![]() |
|
|
Vol. 62, Issue 6, 1515-1521, December 2002
Graduate Institute of Medicine (Y.-C.H.), Department of Biochemistry, (L.-Y.C.) and School of Technology for Medical Sciences (W.-C.H.), Kaohsiung Medical University, Kaohsiung, Taiwan
| |
Abstract |
|---|
|
|
|---|
We demonstrated previously that nonsteroidal anti-inflammatory drugs
(NSAIDs) increased p27Kip1 by inhibiting protein
degradation to suppress the proliferation of human lung cancer cells.
In this study, we elucidate the molecular mechanism by which NSAIDs
modulate p27Kip1 proteolysis. Immunoblotting and
in vitro ubiquitination assays indicated that the expression of Cul1
and Skp2 and ubiquitination activity toward
p27Kip1 were not regulated by NSAIDs. On the
contrary, we found that NSAIDs inhibited proteasome activity to
increase p27Kip1 protein levels. NSAIDs
suppressed the expression of chymotrypsin-like catalytic subunits
(
5, LMP7, and LMP2), but did not directly block enzymatic activity,
to inhibit proteasome activity. Reverse transcriptase-competitive
polymerase chain reaction and promoter activity assays showed that this
inhibition occurred at the transcriptional level. In vitro degradation
experiments showed that p27Kip1 degradation was
inhibited by NS398, and the addition of purified 26S proteasome
reversed this inhibitory effect. Collectively, our results revealed the
mechanism by which NSAIDs modulate p27Kip1
protein degradation and suggest that NSAIDs are a novel class of
proteasome inhibitors.
| |
Introduction |
|---|
|
|
|---|
Emerging
evidence demonstrates that nonsteroidal anti-inflammatory drugs
(NSAIDs) exhibit a significant antiproliferative effect on a variety of
cancer cells (Goldberg et al., 1996
; Sheng et al., 1997
; Thompson et
al., 1997
; Molina et al., 1999
). Additionally, epidemiological studies
also indicate that NSAID use is associated with a reduced risk of
cancer development (Gupta and DuBois, 1998
). However, the mechanisms by
which NSAIDs inhibit tumor growth are not well-defined. Some NSAIDs may
induce apoptosis in cancer cells (Shiff et al., 1995
; Elder et al.,
2000
; Rahman et al., 2000
), and the apoptosis-inducing activity of
these drugs is linked with suppression of the antiapoptotic bcl-2 gene
or with the induction of ceramide, a well-known mediator of apoptosis,
in cancer cells (Chan et al., 1998
; Liu et al., 1998
). However, most
NSAIDs at pharmacological doses induce growth inhibition rather than
apoptosis in cancer cells. At present, the molecular basis for this
inhibitory action is largely unknown.
The progression of the mammalian cell cycle is controlled by three
major gene families, including cyclins, cyclin-dependent kinases
(CDKs), and cyclin-dependent kinase inhibitors (CDKIs). Cyclins and
CDKs are positive cell-cycle regulators, and the up-regulation of these
two gene families is frequently found in human cancers (Sherr, 1995
).
Conversely, CDKIs are negative cell-cycle regulators, and the
down-regulation of these inhibitory proteins is a general phenomenon
observed in human cancers (Sherr and Robert, 1995
). We showed
previously that an NSAID, NS398, may suppress the growth of human lung
cancer cells by up-regulating the expression of p27Kip1, a typical CDKI (Hung et al., 2000
).
Additionally, we showed that NS398 increased the intracellular level of
p27Kip1 via inhibition of protein degradation.
Two other recent studies showed that aspirin, a generally used NSAID,
also increased intracellular p27Kip1 protein
levels to suppress the proliferation of vascular smooth muscle cells
and colon cancer cells (Marra et al., 2000
; Kralj et al., 2001
). These
results suggest that the up-regulation of p27Kip1 is one of the mechanisms by which NSAIDs
inhibit cell growth.
The intracellular level of p27Kip1 is controlled
by post-translational modification. Recent works showed that this CDKI
is degraded via the ubiquitin/proteasome pathway. After being
phosphorylated at T187 by cyclin E/CDK2 complex,
p27Kip1 is ubiquitinated by the sequential
action of E1 (ubiquitin-activating enzyme), E2 (ubiquitin-conjugating
enzyme), and E3 (ubiquitin ligase) (Hershko and Ciechanover, 1998
;
Kornitzer and Ciechanover, 2000
). Polyubiquitinated
p27Kip1 protein is subjected to degradation by
the 26S proteasome (Reits et al., 1997
; Ciechanover, 1998
). In this
study, we investigated the mechanism by which NSAIDs modulate
p27Kip1 protein degradation.
| |
Materials and Methods |
|---|
|
|
|---|
Cells and Reagents.
A549 human lung cancer cells were
maintained in Dulbecco's modified Eagle's medium and Ham's F12
nutrition mixture with 10% fetal calf serum and antibiotics. NS398,
20S, and 26S proteasome and methylubiquitin were obtained from BIOMOL
Research Laboratories (Plymouth Meeting, PA). The LMP2
promoter-luciferase construct was kindly provided by Dr. Jenny J. P. Ting (University of North Carolina, Chapel Hill, NC).
Luciferase and
-galactosidase assay systems were obtained
from Promega (Madison, WI). The His6-tagged human
p27Kip1 expression vector was a gift from Dr.
Michele Pagano (Department of Pathology, NYU School of Medicine, New
York, NY).
Immunological Reagents and Procedures.
For immunoblotting,
cells were treated with vehicle (0.5% dimethyl sulfoxide) or drugs
(indomethacin or NS398) for different times and harvested with a lysis
buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 5 mM EDTA, 50 mM NaF, 1%
Triton X-100, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl
fluoride, 1 mg/ml aprotinin, 2 µg/ml pepstatin A, and 2 µg/ml
leupeptin). The determination of protein concentration,
SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and immunoblotting
were performed as described previously (Hung et al., 2000
). Antibodies
used in this study included Cul1, Skp2, p27Kip1,
and His6-tagged protein from Santa Cruz Biochemicals (Santa Cruz, CA);
actin was from Chemicon International (Temecula, CA); and LMP7 and LMP2
were purchased from Affiniti Research Products (Mamhead, United
Kingdom). Polyclonal antibody against human proteasome
5 subunit was
provided by Dr. K. B. Hendil (August Krogh Institute, University
of Copenhagen, Copenhagen, Denmark).
Preparation of Cell Extracts for In Vitro Ubiquitination
Assay.
Control or drug-treated cells were washed with
phosphate-buffered saline and harvested in a lysis buffer (20 mM HEPES,
pH 7.9, 0.4 M NaCl, 25% glycerol, 1 mM EDTA, 2.5 mM dithiothreitol, and protease inhibitors). Cells were frozen and thawed three times, and
the lysates were subjected to centrifugation at 10,000g for 20 min at 4°C. The supernatants were frozen at
70°C until assays were performed.
Expression of His6-Tagged Human p27Kip1. His6-tagged human p27Kip1 vector was expressed in Escherichia coli, and expressed proteins were purified by nickel-agarose chromatography according to the manufacturer's instructions (QIAGEN, Valencia, CA).
In Vitro Ubiquitination Assays. His6-tagged human p27Kip1 protein was incubated with the cell extracts (containing equal amount of cellular proteins) in the presence of an ATP-generating system (50 mM Tris, pH 8.3, 5 mM MgCl2, 5 mM ATP, 10 mM creatine phosphate, and 0.2 unit/ml creatine kinase) together with 2 mM dithiothreitol, 1 mg/ml methylubiquitin, and protease inhibitors. Reactions were carried out at 37°C for 30 min and were terminated by adding SDS sample buffer. Reaction mixtures were subjected to SDS-PAGE and probed with anti-His6-tagged protein antibody.
Assays for Proteasome Activity in Cells.
To investigate the
effect of NSAIDs on intracellular proteasome activity, cell lysates
were prepared, and fluorogenic peptide substrate assays were performed
according to the procedures described by Glas et al. (1998)
. In brief,
control or drug-treated cells were broken by glass beads (<106 µm,
acid-washed; Sigma Chemical, St. Louis, MO) in a homogenization buffer
(50 mM Tris, pH 7.4, 1 mM dithiothreitol, 5 mM
MgCl2, 2 mM ATP, and 250 mM sucrose). Cells were
then vortexed for 1 min. Beads and cell debris were removed by
centrifugation at 1,000g for 5 min, followed by
10,000g for 20 min at 4°C. The supernatant was collected,
and the protein concentration was determined. For an assay of
chymotrypsin-like activity of the proteasome, the fluorogenic substrate
Suc-LLVY-AMC (Biomol) was used. Total cell lysates (10 µg) were
diluted to 100 µl in a reaction buffer (50 mM Tris, pH 7.4, 1 mM
dithiothreitol, 5 mM MgCl2, and 2 mM ATP).
Substrates (100 µM) were added to samples and incubated at 37°C for
45 min. The reaction was stopped with 1% SDS solution, and the
intensity of fluorescence was measured by a fluorescent
spectrophotometer (BMG Labtechnologies, Offenburg, Germany).
In Vitro Proteasome Activity Assay. To determine whether NS398 and indomethacin are direct inhibitors of proteasome, an in vitro proteasome activity assay was performed. Purified 20S proteasome (0.5 µg) was diluted to 100 µl in a reaction buffer (50 mM Tris, pH 7.4, 1 mM dithiothreitol, 5 mM MgCl2, and 2 mM ATP). NS398, indomethacin, or the proteasome inhibitor MG132 was added into the reaction buffer. Fluorogenic substrate Suc-LLVY-AMC (100 µM) was then added to samples and incubated at 37°C for 45 min. The reaction was terminated, and the intensity of fluorescence was measured as described above.
Construction of Competitor Templates.
A competitive reverse
transcriptase-polymerase chain reaction (RT-PCR) construct (mimic) for
LMP2 was synthesized using the sense primer
5'-CCTTGCAGGGATGCTGCGGATACTTTCGGCAGCACCTC-3', in which nucleotides 1 through 17 of LMP2 (GenBank accession number U01025) were attached to
nucleotides 35 through 54 of the proteasome
6 subunit (GenBank
accession number XM006212), and the antisense primer
5'-GGGAAGGTTCACTCATCACCATTGGTTCATCAGC CTTT-3', in which nucleotides 630 through 645 of LMP2 were attached to nucleotides 868 through 887 of
proteasome
6 subunit. Total RNA was isolated, and RT-PCR was
performed as described previously (Lee et al., 2000
). The PCR reaction
mixture contained 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2.5 mM
MgCl2, 0.4 mM dNTP, 600 nM primers, and 3 units of HotStarTaq DNA polymerase, and the condition for PCR was 30 cycles
of denaturation (94°C/1 min), annealing (60°C/45 s), extension (72°C/1 min), and 1 cycle of final extension (72°C/10 min).
5
subunit mimics. The primer sequences used for LMP7 (GenBank
accession number NM-004159) were 5'-GTGATGCTC
ATAGGAACCGATACTTTCGGCAGCACCTC-3' and
5'-GCCCCACCACCATTACCATTGGTTCATCAGCCT TT-3'; for the proteasome
5
subunit (GenBank accession number D29011), the sequences used
were 5'-GACTTGGGGGT CGTGCAGATACTTTCGGCAGCACCTC-3' and
5'-CACCTCTGCAG CAGCTCACCATTGGTTCATCAG CCTTT-3'.
Competitive PCR.
Cells were treated with vehicle or drugs
for 24 h; then total RNA was isolated, and reverse transcription
was performed as described previously (Lee et al., 2000
). PCR was
carried out in a reaction buffer of 10 mM Tris-HCl, pH 8.3, 50 mM KCl,
2.5 mM MgCl2, 0.4 mM dNTP, 600 nM primers, and 3 units of HotStarTaq DNA polymerase. The reverse-transcribed cDNA
samples and various amounts of mimics were added to the reaction
mixture and coamplified for 30 cycles of denaturation (94°C/1 min),
annealing (60°C/1 min), extension (72°C/1 min), and 1 cycle of
final extension (72°C/10 min). The primer sequences used for LMP2
were 5'-CCTTGCAGGGATGCTGCG-3' and 5'-GGG AAGGTTCACTCATCA-3'; for LMP7,
the sequences used were 5'-GTGATGCTCATAGGAACC-3' and
5'-GCCCCACCACCATTA-3'; and for proteasome
5 subunit, the sequences
were 5'-GACTTGGGGGTCGTGCA-3' and 5'-CACCTCTGCAGCAGCTCA-3'. PCR products
(10 µl) were separated by electrophoresis on 1.2% agarose gels and
stained with ethidium bromide, and the intensity of the signals was
analyzed by a densitometer.
Promoter Activity Assays.
Cells were plated onto six-well
plates at a density of 200,000 cells/well and grown overnight. Cells
were then cotransfected with 2 µg of LMP2 promoter-luciferase
construct and 2 µg of pCMV-
-galactosidase plasmid by the
LipofectAMINE method (Invitrogen, Carslbad, CA) as described previously
(Hung et al., 2000
). Cells were incubated in the absence or presence of
NSAIDs for 24 h, and luciferase activity was investigated by using
the luciferase and
-galactosidase assay system (Promega). Luciferase
activity was normalized with
-galactosidase activity and expressed
as a percentage of the control cells. Results shown are from three
independent experiments of duplicate samples.
In Vitro Degradation Assays.
Cellular proteins were
extracted according to the procedure described by Loda et al. (1997)
.
Control or drug-treated cells were suspended in ice-cold
double-distilled water. The samples were frozen and thawed three times,
and the lysates were centrifuged at 15,000g for 30 min. The
supernatants were collected for analysis. The total cell extracts
prepared by this method have been shown to preserve ubiquitinating
enzyme activity (Loda et al., 1997
). Cell lysates (10 µg) were
diluted to 100 µl in a reaction buffer (50 mM Tris, pH 7.4, 1 mM
dithiothreitol, 5 mM MgCl2, and 2 mM ATP), and
0.5 µg of His6-tagged p27Kip1 was added. The
reactions were carried out at 37°C for different times and were
terminated by adding SDS sample buffer. Each reaction mixture was
subjected to SDS-PAGE and probed with anti-His6 antibody to monitor the
His6-tagged p27Kip1 protein levels in the
mixture. In some experiments, purified 26S proteasome (0.5 µg) was
added exogenously to the reaction buffer.
| |
Results |
|---|
|
|
|---|
Expression of Cul1 and Skp2 and Ubiquitination of
p27Kip1 Were Not Affected by NSAIDs.
Because our previous work indicated that NS398 up-regulated
p27Kip1 protein levels via inhibition of
degradation, a direct prediction is that ubiquitination of
p27Kip1 may be affected by this drug.
Ubiquitination of p27Kip1 is catalyzed by the
ubiquitin ligase SCFp45Skp2. This ligase
comprises Skp1, Cul1, Skp2 (an F-box protein), Roc1/Rbx1, and the
recently identified Cks1 (Ganoth et al., 2001
; Spruck et al., 2001
).
Among these components, the expression of Cul1 and Skp2 was found to be
regulated by different extracellular stimuli (O'Hagan et al., 2000
;
Mamillapalli et al., 2001
). Therefore, we tested whether NS398 and
indomethacin may affect the expression of these two proteins. Our
results showed that intracellular protein levels of Cul1 and Skp2 were
not significantly regulated by these two NSAIDs (Fig.
1A). To further confirm these results, we
performed an in vitro ubiquitination assay to clarify whether these two NSAIDs may disturb the ubiquitination of
p27Kip1. We used methylubiquitin in our
experiments because it terminates the formation of polyubiquitin chains
and thus causes the accumulation of easily detectable, discrete,
low-molecular-mass (usually monoubiquitinated) derivatives rather than
a "smear" of polyubiquitinated p27Kip1.
Our results demonstrated that monoubiquitinated
p27Kip1 was clearly detected in the immunoblots
and that ubiquitination activity toward p27Kip1
in A549 lung cancer cells was not affected by NS398 and indomethacin (Fig. 1B).
|
NSAIDs Inhibit Proteasome Activity in A549 Cells.
Because
NS398 and indomethacin did not inhibit p27Kip1
ubiquitination, we next examined whether these two NSAIDs suppressed
proteasome activity to increase intracellular
p27Kip1 protein levels. We used two approaches
to address this question. First, it has been demonstrated that
significant accumulation of ubiquitinated proteins can be detected
easily in cells incubated with proteasome inhibitors. Therefore, we
treated A549 cells with NS398, indomethacin, or MG132, a proteasome
inhibitor, and investigated the change of protein ubiquitination by
immunoblotting. Indeed, we found that the accumulation of ubiquitinated
proteins was observed in NS398- or indomethacin-treated cells (Fig.
2). The pattern of protein accumulation
in cells incubated with NSAIDs was similar to that of MG132-treated
cells. Second, we examined the effect of NSAIDs on cellular proteasome
activity. Cells were treated with vehicle or NSAIDs for 24 h, and
cell lysates were harvested for analysis. A fluorogenic substrate was
used to examine the chymotrypsin-like activity of proteasomes. As shown
in Fig. 3, our results indicated that
NS398 and indomethacin suppressed intracellular proteasome activity in
a dose-dependent manner. However, the addition of prostaglandin
E2 (1 µM) could not significantly counteract the inhibitory effect of NS398 and indomethacin. These results suggest
that the suppression of proteasome activity by NSAIDs may not be
mediated via the inhibition of cyclooxygenase activity. We next
investigated whether NS398 and indomethacin are direct enzymatic
inhibitors for proteasomes. Purified 20S proteasomes were incubated
with these two NSAIDs, and enzymatic activity was assayed. Our results
indicated that NSAIDs could not directly inhibit the enzymatic activity
of proteasomes (Fig. 4). This was not
attributable to failures in the experiments, because MG132 effectively
suppressed 20S proteasome activity under the same experimental
conditions. Therefore, the suppression of intracellular proteasome
activity by NSAIDs was not mediated via direct inhibition of enzymatic
activity.
|
|
|
Suppression of Intracellular Proteasome Activity by NSAIDs Is
Correlated with the Down-Regulation of Catalytic Subunits of
Proteasome.
Because NSAIDs could not inhibit proteasome activity
directly, we speculated that NSAIDs might affect the expression and
assembly of proteasome catalytic subunits in cells. Therefore, we
tested the effect of NSAIDs on the expression of chymotrypsin-like
catalytic subunits, including
5, LMP7, and LMP2, of standard
proteasome or immunoproteasome. We developed an RT-competitive PCR
assay in which the target (LMP2, LMP7, and
5 subunit) cDNA samples obtained after reverse transcription from control or drug-treated cells
were coamplified in the same reaction tube in the presence of known
amounts of competitor DNAs (mimics). The competitor and target DNAs use
the same PCR primers but yield PCR products with different sizes. The
PCR products (646 bp for LMP2 and 888 bp for mimic) from a typical
competitive PCR assay were separated on agarose gel and visualized by
ethidium bromide staining (Fig. 5A).
|
5 subunit were suppressed by NSAIDs (Fig. 5B). In accordance with the RT-PCR results, our data
showed that NSAIDs also attenuated protein levels of these subunits in
A549 cells (Fig. 5C). We next tested whether NSAIDs may directly
inhibit gene transcription of these subunits. Because we did not have
the promoter of the
5 and LMP7 genes, we first studied the effect of
NSAIDs on the LMP2 promoter. As shown in Fig.
6, our results showed that NSAIDs
inhibited LMP2 promoter activity in a dose-dependent manner.
Additionally, prostaglandin E2 could not reverse
the inhibitory effect of NS398 and indomethacin. Thus, the inhibition
of LMP2 by NSAIDs is not mediated via the inhibition of cyclooxygenase
activity. Collectively, these data suggest that NSAIDs suppress the
expression and assembly of catalytic subunits to inhibit proteasome
activity and to increase p27Kip1 protein levels.
|
Addition of Purified 26S Proteasome Counteracts NS398-Induced
Inhibition of p27Kip1 Degradation.
If
NSAIDs indeed suppressed the expression and assembly of proteasome
subunits, it is obvious that p27Kip1 degradation
will be attenuated in NSAID-treated cells, and the addition of 26S
proteasomes into the lysates of NSAID-treated cells should effectively
promote p27Kip1 degradation. Lysates prepared
from vehicle- or NS398-treated cells were incubated with degradation
buffer containing ubiquitin, ATP-generating system, and His6-tagged p27
Kip1. As shown in Fig.
7A., our data showed that degrading
activity toward His6-tagged p27 Kip1 was
suppressed in cells treated with NS398 because His6-tagged p27
Kip1 was almost completely degraded in the
reaction buffer incubated with lysates of vehicle-treated cells after
1 h of incubation. However, the reaction buffer incubated with
lysates of NS398-treated cells remained 30 to 50% of the added
His6-tagged p27Kip1 after reaction as detected
by immunoblotting. Figure 7B showed that minor
p27Kip1 degrading activity was detected in
NS398-treated cell lysates, and His6-tagged
p27Kip1 protein was degraded gradually after
incubation. However, the addition of purified 26S proteasome obviously
promoted degradation, and His6-tagged p27Kip1
was almost undetectable after incubation for 15 min.
|
| |
Discussion |
|---|
|
|
|---|
Our previous work demonstrated that NS398 up-regulates
p27Kip1 levels by inhibiting protein degradation
(Hung et al., 2000
). Two recent studies also indicated that another
NSAID, aspirin, might up-regulate p27Kip1 in
vascular smooth muscle cells and colon cancer cells (Marra et al.,
2000
; Kralj et al., 2001
). In this study, we sought to elucidate the
molecular mechanism by which NSAIDs modulate
p27Kip1 degradation, and our results
demonstrate that NSAIDs increase p27Kip1 levels
via the inhibition of proteasome activity.
Several novel findings are noteworthy. First, our results indicate that
NSAIDs may up-regulate p27Kip1 levels by
inhibiting proteasome-mediated degradation to suppress tumor growth and
to provide a molecular basis for NSAID-induced growth inhibition.
Additionally, these results may be of clinical significance. Recent
studies have demonstrated that more than 70% of non-small-cell lung
cancer tumors showed reduced p27Kip1 protein
levels (Catzavelos et al., 1999
; Hayashi et al., 2000
). Moreover, the
loss of this CDKI is linked with poor clinical outcome (Yatabe et al.,
1998
). It is rational to suggest that natural or synthetic agents which
can effectively up-regulate p27Kip1 expression
will be considered to be useful drugs for the prevention or treatment
of lung cancer. Our results suggest that NSAIDs fit this category and
may be a novel class of chemopreventive drugs for lung cancer. Indeed,
epidemiological investigations indicated that NSAID use is associated
with reduced lung cancer incidence (Schreinemachers and Everson, 1994
;
Nelson, 1995
).
Second, a number of works showed that proteasome inhibitors exert a
potent anticancer effect in vitro and in vivo (Shinohara et al., 1996
;
Kitagawa et al., 1999
; Fan et al., 2001
). To date, most of the
proteasome inhibitors are known to suppress proteasome activity by
modifying the critical residue in the active sites or by competing
with the substrate-binding sites in the catalytic subunits. Our
study provides new evidence that proteasome activity can also be
regulated by modulating the expression and assembly of proteasome
subunits. A recent study reported another novel mechanism of proteasome
inhibition (Zaiss et al., 1999
). The authors demonstrated that the
proteasome inhibitor PI31 may inhibit proteasome activity via
competitive inhibition of the proteasome activator PA28. Thus, besides
direct enzymatic inhibition, intracellular proteasome activity can also
be affected by different mechanisms. An important and unresolved
question is why the inhibition of proteasome activity by NSAIDs
predominantly affects p27Kip1 degradation. One
possible explanation is that p27Kip1 is very
sensitive to the chymotrypsin-like activity of proteasome. Because
NSAIDs preferentially suppress the expression of
5, LMP7, and LMP2,
it is possible that the accumulation of p27Kip1
will be detected easily and quickly after NSAID treatment when the
proteolysis of other cell-cycle regulatory proteins is still unaltered.
Indeed, a recent study showed that a dietary polyphenol, tannic acid,
specifically inhibited the chymotrypsin-like activity of proteasomes
and predominantly increased p27Kip1 protein
levels in tumor cells (Nam et al., 2001
). In addition, the rapid
accumulation of p27Kip1 has also been observed
in cells incubated with various dipeptidyl proteasome inhibitors (An et
al., 1998
; Sun et al., 2001
).
Third, this study indicates that NS398 and indomethacin, in addition to
being anti-inflammatory drugs, are also potent proteasome inhibitors.
It is possible that proteasome inhibitors may exhibit an
anti-inflammatory effect, per se. Indeed, a recent work demonstrated that the proteasome inhibitor epoxomicin is a potent anti-inflammatory agent in vivo (Meng et al., 1999
). Therefore, the molecular targets and
clinical usefulness of NSAIDs and proteasome inhibitors are more broad
and complex than that was originally believed.
The mechanism by which NSAIDs regulate
5, LMP7, and LMP2 expression
is not presently clear. A number of transcription-factor binding sites,
including interferon-
regulatory factor, simian virus 40 promoter
factor 1, nuclear factor-
B, and activator protein-1, have been
identified in the human LMP2 promoter (Wright et al., 1995
), and
elucidating the critical elements and signaling pathways that mediated
the effect of NSAIDs on the expression of these catalytic subunits will
be an important topic for future study. We clarified the mechanism by
which NSAIDs up-regulate p27Kip1 protein levels
in lung cancer cells, and our results may be helpful for the
development of new strategies for the prevention of lung cancer.
| |
Acknowledgments |
|---|
We thank Drs. Michele Pagano, Jenny J. P. Ting, and K. B. Hendil for providing agents.
| |
Footnotes |
|---|
Received June 4, 2002; Accepted September 17, 2002
This study was supported by grant NSC-91-2320 B-037-015.
Address correspondence to: Wen-Chun Hung, Ph.D., School of Technology for Medical Sciences, Kaohsiung Medical, University, 100, Shih-Chuan 1st Road, Kaohsiung 807, Taiwan. E-mail: hung1228{at}ms10.hinet.net
| |
Abbreviations |
|---|
NSAID, nonsteroidal anti-inflammatory drug; NS398, N-(2-cyclohexyloxy-4-nitrophenyl)methanesulfonamide; CDK, cyclin-dependent kinase; CDKI, cyclin-dependent kinase inhibitor; PAGE, polyacrylamide gel electrophoresis; RT-PCR, reverse transcriptase-polymerase chain reaction; PCR, polymerase chain reaction; bp, base pair(s); Suc-LLVY-AMC, N-succinyl-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin; MG132, N-benzoyloxycarbonyl (Z)-Leu-Leu-leucinal.
| |
References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. Marfella, C. Di Filippo, M. Portoghese, F. Ferraraccio, B. Crescenzi, M. Siniscalchi, M. Barbieri, C. Bologna, M. R. Rizzo, F. Rossi, et al. Proteasome Activity as a Target of Hormone Replacement Therapy-Dependent Plaque Stabilization in Postmenopausal Women Hypertension, April 1, 2008; 51(4): 1135 - 1141. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dikshit, M. Chatterjee, A. Goswami, A. Mishra, and N. R. Jana Aspirin Induces Apoptosis through the Inhibition of Proteasome Function J. Biol. Chem., September 29, 2006; 281(39): 29228 - 29235. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Oida, B. Gopalan, R. Miyahara, S. Inoue, C. D. Branch, A. M. Mhashilkar, E. Lin, B. N. Bekele, J. A. Roth, S. Chada, et al. Sulindac enhances adenoviral vector expressing mda-7/IL-24-mediated apoptosis in human lung cancer Mol. Cancer Ther., February 1, 2005; 4(2): 291 - 304. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Herrmann, A. Ciechanover, L. O Lerman, and A. Lerman The ubiquitin-proteasome system in cardiovascular diseases--a hypothesis extended Cardiovasc Res, January 1, 2004; 61(1): 11 - 21. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||