction in
peptide levels, but it was not associated with decrease in natriuretic
peptide mRNA levels. The result cannot have been caused by poor
transfection efficiency, because the samples for radioimmunoassay and
Northern blot analysis were from the same cells. Cellular mechanisms
regulating secretion of natriuretic peptides are poorly understood.
However, previous findings suggest that ANP secretion from atrial cells
is stimulated both by the increase in calcium levels and by the
activation of PKC, whereas ANP synthesis is mainly stimulated by the
activation of PKC (Suzuki et al., 1992
). Our results indicate that
PKC
, the major calcium-dependent isozyme in neonatal ventricular
myocytes, plays a pivotal role in the regulation of ANP and BNP
secretion. Recent studies on exocytosis and membrane fusion give
further support for the role of calcium in this process (Hu et al.,
2002
; for review, see Tavi et al., 2001
). Because PE and ET-1 both
increase intracellular calcium concentration transients, it is
intriguing to speculate whether antisense PKC
treatment has effect
on intracellular calcium oscillations (Furukawa et al., 1992
; Eble et
al., 1998
). Using confocal microscopy imaging of Fluo-3-loaded
myocytes, we did not find a difference in intracellular calcium
transients between antisense PKC
and scrambled ODN-treated myocytes.
Treatment of cells with the PKC
antisense ODN led to marked
reduction in PE-induced ANP secretion and had no effect on BNP secretion. On the other hand, ET-1-induced ANP and BNP
secretion were inhibited with PKC
antisense treatment. Factors
contributing to this differential regulation of ANP and BNP secretion
are not clear. ET-1 and PE induced activation of downstream kinases are both known to involve Gq, whereas
Gi signaling is only associated with ET-1.
Treatment with high concentration of PE (100 µM) may also stimulate
Gs via
-adrenergic receptors and thus result
in the observed difference in the regulation of ANP and BNP secretion (Ruskoaho, 1992
). G protein-coupled receptors are known to activate MAP
kinases via Ras-dependent pathway, although there is also data
suggesting that Gq-mediated activation of ERK
pathway may be fully or partially PKC-dependent (Gutkind, 1998
).
Another mechanism involved may be differential phosphorylation of PKC
isozymes by PE and ET-1. Whereas PE activates PKC
and ET-1 activates
PKC
and PKC
, membrane-bound diacylglycerol and PMA are known to
activate PKC
and PKC
(Clerk et al., 1994
; Puceat et al., 1994
).
Further studies are required to elucidate differences in downstream
signaling mechanisms of ET-1 and PE, responsible for differing
PKC
-dependent regulation of ANP and BNP secretion.
Taken together, these data indicate that PKC
plays a highly
selective role in the regulation of hypertrophic cardiomyocyte growth.
PKC
is involved in
-SkA gene expression, possibly by mechanisms involving ERK, but not in
-MHC gene
expression. In addition, PKC
is required for PE- and ET-1-induced
natriuretic peptide secretion, but antisense inhibition of PKC
is
not sufficient to block hypertrophic agonist-induced ANP or
BNP gene expression. We conclude that PKC
participates in
the regulation of hypertrophic agonist-induced
-SkA gene
expression and natriuretic peptide secretion but has a minor role in
the development of hypertrophic phenotype. Although the role of all
isozymes of PKC in the hypertrophic response in neonatal rat cardiac
myocytes is not clear, these data provide novel strategies for future
investigations, which are likely to identify other cellular targets
controlled selectively by PKC isozymes.
| |
Footnotes |
|---|
Received April 26, 2002; Accepted September 5, 2002
This work was supported by grants from Academy of Finland (to H.R.), Sigrid Juselius Foundation (to H.R.), Aarne Koskelo Foundation (to R.K., S.P., and H.T.), Finnish Foundation for Cardiovascular Research (to R.K., S.P., and H.R.), Research Foundation of Orion Corporation (to R.K.), Finnish Cultural Foundation (to S.P.), Ida Montin Foundation (to R.K. and S.P.), and the Foundation of Oulu University (to R.K.).
Address correspondence to: Heikki Ruskoaho, M.D., Ph.D., Department of Pharmacology and Toxicology, Faculty of Medicine, University of Oulu, P.O. Box 5000, FIN-90014 University of Oulu, Finland. E-mail: heikki.ruskoaho{at}oulu.fi
| |
Abbreviations |
|---|
-SkA, skeletal
-actin;
-MHC,
-myosin heavy chain;
ANP, atrial natriuretic peptide;
BNP, B-type
natriuretic peptide;
PKC, protein kinase C;
PE, phenylephrine;
PMA, phorbol 12-myristate 13-acetate;
ET-1, endothelin-1;
ODN, oligodeoxynucleotide;
DMEM, Dulbecco's modifed Eagle's medium;
PBS, phosphate-buffered saline;
FITC, fluorescein isothiocyanate;
ERK, extracellular signal-regulated kinase;
RT-PCR, reverse-transcriptase
polymerase chain reaction;
PD98059, 2'-amino-3'-methoxyflavone;
GF109203X, 3-[1-[3-(dimethylaminopropyl]-1H-indol-3-yl]-4-(1H-indol-3-yl)-1H-pyrrole-2,5-dione
monohydrochloride;
PAGE, polyacrylamide gel electrophoresis.
| |
References |
|---|
|
|
|---|
regulates the hypertrophic growth of cardiomyocytes through extracellular signal-regulated kinase 1/2 (ERK1/2).
J Cell Biol
156:
905-919
-deficient mice.
Proc Natl Acad Sci USA
99:
4586-4591
-adrenergic receptor signaling in G
q-mediated cardiac hypertrophy and ventricular dysfunction.
Mol Pharmacol
57:
278-287This article has been cited by other articles:
![]() |
W. S. Park, J.-H. Ko, N. Kim, Y. K. Son, S. H. Kang, M. Warda, I. D. Jung, Y.-M. Park, and J. Han Increased Inhibition of Inward Rectifier K+ Channels by Angiotensin II in Small-Diameter Coronary Artery of Isoproterenol-Induced Hypertrophied Model Arterioscler. Thromb. Vasc. Biol., August 1, 2007; 27(8): 1768 - 1775. [Abstract] [Full Text] [PDF] |
||||
![]() |