Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

P2X receptors constitute a family of ligand-gated ion channels activated by extracellular ATP (for a review, see Mackenzie et al., 1999). The P2X₁ polypeptide contains two transmembrane domains linked by a large, glycosylated extracellular loop (Newbolt et al., 1998; Torres et al., 1998). Like other ligand-gated ion channels, P2X receptors are multimers. Based on the apparent similarity of membrane topology with inwardly rectifying K⁺ channels, K_ir, and also with the degenerin/epithelial Na⁺-channel superfamily, a tetrameric structure seemed to be most plausible. However, results obtained by chemical cross-linking and blue native polyacrylamide gel electrophoresis (BN-PAGE) analysis of receptors assembled from P2X₁ or P2X₃ polypeptides in Xenopus laevis oocytes indicate that trimers represent the essential element of P2X receptors (Nicke et al., 1998). These findings suggest that the P2X receptor provides a fundamentally new structural motif distinct from the established pentameric or tetrameric structures of the other ion channel families.

Methods commonly used to determine the subunit stoichiometry of membrane protein complexes include cross-linking analysis or coprecipitation experiments. However, artifactual aggregation of intracellular proteins resulting from overexpression in heterologous cell systems may severely bias conclusions based on biochemical approaches. In the present study, we used the concatamer approach to confirm the trimeric structure of the P2X receptor and to investigate whether it would be an appropriate method to examine the subunit organization of the P2X receptor. The concatamer strategy has first been applied to voltage-gated K⁺ channels, K_v (Isacoff et al., 1990). Linking channel subunits has also been successfully exploited for constraining the stoichiometry of K_v and K_ir to identify their quaternary structure (Liman et al., 1992; Yang et al., 1995; Silverman et al., 1996), the gating mechanism (Hurst et al., 1992; Tytgat et al., 1993), positional effects of particular subunits around the pore (Pessia et al., 1996), activation and inactivation mechanisms (Lee et al., 1996), assembly pathways (Tu and Deutsch, 1999), the roles of single amino acid residues for channel function (Hurst et al., 1995; Kirsch et al., 1995), and the nature of subunit-subunit (Lee et al., 1994) and ligand-subunit interactions (Heginbotham and Mackinnon, 1992; Kavanaugh et al., 1992). These predominantly electrophysiological studies indicate that a defined assembly of K⁺ channel subunits can be constrained by concatenation. Other membrane proteins that have been studied by the concatamer approach include close relatives of K⁺ channels, such as the cyclic nucleotide-gated channels (Liu et al., 1996; Varnum and Zagotta, 1996; Shapiro and Zagotta, 1998), and hyperpolarization-activated cyclic nucleotide-gated cation channels (Ulens and Tytgat, 2001), but also the ligand-gated GABA_A receptor (Im et al., 1995; Baumann et al., 2001), the mechanosensitive channel of Escherichia coli (Blount et al., 1996), the epithelial Na⁺ channel (Firsov et al., 1998), aquaporin (Mathai and Agre, 1999), as well as transmembrane transporters (Emerick and Fambrough, 1993; Sahin-Tóth et al., 1994; Köhler et al., 2000). A majority of these studies yielded convincing results, indicating that the concatamers are generated in full length and that the stoichiometry of the resulting ion channels can be constrained by the order in which different ion channel subunits are linked together. However, other reports suggest that concatamers can disrupt the normal association of subunits or that subunits from different concatamers might combine to form one ion channel, whereas adjacent subunits are excluded from the channel (Liman et al., 1992; McCormack et al., 1992; Hurst et al., 1995).

So far, all studies on concatamers depend on the interpretation of electrophysiological properties of the respective constructs. Here we present the first direct investigation of the assembly and surface appearance of oocyte-expressed concatamers. Biochemical analysis of the plasma membrane-bound receptor protein, but not of the total receptor protein, clearly demonstrates that monomeric and dimeric byproducts are generated upon expression of concatenated P2X₁ constructs, which appear as a complex equivalent to the plasma membrane-bound homotrimeric P2X₁ receptor assembled from wild-type monomers. These P2X₁ trimer-equivalent complexes can fully account for the ATP-dependent currents in these oocytes, thus indicating that formation of lower order byproducts can be a pitfall of the concatamer approach.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

cDNA Constructs. The cDNA construct encoding the N-terminally hexahistidyl-tagged rat P2X₁ polypeptide in the vector pNKS2 has been described previously (Nicke et al., 1998). To generate cDNAs encoding G(Q)₅VMA(H)₆-linked P2X₁ multimers from the dimer up to the hexamer, (His-P2X₁)_2-6 (Fig. 1), a double-stranded oligonucleotide (GGGCAGCAGCAGCAGCAGGTCATGAGC and GCTCATGACCTGCTGCTGCTGCTGCCC) encoding five glutamine residues followed by a BspHI site (underlined) was ligated into the mung bean nuclease-treated C-terminal Bsu36I cleavage site of His-P2X₁. This modified His-P2X₁-G(Q)₅V cDNA was excised with HindIII and BspHI and ligated in frame between the unique HindIII and NcoI cleavage sites of the parent His-P2X₁ plasmid. Because NcoI and BspHI generate compatible cohesive ends that are not recleavable after ligation, this cloning strategy can be repeated many times to engineer concatenated cDNAs encoding G(Q)₅VMA(H)₆-linked P2X₁ multimers of the desired order. Site-directed mutagenesis was performed using the QuikChange kit (Stratagene, Heidelberg, Germany). Junction sequences and mutations were confirmed by sequencing.

View larger version (35K): [in this window] [in a new window]   Fig. 1.   Schematic diagram of P2X1 concatamers. His-P2X1 monomers were joined tail to-head with five Q residues, yielding a G(Q)5VMA(H)6 linking sequence (linker 1). Positions of the four N-X-S/T N-glycosylation sequons that carry N-glycans (Rettinger et al., 2000) are marked by diamonds.

Expression in X. laevis Oocytes. Capped cRNAs were synthesized from linearized plasmid cDNAs. Oocytes were prepared as described previously (Nicke et al., 1998), injected with 50-nl aliquots of cRNA (0.5 µg/µl), and kept at 19°C in ORi (oocyte Ringer solution, 90 mM NaCl, 1 mM KCl, 1 mM CaCl₂, 1 mM MgCl₂, and 10 mM HEPES, pH 7.4) supplemented with 50 mg/l of gentamicin.

Two-Electrode Voltage Clamp Recordings. Current responses to ATP were measured by two-electrode voltage clamp recordings on cRNA-injected oocytes (Rettinger et al., 2000). For determination of current magnitudes, the response to the first application of 30 µM ATP was used.

Radiolabeling of Oocytes. cRNA-injected oocytes and noninjected control oocytes were metabolically labeled by overnight incubation with L-[³⁵S]methionine (>40 TBq/mmol; Amersham Biosciences Europe, Freiburg, Germany) at ~100 MBq/ml in ORi (0.2 MBq/oocyte) at 19°C and cultured in parallel with the nonlabeled oocytes used for surface radioiodination. For selective labeling of plasma membrane bound proteins, cRNA-injected oocytes were kept for 3 days at 19°C and then labeled with freshly radioiodinated (Na¹²⁵I; Amersham Biosciences) sulfosuccinimidyl-3-(4-hydroxyphenyl)proprionate (sulfo-SHPP; Pierce Biotechnology). After 60 min of incubation on ice oocytes were washed in Ca²⁺-free ORi containing 1 mM lysine to quench unbound ¹²⁵I-sulfo-SHPP.

Ni²⁺ NTA Affinity Chromatography, Blue Native PAGE, and SDS-PAGE. Proteins were purified from digitonin or dodecyl maltoside extracts of oocytes and resolved by blue native PAGE (Schägger et al., 1994) as described previously (Nicke et al., 1998). For SDS-PAGE, proteins were supplemented with SDS sample buffer containing 20 mM dithiotreitol (DTT), incubated for 10 min at 37°C, and then electrophoresed in parallel with ¹⁴C-labeled molecular mass markers (Rainbow; Amersham Biosciences) on SDS polyacrylamide gels. Where indicated, samples were treated for 1 to 2 h with either endoglycosidase H (Endo H) or PNGase F (New England Biolabs, Frankfurt, Germany) in the presence of reducing SDS sample buffer and 1% (w/v) octylglucoside.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

Concatamers of Two to Six Linked P2X₁ Monomers All Give Rise to ATP-Gated Cation Currents. We generated a series of concatenated cDNA constructs, (His-P2X₁)_2-6, consisting of two to six copies of the His-P2X₁ subunit in a single open reading frame by linking together the last C terminal codon of one subunit to the first N terminal codon of the second subunit with a heptapeptide sequence, G(Q)₅V (Fig. 1, linker 1). The resulting cDNAs encode polypeptides of 821, 1235, 1649, 2063, and 2477 amino acid residues. Complementary RNAs were injected into X. laevis oocytes, which were subjected to electrophysiological analysis by the two-electrode, voltage-clamp technique 3 days later (Fig. 2). Our hypothesis was that a dimer should give small ATP-gated currents if the functional channel requires three subunits, whereas expression of the trimer should result in considerably larger currents. Contrary to expectations, however, we recorded larger currents in oocytes expressing the concatenated P2X₁ dimer (Fig. 2B). This may signify that the functional P2X₁ receptor is made up of an even number of subunits, potentially four or six. We therefore analyzed tetrameric, pentameric, and hexameric constructs. However, a tetrameric or hexameric subunit organization was also not supported by the data, because the current magnitude decreased further when higher order concatamers were expressed. We can therefore not infer from these data any preferential formation of functional P2X₁ receptors from a particular concatamer. Qualitatively, the ATP-inducible currents recorded from oocytes expressing tandem constructs were virtually identical to those in oocytes expressing the wild-type P2X₁ monomer alone, as illustrated by the individual current traces in Fig. 2A.

View larger version (22K): [in this window] [in a new window]   Fig. 2.   Comparison of inward current responses generated by expression of P2X1 monomers and concatamers. Currents evoked by 30 µM ATP were recorded at 60 mV from oocytes injected with 25 ng of cRNA for the indicated P2X1 construct 3 days earlier. A, original current traces that have been scaled to the same amplitude for comparison of time courses. B, magnitudes of ATP-induced inward currents decrease with the order of the P2X1 concatamer expressed. Data are given as means ± S.E.M. from five to seven oocytes per column. *, p < 0.05, statistically significant difference from His-P2X2 dimer (unpaired Student's t test).

His-P2X₁ Concatamers Are Synthesized with the Expected Masses. When metabolically labeled His-P2X₁ concatamers were resolved by reducing SDS-PAGE, the isolated dimers and trimers appeared as bands at about 120 and 180 kDa, respectively (Fig. 3), compared with the monomer, which migrates as a 57- to 64-kDa glycoprotein depending on whether it was resolved on a linear (Fig. 4B) or on a gradient gel (Fig. 3). Concatamers larger than the trimer migrated at positions that are entirely consistent with the expected multiples of a 57-kDa P2X₁ monomer when run on linear gels (Fig. 4B), yet tended to migrate somewhat faster on gradient gels (Fig. 3). Nevertheless, the regular decrease in mobility of all the polypeptides with the order of the construct leaves no doubt that each of the five concatamers is synthesized with the expected mass of a full-length protein. Besides full-length concatamers, small amounts of monomeric and dimeric byproducts are visible (Fig. 3, lanes 3-8). Intermediate-sized byproducts smaller than the monomer or located between the monomer and the dimer were never observed.

View larger version (60K): [in this window] [in a new window]   Fig. 3.   Molecular masses and N-glycan content of His-P2X1 concatamers. Oocytes were labeled overnight with [35S]methionine and then extracted with digitonin (1%). Proteins were natively purified by Ni2+ NTA agarose chromatography, treated with PNGase F as indicated, and resolved by reducing SDS-PAGE (4-10% acrylamide). kD gives the molecular mass shifts induced by deglycosylation. Arrowheads indicate positions of lower order side products.

View larger version (42K): [in this window] [in a new window]   Fig. 4.   Oligomeric state and glycosylation state of total (plasma membrane-bound plus intracellular) His-P2X1 concatamers. His-tagged proteins were isolated under nondenaturing conditions from dodecylmaltoside (0.5%) extracts of metabolically labeled oocytes. A, oligomeric state. Protein complexes were resolved by blue native PAGE (5-13% acrylamide) either without further treatment or after incubation for 30 min at 37°C with 0.1 M DTT as indicated. Numbered arrows indicate positions of respective multimers. B, glycosylation state. Aliquots of the samples shown in (A) were treated with Endo H or PNGase F as indicated, and resolved by reducing SDS-PAGE (8% acrylamide). C, noninjected control oocytes.

All Potential N-Glycosylation Sites of P2X₁ Concatamers Are Used. A single P2X₁ polypeptide carries four N-glycans on the ectodomain, which increase the mass of the polypeptide by ~18%. To assess whether a given concatamer folds through the membrane with the predicted number of transmembrane segments (Fig. 1), the mass shift caused by full deglycosylation with PNGase F was determined (Fig. 3). To allow for precise mass determinations over the entire mass range, a calibration curve was constructed by plotting the log₁₀ of the masses of the protein cores predicted from the amino acid sequence of the various concatamers against their relative mobilities, thus using the P2X₁ concatamers as their own mass standards. Based on this calculation, each concatamer contains virtually the same mass fraction of N-linked carbohydrates [17.6 ± 1.2% (mean ± S.D.)] as the parent P2X₁ polypeptide. This indicates that the number of N-glycans increases in proportion with the number of P2X₁ copies incorporated in a concatamer, suggesting that each copy carries four N-glycans.

Full-Length P2X₁ Concatamers Are Retained as Aggregates in the ER. Because we did not find a preferential formation of functional P2X₁ receptors with any of the concatamers analyzed, we examined whether concatamers can by themselves homomultimerize into higher order assemblies. This has often been accounted for inconsistencies in the analysis of concatamers. Functional trimeric P2X₁ receptors could be generated, for instance, by dimerization of two dimers if one of the two dimers donated only one of its two P2X₁ copies to the receptor channel. For oligomer detection, we exploited blue native PAGE analysis, which is able to correctly display the pentameric nature of members of the nicotinic superfamily (Nicke et al., 1998; Griffon et al., 1999). When resolved by blue native PAGE, the P2X₁ receptor assembled from P2X₁ monomers exhibited a mobility corresponding to that of soluble marker proteins of an apparent molecular mass of approximately 250 kDa (Fig. 4A) as described previously (Nicke et al., 1998). The 250-kDa P2X₁ receptor protein consists of three noncovalently linked P2X₁ monomers. Reduction with DTT results in a partial dissociation of the 250-kDa protein into two lower-order bands of apparent masses of 170 and 80 kDa, which represent an intermediate dimer and the monomer, respectively (Fig. 4A, lane 6). These masses are larger than those found by SDS-PAGE analysis for the His-P2X₁ monomer or the concatenated dimer and trimer, because soluble proteins (used as markers) and membrane proteins can differ in their mobility in the BN-PAGE system (Schägger et al., 1994). Hence, the molecular masses obtained by BN-PAGE analysis must be regarded as relative values rather than absolute values (Nicke et al., 1998).

View larger version (63K): [in this window] [in a new window]   Fig. 5.   Visualization of plasma membrane-bound P2X1 receptor complexes produced from expressed concatamers. His-tagged proteins were isolated under nondenaturing conditions from dodecylmaltoside extracts (0.5%) of oocytes surface-labeled with membrane-impermeant 125I-sulfo-SHPP. A, oligomeric state. Protein complexes were resolved by blue native PAGE (4-13% acrylamide) either without further treatment or after incubation for 30 min at 37°C with 0.1 M DTT as indicated. Numbers beside arrows specify the number of P2X1 copies present in the respective protein either in the form of noncovalently linked monomers or concatamers. Irrespective of the order of the concatamer expressed, the plasma membrane contains only protein complexes equal in mass to the wild-type P2X1 receptor, which is a noncovalently linked homotrimer. Note that the amount of the 250 kDa protein was larger for (His-P2X1)2 (lane 2) than for (His-P2X1)3 in this particular experiment. In two other experiments, however, more 250-kDa protein was observed after expression of (His-P2X1)2 than for higher order concatamers consistent with the current magnitudes shown in Fig. 2B. B, aliquots of the same protein samples were treated with Endo H or PNGase F as indicated and resolved by reducing SDS-PAGE (8% acrylamide).

The Plasma Membrane Contains Primarily Monomeric and Dimeric Byproducts of Higher Order P2X₁ Concatamers. To examine whether full-length concatamers are incorporated into the plasma membrane, the cell surface of intact oocytes was selectively radioiodinated. His-tagged proteins were subsequently purified from digitonin or dodecylmaltoside extracts of these cells. Irrespective of the concatamer expressed, blue native PAGE analysis revealed one discrete 250-kDa protein band that migrated with exactly the same mobility as the noncovalently linked homotrimeric His-P2X₁ receptor (Fig. 5A, lanes 1-4). Treatment with DTT resulted in a dissociation of the 250-kDa band into P2X₁ dimers and monomers, indicating that the majority of the 250-kDa protein consisted of either three monomers or one monomer associated with a concatenated dimer (lanes 6-9). Only minor amounts of concatenated trimers reached the plasma membrane (lane 8). No significant assembly of concatamers resulting in complexes with more than three P2X₁ copies occurred. Likewise, no significant surface expression of (His-P2X₁)₄ was observed.

Monomeric and Dimeric Byproducts Do Not Originate from the Usage of Internal Methionines of Higher Order Concatamers. Internal translation initiation could be a possible source of lower order byproducts. The tandem P2X₁ dimer construct contains two AUG codons that, if used as internal initiation codons, would give rise to polypeptides of approximately the size of a P2X₁ monomer. One AUG encodes an endogenous methionine, M³⁹⁶, at the very C-terminal end of the N-terminal P2X₁ copy, and the second encodes a methionine residue in the linker sequence (Fig. 1, linker 1), designated M^Linker. To assess the possible contribution of these internal AUG codons on monomer formation, M³⁹⁶ and M^Linker were successively changed to serine and glycine, respectively (linker 2). In addition, we engineered a P2X₁ dimer with a modified linker consisting almost solely of 13 glutamine residues and lacking in particular the hexahistidyl sequence as well as M^Linker (Fig. 1, linker 3). Polyglutamine linkers have been widely used in previous studies for tethering of channel subunits (Isacoff et al., 1990; Hurst et al., 1992; Yang et al., 1995; Pessia et al., 1996; Varnum and Zagotta, 1996; Firsov et al., 1998). The encoded P2X₁ dimers were analyzed in respect to plasma membrane appearance of ATP-gated ion channels and protein accessible to surface radioiodination. Replacement of M³⁹⁶ or of M^Linker together with the hexahistidyl tag did not reduce the magnitude of ATP-gated currents in comparison with the parent P2X₁ dimer, as assessed by two-electrode voltage clamp analysis (Fig. 6A). Likewise, SDS-PAGE analysis of the surface radioiodinated P2X₁ dimer-derived polypeptides and subsequent quantification by PhosphorImaging of the monomer-to-dimer ratio at the plasma membrane showed no significant reduction of monomer formation upon deletion of internal methionines or the hexahistidyl tag (Fig. 6, B and C). Taken together these results argue against an important role of internal translation initiation in the generation of monomers from cRNA encoding concatenated P2X₁ dimers.

View larger version (30K): [in this window] [in a new window]   Fig. 6.   Effect of linker sequence on formation of monomeric side product from expressed tandem His-P2X1 dimers. Subgroups of oocytes injected with the indicated cRNAs were either labeled with [35S]methionine or kept unlabeled for later electrophysiological analysis and surface radioiodination. All oocytes were analyzed in parallel 3 days after cRNA injection. A, magnitudes of inward currents elicited by 30 µM ATP were recorded at 60 mV. Data are given as means ± S.E.M. from 22 to 36 oocytes per column analyzed in two to five independent experiments. B, subgroups of the same oocytes were either metabolically labeled overnight and then chased for 2 days or radioiodinated with 125I-sulfo-SHPP at day 3 after cRNA injection. His-tagged proteins were isolated from dodecylmaltoside extracts (0.5%) of the oocytes and resolved by reducing SDS-PAGE (8% acrylamide). C, shown are the amounts of concatenated dimers normalized to the respective monomeric byproduct, as determined by PhosphorImaging. Data are means ± S.E.M. from three independent experiments except for the tandem dimer with linker 2 and the M396S mutation, which was analyzed in a single experiment only (with identical results in duplicate determinations). Note that the monomeric side product was always present in larger amounts than the tandem dimers, suggesting that dimers require to combine with a monomer for export to the cell surface.

The Monomeric Byproduct Originates Predominantly from the P2X₁ Copy in the N-Terminal Position. Alternative mechanisms that may lead to the generation of monomeric byproducts are premature termination of translation and proteolytic cleavage of full-length concatamers. Whereas premature translation termination can be expected to favor the expression of the leading copy of a concatenated P2X₁ dimer, proteolytic cleavage within the linker region may produce two functional P2X₁ monomers. To discriminate between these possibilities, we examined whether or not both copies of a P2X₁ dimer contribute equally to the generation of monomeric byproducts. To this end, we took advantage of a nonfunctional His-P2X₁^R34L mutant, which is exported to the plasma membrane as a noncovalently linked trimer but does not mediate any ATP-gated inward current (results not shown). Concatenated P2X₁ dimers were tagged with this nonfunctional His-P2X₁^R34L subunit either at the N-terminal or the C-terminal position. Recording of the ATP-gated currents in oocytes expressing the concatenated dimer constructs showed significantly larger currents when the nonfunctional His-P2X₁^R34L subunit was at the C-terminal rather than at the N-terminal position. The relatively low current amplitudes observed from tandem dimers containing one copy of the R³⁴L mutant compared with the His-P2X₁ dimer suggests a dominant-negative effect of the R³⁴L mutation, which may lead to a nonfunctional receptor even if only one copy of this mutant is incorporated into a trimeric channel complex.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

In the present study, we exploited the concatamer approach for the determination of the subunit stoichiometry of the homomeric P2X₁ receptor. We show that P2X₁ concatamers up to the hexamer are readily synthesized in X. laevis oocytes as full-length glycoproteins, yet the plasma membrane contains monomeric and dimeric byproducts of the P2X₁ concatamers rather than the full-length concatamers. These byproducts exist as complexes of one dimer plus one monomer or three monomers (Fig. 7) and are thus indistinguishable in mass from an authentic homotrimeric P2X₁ receptor formed upon expression of nonconcatenated P2X₁ subunits. We infer from these results that ATP-gated inward currents that could be elicited from all oocytes irrespective of the order of the concatamer expressed are largely mediated by receptor complexes assembled from monomeric and dimeric byproducts, which accordingly constitute the principal functional elements of higher order P2X₁ concatamers. The sole full-length concatamers that appear in significant amounts at the plasma membrane are the P2X₁ dimer and trimer, but in these cases, similar or even higher amounts of the monomeric byproduct are also present.

View larger version (26K): [in this window] [in a new window]   Fig. 7.   Cartoon showing the formation of trimeric P2X1 receptors from concatenated P2X1 dimers, trimers, and tetramers. The left hand displays possible subunit arrangements of concatamers comprising two to four P2X1 subunit copies in the ER. Inconsistencies with the concatamer approach have previously been attributed to the exclusion of individual copies () of a given concatamer from a functional arrangement of subunits around an ion pore. In the case of P2X1 concatamers, however, only concatenated P2X1 trimers appear at the plasma membrane by themselves (right). Dimers can only exit the ER after combining noncovalently with a P2X1 monomer, formed as a byproduct and representing the leading copy of another P2X1 dimer. Alternatively, three such monomeric byproducts corresponding to the leading copies of three dimers can noncovalently assemble to a trimeric P2X1 receptor complex. Finally, the fourth copy of a concatenated tetramer can be cleaved off to yield a concatenated P2X1 trimer that can exit the ER. Altogether, although full-length P2X1 concatamers are efficiently synthesized in X. laevis oocytes, solely proteins equivalent to three P2X1 subunit copies are exported to the plasma membrane.

Possible Origin of Lower Order Byproducts. Any explanation of the origin of the lower order byproducts has to take into account that (i) only uniform populations of both monomers and dimers are produced, which have exactly the length of one copy or two copies of a P2X₁ polypeptide, respectively, and that (ii) functional P2X₁ receptors include predominantly the leading P2X₁ copy of tandem dimers. These observations exclude partially degraded cRNA, unspecific proteolytic degradation, and internal translation initiation within the linker region as a possible source of byproducts. The latter was further ruled out by mutational deletion of ATGs shortly before and within the linker sequence, which did not reduce the formation of monomers from tandem dimers. Premature termination of translation because of unfavorable secondary cRNA structures in the linker region could basically explain both the truncation after the first or second repeat and the prominent role of the leading P2X₁ copy of tandem dimers to the formation of functional receptors. However, computational analysis provided no indication for the presence of stable hairpin-like structures. Even more importantly, no lower order byproducts were seen upon translation of the concatamers in vitro (results not shown), indicating that byproduct formation requires intact cells.

Concatamer Strategy. Although the usefulness of the concatamer approach has been carefully documented (see Introduction), several electrophysiological studies suggest that the tandem linkage does not always ensure the subunit stoichiometry (McCormack et al., 1992; Liman et al., 1992; Hurst et al., 1995). Even in studies with otherwise well constrained stoichiometry, certain concatenated K_v trimers and pentamers (Liman et al., 1992), as well as certain K_ir trimers (Silverman et al., 1996), unexpectedly yielded large currents when expressed alone. Such inconsistencies with the concatamer approach have generally been attributed to the multimerization of full-length concatamers (McCormack et al., 1992; Hurst et al., 1995; Yang et al., 1995; Shapiro and Zagotta, 1998; Stoop et al., 1999). In this way, one or several repeats of separate concatamers become incorporated into a channel, leaving other repeats of the same polypeptides outside the channel.

Trimeric Architecture of P2X Receptors. The present data demonstrate that the concatamer approach does not assure the subunit arrangement of the P2X₁ receptor but nonetheless corroborates the trimeric structure of P2X₁ receptors. First, the concatenated P2X₁ trimer migrates exactly with the same mobility as the parent P2X₁ receptor consisting of three noncovalently linked monomers. Second, monomers and dimers appear at the plasma membrane in approximately stoichiometric amounts, suggesting that the amount of monomers available to combine with dimers most likely constitutes the limiting factor for ER exit of full-length P2X₁ dimers to the plasma membrane; hence, a trimer constitutes the sole complex that can adopt a conformation able to pass the quality control system. Third, tetramers are not exported to the plasma membrane, indicating that tetramers can adopt only a non-native conformation that does not allow for ER exit. Fourth, free dimers (i.e., those without an associated monomer) or oligomerized dimers such as tetramers or hexamers were not observed to occur at the plasma membrane. In our previous study, we could not exclude that P2X₁ trimers assemble to form larger entities such as hexamers and nonamers. From the present observation, we infer that trimers constitute the sole P2X₁ receptor conformation capable of passing the ER quality control system; hence, trimers represent the "correct" architecture of homomeric P2X₁ receptors.