![]() |
|
|
Vol. 63, Issue 3, 653-658, March 2003
Department of Pharmacology, Yale University School of Medicine, New Haven, Connecticut
| |
Abstract |
|---|
|
|
|---|
Dopamine transporter (DAT) is a major target of cocaine, one of the most abused drugs. Major efforts have been focused on defining residues in DAT involved in cocaine binding. We have isolated the Drosophila melanogaster DAT (dDAT) cDNA, which is 10-fold less sensitive to cocaine than the mammalian DATs. Replacing transmembrane domain 2 (TM2) of mouse DAT (mDAT) with dDAT sequence reduced cocaine sensitivity. The reciprocal construct exhibited increased cocaine sensitivity. Switching residue 105 in TM2, a phenylalanine conserved in all mammalian DATs, to methionine, the corresponding residue in dDAT, resulted in a functional transporter with cocaine sensitivity 4-fold lower. Replacing F105 with alanine, leucine, isoleucine, serine, threonine, asparagine, or glutamine resulted in transporters with low transport activity. In contrast, changing F105 to the other aromatic residues tyrosine or tryptophan retained more than 75% transport activity and high cocaine sensitivity. Most significantly, the reciprocal construct, switching the methionine in dDAT at the corresponding residue to phenylalanine, increased cocaine sensitivity 3-fold. Finally, the mDAT mutant with a cysteine at this position had normal transport activity but exhibited cocaine sensitivity that was 15-fold lower. These results suggest that F105 in mDAT contributes to high-affinity cocaine binding. The functional cocaine-insensitive mutants provide tools for the study of the mechanism of cocaine addiction.
| |
Introduction |
|---|
|
|
|---|
Nerve
cells communicate with each other and with other cells by releasing
neurotransmitters which bind to their respective receptors on target
cells, thus transmitting the signals. Neurotransmitter transporters
terminate neurotransmission by the reuptake of the released
neurotransmitters from synaptic clefts and surrounding areas (Iversen,
1971
; Kanner and Schuldiner, 1987
). The cloning of the rat
-aminobutyric acid-1 transporter (Guastella et al., 1990
), the human
norepinephrine transporter (Pacholczyk et al., 1991
), and later other
transporters established the presence of a gene family of
Na+-and Cl
-dependent
neurotransmitter transporters (Amara and Arriza, 1993
; Rudnick and
Clark, 1993
).
Transporters for the biogenic amines dopamine (DA),
5-hydroxytryptamine, and norepinephrine are high-affinity targets for cocaine and amphetamines (Ritz et al., 1987
; Giros and Caron, 1993
; Gu
et al., 1994
). These stimulants are highly addictive and thus are major
drugs of abuse worldwide. The biogenic amine transporters are also
molecular targets for therapeutic agents such as bupropion,
methylphenidate, imipramine, desipramine, fluoxetine, and sertraline,
which are used in the treatment of neurological and mood disorders such
as attention-deficit/hyperactivity disorder, minimal brain dysfunction,
depression, and others (Koe, 1990
; Goodnick, 1991
; Barr et al., 1992
;
Boyer and Feighner, 1992
; Ascher et al., 1995
; Klein, 1995
; Seeman and
Madras, 1998
; Smith et al., 1998
). These agents bind to the biogenic
amine transporters, disrupt transport function, and thereby prolong
transmitter presence in the extracellular spaces of the brain. This
leads to the profound psychiatric effects.
A wealth of evidence suggests that dopamine pathways are involved in
the addiction process of cocaine. It has been proposed that the
dopamine transporter plays the most important role in the mechanism of
cocaine addiction among the three biogenic amine transporters (Ritz et
al., 1987
). To identify regions and residues that may be involved in
cocaine binding directly or indirectly, several groups of investigators
have made numerous DAT mutants. They made chimeric constructs between
transporters with distinct properties or mutated selected Phe, Tyr,
Trp, Pro, and other residues and tested the effects of these mutations
on the binding affinity of cocaine analogs and/or sensitivity to
cocaine inhibition of transport (Kitayama et al., 1992
; Giros et al.,
1994
; Buck and Amara, 1995
; Lin et al., 1999
, 2000
; Chen et al., 2001
).
These efforts provided some information about specific regions or
single amino acid residues in DAT that might be involved in cocaine binding.
In this study, we isolated a cDNA encoding the Drosophila melanogaster dopamine transporter (dDAT). This transporter is 10-fold less sensitive to cocaine inhibition than the mouse dopamine transporter (mDAT). Comparison studies between dDAT and mDAT revealed that TM2 and specifically Phe 105 in TM2 are involved in cocaine binding.
| |
Materials and Methods |
|---|
|
|
|---|
Isolation of the D. melanogaster Dopamine
Transporter cDNA.
A tube of approximately 100 live fruit flies was
chilled in a freezer at
80°C for 1 min and poured into cell-lysing
buffer from the RNeasy Total RNA Kit (QIAGEN, Valencia, CA). They were homogenized using three 10-s bursts with a polytron homogenizer (model
PT 10/35, Brinkmann Instruments, Westbury, NY). Total RNA was purified
according to the kit protocol. Poly(A) RNA was isolated using the
Oligotex mRNA Kit (QIAGEN). The RNA preparations were stored in a
freezer at
80°C until use. cDNA was synthesized using a specially
designed oligonucleotide, QT, as the primer.
QT contains 22 Ts at the 3' end that anneal to
mRNA poly(A) tails and a stretch of 30 nucleotides that can be annealed
to by two anchor primers (Qin and
Qout) (Wu and Gu, 1999
). Reverse transcription
was performed using avian myeloblastosis virus reverse transcriptase
(Roche Diagnostics, Mannheim, Germany) at 48°C and Moloney murine
leukemia virus reverse transcriptase (New England Biolabs, Beverly, MA) at 42°C following manufacturer's protocols. The products from the
two reactions were pooled. The mRNA was then degraded with Ribonuclease
H (Invitrogen, Carlsbad, CA) treatment, and the cDNA was cleaned
with the QIAquick DNA purification kit (QIAGEN) and stored at
80°C.
Numerous oligonucleotide primers were synthesized according to the DNA
sequences from the D. melanogaster database, including
forward primers FP1 (GAGCGCGAAACATGGAGC), FP2
(TTTTATTATCGGTTATTGGATTCGC), and FP3 (AATTGGTACCGGCGGCGGGATCTCCAC), and
reverse primer RP1 (ACCTAAGCTTTATAGATGGCACTAAAG). Polymerase chain
reactions (PCRs) were performed using outer primers FP1 and
Qout for the first round and inner primers FP2
and Qin for the second round, yielding the 3'
portion of the dDAT cDNA. The 5' portion of the cDNA was PCR-amplified
using primers Fp3 and RP1. The full-length coding region was then
amplified with primers annealing to regions just outside the coding
sequence. The final PCR reactions were performed using Pfu polymerase
(Stratagene, La Jolla, CA), which has a much lower error rate than
Taq polymerase. The cDNA clones were sequenced in both
directions by the sequencing facility at Yale University (New Haven, CT).
Chimeric and Mutant Transporter Construction.
There are
numerous unique restriction enzyme (RE) sites within the mDAT cDNA.
Additional RE sites were also introduced by silent mutations. Chimeric
transporters were constructed by replacing a region of mDAT between two
RE sites with a PCR fragment of dDAT cDNA amplified with primers
incorporating the proper RE sites. Site-specific mutagenesis was
performed using a method similar to that described by Nelson and Long
(1989)
. The sequences of the chimeric and mutant constructs were
confirmed by sequencing.
Functional Analysis.
We subcloned the dDAT and mDAT cDNA
into a bluescript vector (Strategene) with a T7 promoter. The cDNAs
were transiently expressed in monkey intestine 407 cells (CCL-6,
American Type Culture Collection, Manassas, VA) and characterized as
described previously (Blakely et al., 1991
; Gu et al., 1994
; Wu and Gu,
1999
). Briefly, cells were plated in 48-well or 96-well plates,
transfected with plasmid DNA using Lipofectin (Invitrogen), and
infected with a recombinant vaccinia virus VTF-7 which carries the T7
polymerase gene. After overnight incubation, the cells were washed once
with assay buffer (phosphate-buffered saline solution supplemented with
1 mM MgCl2, 0.1 mM CaCl2,
and 50 µM L-ascorbic acid) and incubated in assay buffer
containing 3H-labeled dopamine and/or other
reagents (as described in each figure legend) for a predetermined
length of time at 22°C. At the end of the incubation, cells were
washed three times with the same buffer and then dissolved in 0.1 M
NaOH. The amounts of substrates accumulated in the cells were
determined by counting in scintillation fluid (OPTI-FLUOR, PerkinElmer
Life Sciences, Boston, MA) in a liquid scintillation counter.
All experiments were performed in triplicate. The
KM and IC50
values were determined by nonlinear regression fits of experimental
data using the computer program Origin (OriginLabCorp, Northampton, MA).
Materials. [3H]dopamine was purchased from PerkinElmer Life Sciences. Cocaine was obtained from Sigma Chemical Co. (St. Louis, MO). Oligonucleotides were synthesized by the Pathology Department DNA Synthesis Lab at Yale University. All other reagents were from commercial sources.
| |
Results |
|---|
|
|
|---|
Isolation of dDAT cDNA.
We searched the genomic DNA database
of D. melanogaster and found many segments of sequenced DNA
that encoded proteins or portions of proteins with sequences similar to
the mammalian biogenic amine transporters. One of these deposited DNA
sequences in GenBank (accession number AC005647) contains the gene
exhibiting the highest homology to mammalian dopamine transporters. We
designed two forward primers, 51006 and 51007, which anneal to the
region around the first transmembrane domain. Two rounds of nested PCR amplification yielded a DNA fragment of 1.9 kilobases using these two
forward primers and two reverse anchor primers
(Qin and Qout, see
Materials and Methods). Next, we searched the GenBank
expressed sequence tags database and found a 5' end partial mRNA
sequence (accession number AI403478) that overlapped with the sequence of our cDNA fragment. We synthesized forward primers according to this
partial mRNA sequence and reverse primers annealing to the cDNA
fragment. We then PCR-amplified the 5' portion of the cDNA and ligated
it with the 3' portion at an overlapping restriction site (EcoN1) to
yield the full-length cDNA (accession number AF439752). We further
confirmed the presence of this full-length cDNA by amplifying the
entire coding region with primers annealing at the start and stop
codons. The encoded transporter protein has 51% residues identical
with mouse DAT, 52% with mouse norepinephrine transporter, 48% with
mouse serotonin transporter (SERT), and 47% with D. melanogaster SERT. When expressed in cultured cells, this
transporter takes up dopamine and norepinephrine as substrates but not
serotonin, suggesting that this transporter is a catecholamine transporter. We searched the nearly complete D. melanogaster
genome and other D. melanogaster databases but failed to
find any other genes or cDNAs that are likely to be a catecholamine
transporter. Recently, Porzgen et al. (2001)
described the isolation
and characterization of the same transporter cDNA and deposited the
sequence of the coding region in GenBank (AF260833). They determined
that this cDNA encodes a dopamine transporter from its restricted
expression in dopaminergic cells. Among the three independently cloned
dDAT sequences, there are 11 discrepancies within the coding region at
the nucleotide level. Ten of these discrepancies are at the third
position of codons and do not result in changes in protein sequence. In
our dDAT sequence, the genomic sequence, and the partial 5' mRNA
sequence, nucleotides 46 to 48 (with the start codon as +1) are CAC,
encoding amino acid residue number 16 as histidine, whereas the same
nucleotides in the other dDAT mRNA sequence (AF260833) are CGC encoding
an arginine.
Comparison of dDAT, mDAT, and Their Chimeras.
We expressed the
cDNAs in intestine 407 cells using the vaccinia-T7 transient expression
system. Figure 1 shows that dDAT has
similar DA uptake kinetics but is approximately 10-fold less sensitive
to cocaine inhibition compared with mDAT (IC50 = 10.8 µM versus 0.95 µM). To identify the regions that are
responsible for the difference in cocaine sensitivity between dDAT and
mDAT, we made 10 chimeric constructs of the two transporters (dmDAT1 to
dmDAT10) (Fig. 2). Most of these chimeric
transporters have very low or no DA transport activity, except for
dmDAT1 and dmDAT6. Chimera dmDAT1 is mostly dDAT with only a short mDAT
N terminus before the first transmembrane domain (TM1), and it has
virtually the same properties as dDAT. In contrast, switching the
intracellular C-terminal tails of the two transporters (dmDAT2 and
dmDAT3) resulted in chimeras with low transport activity (Fig.
3A). Generally, replacing one or more TMs
from one transporter with that from the other transporter resulted in
chimeras (dmDAT4, -5, -7, -8, -9, and -10) (Fig. 2B) with low or no
transport activity (data not shown). There were two exceptions: the TM1
sequences from mDAT and dDAT are identical, and switching the TM2
sequences between mDAT and dDAT was well tolerated (dmDAT6) (Figs. 2A
and 3A). Residue 121 in dDAT is an aspartate among hydrophobic residues
of putative TM3. In contrast, all mammalian transporters for dopamine
and norepinephrine have a glycine at the corresponding position, and an
alanine is conserved at this position in all mammalian SERTs. To test
whether this potentially disruptive acidic residue in the transmembrane
domain was the reason that dmDAT8 was not functional, we changed this
residue to Gly in dmDAT8. The resulting mutant remained nonfunctional
(data not shown), suggesting that other dDAT residues in dmDAT8 besides
Asp 121 also contribute to the inactivation of the chimeric
transporter.
|
|
|
Further Mutagenesis of TM2.
Chimera dmDAT6 is mostly
mDAT sequence with TM2 and part of internal loop 1 (IL1) replaced by
dDAT sequence (Fig. 2A). This chimera exhibited DA transport activity
similar to that of mDAT but significantly lower sensitivity to cocaine
inhibition (IC50 = 3.2 µM), suggesting that the
region replaced by dDAT sequence may contribute to cocaine binding in
the dopamine transporter. To narrow down the region as a potential
cocaine binding site, five more chimeric transporters were constructed
(Fig. 2A). All of these chimeras were functional and exhibited
differing sensitivities to cocaine inhibition (Figs. 2A and 3A and
Table 1). Chimeras having mostly mDAT
sequence with only the partial IL1 (dmDAT6a), all of TM2 (dmDAT6b), or
only the upper portion of TM2 (dmDAT6c) from dDAT exhibited lower
sensitivity to cocaine than wt mDAT (IC50 = 1.8, 2.1, and 4.54 µM, respectively), suggesting that both IL1 and TM2
regions affect cocaine binding. More significantly, the reciprocal
construct (dmDAT6d) (Fig. 2), which contains mostly dDAT sequence with
only TM2 from mDAT, exhibited increased cocaine sensitivity
(IC50 = 4.3 versus 10.8 µM for dDAT), which is
a shift from dDAT toward mDAT. When only the lower portion of mDAT TM2 was inserted into dDAT (dmDAT6d), the resulting construct (dmDAT6e) exhibited lower cocaine sensitivity than dDAT
(IC50 = 17.9 µM). We also measured cocaine
sensitivity for dmDAT2, -3, and -9, which have 20 to 30% wt transport
activity. The IC50 values for these mutants are
6.2, 0.9, and 2.4 µM, respectively.
|
Point Mutations at Residue 105.
These results suggest that the
upper portion of TM2 may be involved in cocaine binding. There are four
residues in this region that differ between mDAT and dDAT. Residue 105 is a methionine in dDAT but a phenylalanine in mDAT, which is conserved
among all mammalian DATs and norepinephrine transporter. We substituted Phe 105 in mDAT with a Met. The point mutation (mDAT-F105M) caused a
significant decrease in cocaine sensitivity (IC50 = 3.1 µM versus 0.95 µM). Next, we made the reciprocal construct,
replacing the Met in dDAT at the corresponding position with Phe. The
resulting mutant dDAT-M72F exhibited increased sensitivity to
cocaine inhibition of transport (IC50 = 3.5 versus 10.8 µM for dDAT). We then focused on F105 and substituted the
residue with amino acids with varying side chain properties.
Substitutions with Ala, Ser, Thr, Leu, Ile, Asn, and Gln resulted in
mutants with low or no transport activity (Fig. 3B). Replacing Phe 105 with the other two aromatic amino acids tyrosine or tryptophan not only
retained transport function (Fig. 3B), but also high sensitivity to
cocaine inhibition (IC50 = 0.66 and 0.53 µM,
respectively) (Fig. 4 and Table 1). Substitution of F105 with cysteine resulted in a mutant that is even
less sensitive to cocaine than dDAT (IC50 = 13.9 µM). To determine whether the loss of transport activity by mutants
at residue 105 were caused by intrinsic defects on uptake or poor expression at the plasma membrane, we added a Flag tag (peptide sequence: DYKDDDDK) to the C termini of wt mDAT and 9 mutants with
substitutions at residue 105. We then measured the surface expression
levels of these DAT constructs by expressing them in cultured cells,
biotinylating surface proteins, isolating the biotinylated proteins
with streptavidin-agarose beads, and Western blotting using antibodies
against the Flag tag (Gu et al., 1996
). The constructs with low or no
transport activity had lower but detectable expression on the cell
surface (data not shown), suggesting that both intrinsic defects and
poor surface expression contribute to low transport activity by the
mutants.
|
| |
Discussion |
|---|
|
|
|---|
Through evolution, nature has provided a large number of variant
forms of the same protein from diverse species. These protein variants
often exhibit substantial differences in their functional properties
and/or binding to drugs, which provide clues of regions or residues
responsible for the differences. Comparison studies of protein variants
from diverse species could reveal the structural bases of functional
properties. This strategy has been successfully used to localize
domains and residues critical for receptor-ligand interaction in G
protein-coupled receptors (Fong et al., 1992
; Oksenberg et al., 1992
;
Hall et al., 1993
) and to identify residues important for drug binding
in biogenic amine transporters (Barker et al., 1998
; Lee et al., 2000
).
In this study, we cloned the full-length cDNA encoding the dopamine
transporter from D. melanogaster. This transporter exhibits
significant differences from mammalian DATs in binding cocaine and
other drugs, such as amphetamine, bupropion, methylphenidate (Ritalin),
fluoxetine, desipramine, and paroxetine (data not shown). The cloning
of dDAT provides us and other investigators with a tool to identify the
residues responsible for the differences in functional properties
between dDAT and the mammalian DATs. Through comparison studies of mDAT and dDAT, we were able to determine that the phenylalanine residue at
position 105 in mDAT is involved in cocaine binding, either by
interacting directly with cocaine or by keeping the transporter in the
conformation required for high-affinity cocaine binding.
Three independently cloned dDAT sequences have been deposited in
GenBank. Of the 11 discrepancies in the coding regions of these dDAT
sequences, 10 are at the third positions of codons and thus do not
result in changes in their predicted amino acid sequences. This
phenomenon has been observed in several other transporters cloned from
other insects in our laboratory (data not shown). Porzgen et al. (2001)
also cloned dDAT and determined that the IC50
value of cocaine inhibition of transport for dDAT was approximately
10-fold higher than that for hDAT, which is in agreement with our results.
The dopamine transporters from the two diverse species, mouse and
D. melanogaster, have only 51% of amino acid residues that are identical. Despite similar transport properties for the two parent
transporters, most chimeric constructs between mDAT and dDAT, even
constructs with a single TM region replaced, are not functional. This
result suggests that the interactions between different parts of the
protein are critical to form a functional transporter. When the N
terminus of dDAT was replaced with that from mDAT (dmDAT1), the chimera
had the same properties as the wild-type dDAT, suggesting that the N
terminus is not essential in the transport function of the protein
expressed in cultured cells. This is consistent with our earlier result
showing that the N terminus-deleted DAT mutant still exhibited full
transport activity (Gu et al., 1996
). In contrast, chimeras with
switched C termini between mDAT and dDAT (dmDAT2 and dmDAT3) had
significantly reduced transport activity. Because the C termini from
both species function well in the wt mDAT and dDAT, this result
suggests that the C terminus from one species and the rest of DAT from
the other species are not compatible with certain mechanism(s),
possibly because of interactions with other proteins necessary for
correct trafficking and surface expression.
The sequences of TM1 from mDAT and dDAT are identical, and switching TM2 between the two transporters is well tolerated. Substitution of TM2 or only the upper part of TM2 in mDAT with corresponding regions of dDAT (dmDAT6b and -6c) decreased cocaine potency to inhibit transport. More importantly, the reverse construct, dDAT with mDAT TM2 (dmDAT6d) exhibited higher potency to cocaine inhibition than did wt dDAT. Replacing only the lower part of TM2 from dDAT with mDAT sequence did not result in increased cocaine sensitivity. This result suggests that certain residue(s) in the upper part of mDAT TM2 that is absent in dDAT TM2 may be important in cocaine binding. Substitution of the Phe residue at position 105 within this region of mDAT with a Met, the corresponding residue in dDAT (mDAT-F105M), reduced cocaine potency, whereas switching the corresponding Met in dDAT to Phe (dDAT-M72F) increased cocaine sensitivity (IC50 = 3.1 versus 10.8 µM for dDAT). Switching residues at many positions between mDAT and dDAT may alter their cocaine binding pockets, resulting in decreased cocaine sensitivity, whereas only very limited number of switches at specific residues from dDAT to mDAT will change the cocaine binding pocket in dDAT toward that of mDAT resulting in increased cocaine sensitivity. These specific residues are likely to contribute to cocaine binding.
Substitutions of Phe 105 in mDAT with nonaromatic amino acids resulted in mutants with low or no transport activity or in mutants with decreased cocaine binding affinity. This result suggests that this residue is in a region that is important for transport function and cocaine binding. Replacing F105 with either of the other two aromatic residues Tyr and Trp not only retained transport function, but also retained high sensitivity to cocaine inhibition. This result suggests that an aromatic residue at this position contributes to high-affinity cocaine binding by either a direct aromatic interaction with cocaine or an aromatic interaction with other residues to maintain the cocaine binding pocket in the required conformation for high-affinity cocaine binding. To examine the pharmacological features of the DAT mutants at physiological temperature, we also measured the cocaine inhibition IC50 values at 37°C for mDAT, dDAT, mDAT-105M, and mDAT-105C. The IC50 values at 37°C were not significantly different from those at 22°C (data not shown).
There are two types of conceivable mutations that could decrease ligand binding: 1) a mutation that takes away one of several specific interactions between the ligand and its target protein; and 2) a mutation that introduces a disruption, making other specific interactions weaker. At position 105 in mDAT, all aromatic residues (Phe, Tyr, or Trp) allowed strong cocaine binding, suggesting a possible specific aromatic interaction. When this interaction was taken away by inserting a Met at that position, the cocaine affinity decreased. Moreover, when Cys was placed at that position, cocaine sensitivity decreased even more, lower than that of dDAT, suggesting that switching to Cys not only removes a possible specific aromatic interaction, it also introduces a disruption or a change in the binding pocket that weakens other interactions between DAT and cocaine. At the equivalent position of mDAT-105F, serotonin transporters have a methionine residue, but they serve as good binding sites for cocaine. The residue three positions down (one helical turn) is a phenylalanine in the SERTs, whereas it is an isoleucine in the DATs. It is possible that this Phe residue in the SERTs plays a role similar to that of F105 in the DATs. It is also possible that cocaine binding in the SERTs does not require an aromatic residue at this position.
Previous reports have identified residues involved in cocaine binding.
Ritz et al. (1987)
, Kozak (1991)
, and Ritz and Kuhar (1993)
mutated a
large number of aromatic resides and prolines located in or near the
putative transmembrane domains and found that some of the mutations
decreased binding affinity to cocaine analog CFT without significantly
affecting dopamine uptake. More recently they reported that changing
F154 in TM3 to alanine retains normal DA uptake but lowers cocaine
affinity by 10-fold (Lin and Uhl, 2002
). Using a similar approach, Chen
et al. (2001)
found that mutant D68N in hDAT exhibited transport
activity that was nearly that of wt hDAT and 4-fold lowered sensitivity
to cocaine. They also showed that mutant D345N lost the ability to bind
CFT completely but was still inhibited by cocaine, demonstrating that CFT binding affinity may not always be a good indication of cocaine sensitivity. Reith et al. (2001)
showed that modification of C90 in
hDAT by methanethiosulfonate reagents increased CFT affinity. Barker et al. (1998)
identified residues in SERT that were important for the binding of drugs by species-scanning mutagenesis between hSERT
and dSERT. They reported that Y95F in hSERT retained normal transport
function but had 5-fold increased cocaine sensitivity. These studies
and current work contribute to defining where and how cocaine binds to
the transporters, which will help in designing new drugs for the
treatment of cocaine addiction.
| |
Acknowledgments |
|---|
We are very grateful to Dr. Gary Rudnick for sharing laboratory resources generously and to Dr. Megan Stephan for critical reading of this manuscript and very helpful discussions.
| |
Footnotes |
|---|
Received August 5, 2002; Accepted November 21, 2002
1 Current address: Molecular Staging, Inc., 300 George Street, 7th floor, New Haven, CT 06511.
This work was supported by a grant from the National Institute on Drug Abuse.
Address correspondence to: Howard H. Gu, Department of Pharmacology, Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06520-8066. E-mail: howard.gu{at}yale.edu
| |
Abbreviations |
|---|
DA, dopamine;
DAT, dopamine transporter;
PCR, polymerase chain reaction;
RE, restriction enzyme;
SERT, serotonin
transporter;
mDAT, mouse dopamine transporter;
dDAT, Drosophila melanogaster dopamine
transporter;
TM, transmembrane domain;
IL, internal loop;
wt, wild
type;
hDAT, human dopamine transporter;
CFT, 2
-carbomethoxy-3
-(4-fluorophenyl)tropane.
| |
References |
|---|
|
|
|---|
-carbomethoxy-3
-(4-fluorophenyl)tropane binding of dopamine transporter.
Mol Pharmacol
57:
883-889This article has been cited by other articles:
![]() |
X. Huang and C.-G. Zhan How Dopamine Transporter Interacts with Dopamine: Insights from Molecular Modeling and Simulation Biophys. J., November 15, 2007; 93(10): 3627 - 3639. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Beuming, L. Shi, J. A. Javitch, and H. Weinstein A Comprehensive Structure-Based Alignment of Prokaryotic and Eukaryotic Neurotransmitter/Na+ Symporters (NSS) Aids in the Use of the LeuT Structure to Probe NSS Structure and Function Mol. Pharmacol., November 1, 2006; 70(5): 1630 - 1642. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chen, M. R. Tilley, H. Wei, F. Zhou, F.-M. Zhou, S. Ching, N. Quan, R. L. Stephens, E. R. Hill, T. Nottoli, et al. Abolished cocaine reward in mice with a cocaine-insensitive dopamine transporter PNAS, June 13, 2006; 103(24): 9333 - 9338. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Melamed and B. I. Kanner Transmembrane Domains I and II of the {gamma}-Aminobutyric Acid Transporter GAT-4 Contain Molecular Determinants of Substrate Specificity Mol. Pharmacol., June 1, 2004; 65(6): 1452 - 1461. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sato, Y.-W. Zhang, A. Androutsellis-Theotokis, and G. Rudnick Analysis of Transmembrane Domain 2 of Rat Serotonin Transporter by Cysteine Scanning Mutagenesis J. Biol. Chem., May 28, 2004; 279(22): 22926 - 22933. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Loland, C. Granas, J. A. Javitch, and U. Gether Identification of Intracellular Residues in the Dopamine Transporter Critical for Regulation of Transporter Conformation and Cocaine Binding J. Biol. Chem., January 30, 2004; 279(5): 3228 - 3238. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||