![]() |
|
|
B
Department of Pharmacology, Southern Illinois University School of Medicine, Springfield, Illinois (S.C.P, D.M.H, V.R.); and Department of Microbiology and Immunology, University of Rochester Medical Center, Rochester, New York (J.F.S, A.L.W, S.B.M)
Received September 16, 2002; accepted February 24, 2003
| Abstract |
|---|
|
|
|---|
B. Hypertonicity regulates the activity of NF-
B in
different cell lines; as such, we propose that it should also regulate the
expression of iNOS. Thus, the goal of this study was to determine whether
hypertonicity regulates iNOS expression and function in smooth muscle cells
and to elucidate the mechanism(s) underlying this process. Treatment of
hamster ductus deferens (DDT1MF-2) cells and porcine aortic smooth
muscle cells with either mannitol (50 mM) or NaCl (50 mM) reduced
LPS-stimulated iNOS expression and nitric oxide release. Both of these agents
also reduced the activation of NF-
B induced by LPS, tumor necrosis
factor-
and interleukin-1
in smooth muscle cells. This inhibitory
action was caused by suppression of I
B-
phosphorylation, a
prerequisite for ubiquitination and degradation of this protein, and showed
additivity with N-benzoyloxycarbonyl (Z)-Leu-Leu-leucinal
(MG-132), an inhibitor of proteasomal degradation of I
B-
.
Furthermore, exposure to mannitol inhibited the activity of I
B kinase,
an enzyme involved in phosphorylation of I
B-
. Mannitol was
unable to affect the induction of iNOS produced by overexpression of RelA in
DDT1MF-2 cells, suggesting that this agent does not have additional
downstream inhibitory actions on this activated NF-
B subunit. Taken
together, these data suggest that these hypertonic solutions may prove useful
as anti-inflammatory agents, especially against conditions associated with
increased NF-
B activity.
(Cohen et al., 1996
Less is known concerning the involvement of nuclear factor (NF)-
B in
mediating cellular responses to hyperosmotic stress. Exposure of normal skin
fibroblasts to hyperosmotic concentrations of sucrose or NaCl inhibited
NF-
B activity induced by TNF-
(Andrieu et al., 1995
).
Similarly, hypertonicity produced by mannitol reduced the activation of
NF-
B and IL-8 production elicited by Helicobacter pylori
(Kim et al., 1999
). In
contrast, exposure to hyperosmotic glucose solutions elicited NF-
B
activation in vascular smooth muscle cells
(Hattori et al., 2000
). In rat
hepatoma cells, whereas hyperosmolarity produced little change in NF-
B
activity, hypo-osmolarity induced sustained activation of this transcription
factor (Michalke et al.,
2000
).
NF-
B plays a pivotal role in communicating the signals from
cytokines, toxins, and various stressors to regulation of gene expression.
Activation of NF-
B is initiated by phosphorylation of serine-32 and
serine-36 residues of I
B by I
B kinases (IKKs), leading to its
ubiquitination and proteasome-mediated degradation. The free NF-
B then
translocates to the nucleus, where it interacts with the consensus DNA binding
sequences present in regulatory regions of numerous target genes
(Karin and Ben-Neriah, 2000
).
Stimulation of inducible nitric-oxide synthase (iNOS) expression by bacterial
lipopolysaccharide (LPS) involves activation and nuclear translocation of
NF-
B, where it interacts with
B sequences in the promoter of the
iNOS gene (Xie et al.,
1994
). The iNOS gene is predominantly regulated at the
level of transcription (de Vera et al.,
1998
) via several putative NF-
B response elements
(Spitsin et al., 1997
;
Taylor et al., 1998
). However,
this gene also contains the transcription factor binding sites for the AP-1,
as well as for members of CCAAT/enhancer-binding protein, activating
transcription factor/cAMP response element-binding protein, and signal
transducer and activator of transcription family of transcription factors
(Hecker et al., 1997
). The
generation of nitric oxide (NO) via iNOS is the basis of the profound
vasodilation observed during septic shock
(Rackow and Astiz, 1991
;
Titheradge, 1999
). As such,
drugs that inhibit the production of or increase the elimination of NO could
be useful in the management of septic shock
(Kilbourn et al., 1990
).
The observations linking hypertonicity to regulation of NF-
B
activation prompted our current interest in examining the effect of
hypertonicity on LPS- and cytokine-induced activation of
NF-
Bdependent signal transduction pathway in smooth muscle cells
in culture. Specifically, the goals of this study were to determine whether
hypertonicity alters LPS- and cytokine-dependent activation of NF-
B and
induction of iNOS expression and to delineate the mechanism(s) underlying this
action. We show that hypertonicity inhibits LPS- and cytokine-stimulated iNOS
expression through inhibition of I
B-
phosphorylation.
| Materials and Methods |
|---|
|
|
|---|
Preparation of Nuclear Extracts. Nuclear extracts were prepared from
the cells as described previously
(Schreiber et al., 1989
).
Briefly, the cells were suspended in buffer A [10 mM HEPES, pH 7.9, 10 mM KCl,
0.1 mM EDTA, 0.4% Nonidet P-40, 1 mM dithiothreitol (DTT), and 1 mM
phenylmethanesulfonyl fluoride (PMSF)]. The mixtures were centrifuged at
5000g for 30 s, and the cytosolic extract was separated. The nuclear
pellet was washed with excess volume of buffer A and then resuspended in
buffer B (20 mM HEPES, pH 7.9, 400 mM NaCl, 1 mM EDTA, 1 mM DTT, and 1 mM
PMSF). After incubating for 5 min at 4°C with rotation, the extracts were
centrifuged (5000g, 1 min), and the supernatants were used for DNA
binding activity analyses.
SDS Polyacrylamide Gel Electrophoresis/Western Blotting. For
quantitation of iNOS isozymes, I
B-
, and
-actin,
supernatants were resolved by SDS polyacrylamide gel electrophoresis as
described by Laemmli (1970
).
Proteins were transferred to nitrocellulose membranes, blocked in a solution
containing 130 mM NaCl, 2.7 mM KCl, 1.8 mM Na2HPO4, 1.5
mM KH2PO4, 0.1% NaN3, 0.1% Triton X-100, and
5% low-fat skim milk for 2 h, and then incubated at 4°C overnight with the
primary polyclonal antibody. After five washes in blocking solution, blots
were incubated with horseradish peroxidase-labeled goat anti-rabbit IgG
(Amersham Biosciences, Piscataway, NJ) for 2 h at room temperature, washed
three times with Tris-buffered saline/Tween 20 (20 mM Tris-HCl, 137 mM NaCl,
0.1% Tween 20, pH 7.6 at 25°C), followed by three washes with
Tris-buffered saline without 0.1% Tween 20, treated with ECL Plus reagents
(Amersham Biosciences) and visualized by exposure to Kodak XAR film or by
using a charge-coupled device camera (Hitachi Genetic Systems, MiraiBio Inc.,
Alameda, CA). All antibodies used in this study for NOS isozymes,
I
B-
, NF-
B and subunits and
-actin were purchased
from Santa Cruz Biotechnology (Santa Cruz, CA).
Immunocytochemistry for iNOS. DDT1MF-2 cells and porcine aortic smooth muscle cells were cultured and treated as described in the figure legends. After specific treatments, cultures were washed twice with warm PBS and fixed with 4% paraformaldehyde for 10 min. After two more washes with PBS, nonspecific binding was reduced by exposing cover slips for 5 min with a solution containing 5% normal goat serum and 0.5% Triton X-100. The cells were treated with rabbit NOS antibody (Santa Cruz Biotechnology) to detect NOS isozymes, diluted 1:200 in 5% normal goat serum along with 0.05% Triton X-100 in PBS, and incubated overnight at 4°C. After rinsing four times in PBS, cells were treated for 1 h with goat anti-rabbit IgG labeled with rhodamine (Jackson Immunoresearch Laboratories, West Grove, PA) diluted 1:100 in 5% normal goat serum and 0.05% Triton X-100 in PBS. After four rinses in PBS, the coverslips were mounted on glass microscope slides using Aquamount. The cells were observed using an Olympus confocal microscope using a 40x objective. In some experiments, localization of cells was facilitated using 0.5 µM Sytox (Molecular Probes, Eugene, OR) to stain cell nuclei in 0.05% Triton X-100 permeabilized cells.
Electrophoretic Mobility Shift Assay. EMSAs were performed by
incubating nuclear extracts with 32P-radiolabeled double-stranded
oligonucleotide probes suspended in reaction buffer (12 mM HEPES, pH 7.9, 100
mM NaCl, 0.25 mM EDTA, 1 mM DTT, and 1 mM PMSF) at room temperature for 10
min. The protein-DNA complexes were electrophoresed using 4% nondenaturing
polyacrylamide gels, dried, and exposed to X-ray films (Amersham Biosciences)
or to phosphor screen imaging (Cyclone Storage Phosphor System; PerkinElmer,
Boston, MA). The -fold increase in the expression of the transcription factors
was determined using background subtract. The probes used in these assays were
as follows. 1) NF-
B, 5'-CAACGGCAGGGGAATTCCCCTCTCCTT-3'; 2)
AP-1, 5' TGTCGAATGCAAATCACTAGAA-3'; and 3) OCT-1,
5'-TGTCGAATGCAAATCACTAGAA-3'.
Assay for Nitric Oxide Production. Intracellular nitric oxide
production was detected in smooth muscle cells using 4,5-diaminofluorescein
diacetate (DAF-2 DA; Calbiochem, San Diego, CA) based on methods described
previously (Kojima et al.,
1998
, Nakatsubo et al.,
1998
). Cells were plated on sterile 12-mm glass coverslips at 400
cells/mm2 in individual wells of 24-well tissue culture plates. The
cells were treated with 50 mM mannitol (Sigma Chemical Co., St. Louis, MO), in
the absence and presence of 10 µg/ml LPS (Sigma Chemical) for 24 h.
Coverslips were washed with PBS and the cells loaded with DAF-2 DA by
incubating in 5 mM DAF-2 DA for 20 min at 37°C and washed with PBS. The
cultures were analyzed for green fluorescence 1 h later using an Olympus
FluoView laser-scanning confocal microscope using an argon laser and a
40x objective.
Infection of Cultures with Adenovirus. DDT1MF-2 cells
were infected with recombinant adenovirus vectors, coexpressing either
humanized version of jellyfish green fluorescent protein (GFP) and full-length
RelA (RelAFL), a transcriptionally inert RelA mutant
(RelA1300) (Ramirez et
al., 2001
), or a mutant form of I
B-
, which acts as a
super-repressor of NF-
B (mI
B-
, kindly provided by Dr. E.
M. Schwarz, University of Rochester Medical Center, Rochester, NY).
Twenty-four hours after infection, cells were either left untreated or treated
with mannitol (50 mM) and/or LPS (10 µg/ml).
Immune Complex Kinase Assays. DTT1MF2 cells were
pretreated with mannitol for 30 min, followed by the addition of LPS 10
µg/ml for 15 min. Whole-cell lysates were then collected in 1 ml of buffer
containing 50 mM HEPES, pH 7.0, 250 mM NaCl, 0.1% Nonidet P-40, 5 mM EDTA, 10
mM NaF, 0.1 mM Na3VO4, and 50 µM ZnCl2,
supplemented with 0.1 mM PMSF, 1 mM DTT, and a mixture of protease and
phosphatase inhibitors, and cellular debris was removed by high-speed
centrifugation. Lysates were precleared by incubation with nonimmune serum for
1 h at 4°C followed by incubation with protein A agarose beads (Santa
Cruz) and centrifugation. Lysates were then incubated with 1 µg of
anti-IKK
(Santa Cruz Biotechnology) overnight at 4°C, after which
IKK
was precipitated using protein A agarose beads. After several
washes, beads containing IKK
were incubated with 0.25 µg of
recombinant GST-I
B
as an exogenous substrate (Santa Cruz
Biotechnology) and 10 µCi of 32P-
ATP in 20 µl of
kinase buffer (containing 50 mM Tris-Cl, pH 8, 10 mM MgCl2, 5 mM
DTT) at 30°C for 30 min. Kinase reactions were stopped by addition of SDS
sample buffer. Incorporation of 32P into I
B
was
analyzed by performing SDS-PAGE and autoradiography. The membranes were
subsequently probed with anti-IKK
(Santa Cruz Biotechnology) antibodies
to determine the levels of immunoprecipitated IKK
kinase.
Reverse Transcription and Polymerase Chain Reaction. Isolation of
total RNA was performed using TRIzol reagent kit (Invitrogen, Carlsbad, CA).
Samples of total RNA (1 µg each), were reverse-transcribed using a
first-strand cDNA synthesis kit (Amersham Biosciences) in a total volume of 15
µl. Five microliters of the reaction volume was then used for PCR
amplification. Primers used included sequences GCCTCGCTCTGGAAAGA (sense) and
TCCATGCAGACAACCTT (antisense) for human iNOS
(Geller et al., 1993
) and
TGAAGGTCGGTGTCAACGGATTTGGC (sense) and CATGTAGGCCATGAGGTCCACCAC (antisense)
for GAPDH. PCR reactions were performed in a total volume of 50 µl and
contained 2.5 mM MgCl2. The sequences of interest were amplified
over 30 cycles. The amplified products were resolved on 1.2% agarose gels.
Bands of interest were visualized using a charge-coupled device camera and
intensities quantitated by densitometry using GAPDH for normalization.
| Results |
|---|
|
|
|---|
B. Under normal cell culture conditions, both
DDT1MF-2 and porcine aortic smooth muscle cells express low levels
of iNOS, as detected by Western blotting assays using a polyclonal antibody
specific for iNOS. Basal expression of 130-kDa iNOS protein was very low and
was detectable only after 30 min exposure to X-OMAT film. Neither endothelial
(eNOS) nor neuronal NOS (nNOS) were detectable in DDT1MF-2 cells
(Fig. 1). The expression of
iNOS was significantly elevated after exposure to LPS (10 µg/ml) for 24 h
and was associated with an increase in the steady-state levels of iNOS mRNA
(see Fig. 2E.) However, no
induction of eNOS or nNOS was detected (data not shown). This induction of
iNOS was abrogated after inhibition of NF-
B by overexpressing a mutant
form of I
B-
(mI
B-
) that acts as a super-repressor
of NF-
B, implying an integral role of this transcription factor in the
induction of iNOS by LPS (data not shown). Under the conditions used, we
achieved approximately 70 to 80% infectivity with the viral vector, as
detected by indirect immunofluorescence.
|
|
Hypertonicity Inhibits LPS-Induced iNOS mRNA and Protein Expression.
To test the effect of hypertonicity on iNOS expression, DDT1MF-2
smooth muscle cells were pretreated with mannitol (50 mM) for 30 min, followed
by the addition of LPS (10 µg/ml) for 24 h. Cells exposed to LPS showed a
significant increase (
3.4-fold) in iNOS expression, compared with
untreated control cells (Fig.
2A). The addition of mannitol (50 mM) alone produced no change in
basal iNOS expression but completely abolished the induction by LPS. This
effect of mannitol on inhibition of iNOS expression was observed at mannitol
concentrations of 30, 50, and 100 mM, with maximum inhibition observed at 50
mM mannitol (Fig. 2B). The
higher concentration of mannitol did not produce any greater inhibition of
iNOS expression but in fact showed a slight stimulation above that observed
for 50 mM mannitol. The addition of TNF-
(20 ng/ml) or IL-1
(20
ng/ml) to DDT1MF-2 cultures also induced iNOS expression
(Fig. 2C). Preincubation of
cells with mannitol (50 mM) resulted in significant reduction in iNOS
expression induced by these cytokines. To test whether this response to
mannitol could be mimicked in vascular smooth muscle cells, we exposed primary
cultures of porcine aortic smooth muscle cells to similar concentrations of
mannitol (50 mM) and LPS (10 µg/ml). In these cells, a
2.2-fold
induction in iNOS was observed with LPS. Pretreatment with mannitol (50 mM)
also significantly suppressed this induction
(Fig. 2D). In these cells, we
observed a small but statistically insignificant increase in iNOS expression
produced by mannitol alone. The reason for this increase is not known. To
determine whether the changes in iNOS expression were associated with
concomitant changes in iNOS RNA, we quantitated the steady-state levels of
mRNA by PCR. The product obtained by PCR was
477 base pairs long, as
predicted from the primers used. As shown in
Fig. 2E, LPS produced a
significant increase in iNOS mRNA (
5-fold increase) which was attenuated
in cells that were pretreated with mannitol (64 ± 22% inhibition).
The ability of mannitol to suppress LPS-induced iNOS expression was further confirmed by immunocytochemistry using the same polyclonal antibody for iNOS (as above) and a rhodamine (tetramethylrhodamine B isothiocyanate)-conjugated secondary antibody. Immunoreactivity for iNOS appeared as a reddish-orange cytoplasmic stain by confocal microscopy, surrounding the yellow nuclear staining provided by the nuclear stain (Sytox). Cells exposed to LPS showed substantially elevated expression of iNOS compared with untreated control cells (Fig. 3A). Pretreatment with mannitol resulted in no demonstrable effect on iNOS expression but attenuated the induction of iNOS expression by LPS. Additional experiments were performed to test whether a similar response to mannitol could be produced in primary cultures of porcine aortic smooth muscle cells. As observed above for DDT1MF-2 smooth muscle cells, mannitol significantly suppressed iNOS expression upon stimulation by LPS in the porcine aortic smooth muscle cells (Fig. 3B). No nuclear staining (with Sytox) was used in the latter cell line. In both DDT1MF-2 and porcine aortic smooth muscle cells, the responses observed with mannitol could be mimicked by exposing cells to hypertonic saline, produced by addition of 50 mM NaCl to the cell culture medium (data not shown).
|
Mannitol Inhibits LPS-Induced Production of NO. Additional
experiments were performed to test whether inhibition of LPS-induced iNOS
immunoreactivity by mannitol was reflected in a decrease in NO production. NO
production was assessed using a fluorescent indicator 4,5-diaminofluorescein
diacetate (DAF-2 DA), which binds NO in the cells and produces
triazolofluoresceins, detectable by confocal microscopy at
488 nm
(Nakatsubo et al., 1998
). The
addition of mannitol alone to DDT1MF-2 cells had little effect on
NO release compared with untreated controls. LPS treatment for 24 h led to a
significant increase in NO release, which was attenuated by pretreatment of
these cells with mannitol 30 min before the addition of LPS
(Fig. 4A). LPS also produced a
substantial increase in NO production in porcine aortic smooth muscle cells.
This response was significantly reduced by mannitol
(Fig. 4B). Induction of
hypertonic stress using NaCl (50 mM) in the culture medium was also able to
suppress LPS-induced NO release, suggesting that this might be a common
property of hypertonic solutions (data not shown).
|
Mannitol Suppresses LPS-Induced iNOS Expression by Inhibiting
NF-
B. To determine the mechanism(s) underlying inhibition of
LPS-induced expression and activity of iNOS, the effect of mannitol on
transcription factors known to regulate the level of this protein was
determined. In this regard, the principal focus was on NF-
B, which has
been extensively studied concerning the induction of iNOS
(Nishiya et al., 2000
).
DDT1MF-2 cells were pretreated with mannitol (50 mM), followed by
addition of either LPS (10 µg/ml), TNF-
(20 ng/ml), or IL-1
(20 ng/ml) for the indicated periods. Next, nuclear fractions were isolated
and used to perform EMSAs. Incubation of DDT1MF-2 cells with
TNF-
or IL-1
substantially increased the activity of NF-
B,
as detected by a time-dependent increase in its binding to the radiolabeled
oligonucleotide that contained cis-acting NF-
B responsive
element (Fig. 5A). Pretreatment
of cells with mannitol (50 mM) for 30 min resulted in a dramatic reduction in
the activation of NF-
B by TNF-
and IL-1
at all time points
tested, indicating that NF-
B could be the target of action of mannitol.
Pretreatment with mannitol and NaCl also inhibited LPS-induced NF-
B
activation in DDT1MF-2 cells
(Fig. 5B). Supershift assays
were performed using selective antibodies for NF-
B subunits to identify
the subunit composition of the NF-
B complex. Supershifted bands were
observed in samples pretreated with antibodies against p50, p65, and c-Rel,
indicating that the NF-
B complex was composed predominantly of these
proteins. There was no differential effect of mannitol or NaCl on the
particular composition of NF-
B dimers. The antibody against p52 seemed
ineffective in inducing supershift, suggesting that p52 is not involved in the
activation of NF-
B by LPS in these cells
(Fig. 5C). Finally, we observed
a similar pattern of NF-
B activity in porcine aortic smooth muscle
cells treated with LPS, in presence of mannitol or NaCl. As shown in
Fig. 5D, the addition of either
mannitol or NaCl resulted in a dose-dependent inhibition of NF-
B
activation. Interestingly, the effect of hypertonicity seemed specific to
NF-
B activation, because preincubation of DDT1MF-2 cells
with mannitol or NaCl had no effect on AP-1 or Oct-1 transcription factors in
cells exposed to 10 µg/ml LPS, 20 ng/ml TNF-
, or 20 ng/ml IL-1
(data not shown).
|
Our hypothesis that NF
B is a potential target for mannitol was
confirmed by Western blotting studies focusing on the degradation of the
inhibitory I
B-
complex. In DDT1MF-2 cells, treatment
with TNF-
or IL-1
increased the degradation of cytosolic
I
B-
in a time-dependent manner, with maximum loss in protein
levels observed 30 min after exposure to these cytokines. The level of
I
B-
quickly recovered by 60 min, probably because of de novo
protein synthesis (Sun et al.,
1993
). Pre-exposure of cells to mannitol (50 mM) attenuated this
response to cytokines, leading to stabilization of I
B-
(Fig. 6). Because
phosphorylation of I
B-
by IKK is a prerequisite for its
proteasomal degradation, these results suggested that the site of action of
mannitol is either upstream of or at the level of I
B-
phosphorylation or the step leading to proteasomal degradation of this
protein.
|
Analogous experiments were performed in HeLa cells to more specifically
localize the site of action of mannitol. We decided to use these cells in the
initial characterization of a potential effect of mannitol because these have
been widely used in NF-
B studies. As expected, exposure of HeLa cells
to TNF-
(20 ng/ml) for 20 min resulted in a complete loss of
I
B-
protein in the cytosol, as determined by Western blotting
analyses. This loss was attenuated in cells pretreated with either mannitol
(200 mM) or NaCl (200 mM) for 2 h (Fig.
7A, top). These higher concentrations of mannitol and NaCl were
required because we observed that HeLa cells were less sensitive to
hypertonicity compared with DDT1MF-2 smooth muscle cells or porcine
aortic smooth muscle cells. Treatment of cells with the proteasome inhibitor
MG-132 (Lee and Goldberg,
1996
) resulted in stabilization of I
B-
in its
phosphorylated state, which was detected as a slowly migrating band, running
just above the native protein. This band showed immunoreactivity with
antiserum against I
B-
phosphorylated at serine 32
(Fig. 7A, bottom). In the
presence of mannitol or NaCl, the stabilized phosphorylated I
B-
band disappeared, suggesting a direct role of hypertonicity in inhibiting
phosphorylation of I
B-
(serine 32). Similar responses were
observed in other cell lines tested, which include DDT1MF-2 cells
(Fig. 7B, top and bottom) and
primary cultures of porcine aortic smooth muscle cells
(Fig. 7C) when these cells were
incubated with LPS (10 µg/ml). The concentrations of mannitol and NaCl used
in these latter experiments were 50 mM each.
|
Suppression of I
B-
degradation by MG-132 was reflected
functionally as suppression of LPS-induced DNA binding activity of NF-
B
in DDT1MF-2 cells (Fig.
7D). The addition of mannitol resulted in further suppression of
DNA binding activity over that observed with MG-132 pretreatment, indicative
of an additive effect, which suggests that these two agents inhibit
NF-
B activity at different steps in its activation cascade.
Overexpression of NF-
B subunit RelA leads to the formation of active
homodimers, which tend to override the inhibitory effects of endogenous
I
B-
. According to our hypothesis that the action of mannitol is
mediated through inhibition of I
B-
phosphorylation, we reasoned
that overexpression of RelA would prevent the inhibitory effect of mannitol.
For these experiments, DTT1MF2 cells were infected with recombinant
adenovirus vector that bicistronically expresses GFP and RelA (full-length
RelA or mutant RelA1300). As shown in
Fig. 8, cells overexpressing
RelAFL, but not the transcriptionally inactive mutant
RelA1300, showed enhanced expression of iNOS. LPS was able
to produce a small increase in iNOS expression in cells infected with viral
vector containing full-length RelA, indicative of its activation of endogenous
NF-
B. Interestingly, exposure of cells to mannitol failed to block the
induction of iNOS via RelAFL
(Fig. 8), indicating that the
events downstream to the activation of NF-
B are not probably sensitive
to mannitol. To validate our argument, analogous treatments were performed
followed by NF-
B DNA binding assays. Significant DNA binding activity
of NF-
B was observed in RelA expressing untreated DTT1MF2
cells, which was not affected by treatment with mannitol, whereas mannitol was
able to inhibit basal NF-
B DNA binding activity in cells expressing
irrelevant control GFP (data not shown). This latter finding is consistent
with a role of hypertonicity in the inhibition of NF-
B activation.
|
Hypertonicity Inhibits IKK Activity in Smooth Muscle Cells. To test
the possibility that mannitol inhibits IKK activity, we used GST-tagged
I
B
to study activity of IKK. In cells treated with LPS, there
was a significant (4.8-fold) increase in IKK activity that was inhibited by 25
and 50% by 50 and 100 mM mannitol, respectively
(Fig. 9).
|
| Discussion |
|---|
|
|
|---|
B (Xie et
al., 1994
B
(Karin and Ben-Neriah, 2000
B by effectors such as inflammatory cytokines,
oxidative stress, microbes, and viruses is preceded by phosphorylation and
degradation of this inhibitory protein, freeing NF-
B from its
cytoplasmic localization and allowing entry into the nucleus
(O'Connell et al., 1998
B is mediated by IKKs, which phosphorylate this
protein on N-terminal serine residues
(Karin and Ben-Neriah, 2000
B is then polyubiquitinated by a specific ubiquitin
ligase and is then rapidly degraded via 26 S proteasomes
(Yaron et al., 1998
B can regulate the transcription of a number of genes that
possess the consensus
B binding sequences in their promoters. An
example of such a gene is iNOS
(Xie et al., 1994
NO serves an important second messenger role in cellular signal
transduction processes. This second messenger, produced from a
Ca2+-dependent nitric-oxide synthase, mediates
endothelium-dependent relaxation of vascular smooth muscle
(Waldman and Murad, 1988
). NO
released from activated macrophages mediates its cytostatic action
(Bogdan et al., 2000
).
Moreover, NO plays an important role as a signaling molecule produced after
activation of neuronal NMDA receptor
(Doyle et al., 1996
;
Ayata et al., 1997
). The
induction of iNOS after exposure of vascular smooth muscle to LPS, a major
component of bacterial cell wall (Morrison
and Ryan, 1987
), is believed to underlie the profound vasodilation
observed in septic shock (Rackow and
Astiz, 1991
; Titheradge,
1999
). The importance of NF-
B in the induction of
iNOS gene suggests that selective inhibitors of this transcription
factor may prove beneficial in inhibiting LPS-mediated induction of iNOS and
thereby reduce the vasodilation that accompanies septic shock. Various
inhibitors of NF-
B have been proposed in this regard. For example,
treatment of endothelial cells with anisodamine, an inhibitor of NF-
B,
reduced LPS-mediated induction of plasminogen activator inhibitor-1 and tissue
factor, markers of endothelial cell activation
(Ruan et al., 2001
). Direct
inhibition of I
B degradation by pyrrolidine dithiocarbamate reduced
microvascular injury produced by LPS in rats
(Liu et al., 1999
).
Furthermore, inhibition of I
B degradation by calpain inhibitor I
protected against endotoxin-mediated shock in rats
(Ruetten and Thiemermann,
1997
). Our study clearly indicates that hypertonicity reduced the
activation of NF-
B and thereby inhibited the induction of iNOS.
Specifically, we show that hypertonicity inhibited the initial step in the
activation of this transcription factor, the phosphorylation of
I
B-
, preventing the nuclear localization of NF-
B. This
conclusion is supported by several pieces of evidence. First, LPS failed to
induce degradation of cytosolic I
B-
in the presence of mannitol
or NaCl, in sharp contrast to the substantial loss of I
B-
observed during the normal course of LPS stimulation. Because phosphorylation
of I
B-
by IKK is a prerequisite for proteosomal degradation, a
likely explanation for the action of mannitol is suppression of IKK activity.
In addition, inhibition of the ubiquitin-proteasome pathway by MG-132, allowed
for quantitation of the levels of phosphorylated I
B-
produced.
In cells pretreated with MG-132, there was accumulation of phosphorylated
I
B-
in response to LPS. However, treatment with mannitol or NaCl
along with LPS resulted in substantial reductions in the level of
phosphorylated I
B-
. Furthermore, the action of mannitol was
abrogated in cells overexpressing the RelA protein. Because overexpression of
RelA would probably overwhelm the endogenous inhibitory action of
I
B-
, the resulting induction of iNOS expression should seem
unresponsive to the inhibition by mannitol if this represents the site of
action of mannitol. Based on these observations, we conclude that the
inhibitory effect of mannitol is mediated at the level of NF-
B
activation, probably at the level of IKK. Additional data from our laboratory
demonstrated that mannitol inhibited LPS-stimulated IKK activity, which would
explain its inhibitory action on downstream events. The inability of mannitol
to produce full inhibition of IKK suggests that other factors may also
contribute to the overall inhibition of iNOS in the intact cell and/or factors
normally associated with IKK in the intact cells were lost during
immunoprecipitation of the kinase.
Other studies have shown that the activation of NF-
B can be
modulated by different experimental conditions and by drugs. For example, heat
stress attenuates NF-
B activity by inhibiting I
B-
phosphorylation (Curry et al.,
1999
; Shanley et al.,
2000
). The flavonoid resveratrol
(Holmes-McNary and Baldwin,
2000
), arsenic (Roussel and
Barchowsky, 2000
; Hershko et
al., 2002
), and the human papillomavirus oncoprotein E7
(Spitkovsky et al., 2002
)
stabilize I
B-
by inhibiting IKK activity. The synthetic
glucocorticoid dexamethasone inhibits TNF-
- and IL-1induced
nuclear translocation of NF-
B by inducing transcription of the
inhibitory protein I
B-
(Scheinman et al., 1995
).
Furthermore, the anti-inflammatory agent sodium salicylate inhibits activation
of NF-
B by preventing degradation of I
B
(Kopp and Ghosh, 1994
).
The concentrations of mannitol, which inhibit NF-
B activation, are
attained in the plasma after intravenous administration of mannitol. In
treating renal failure and head trauma, mannitol is normally administered by
infusion of a 20% solution to attain a concentration of 0.5 to 2 g/kg body
weight, which results in a plasma concentration of 15 to 60 mM
(Malek et al., 1998
).
Significant reductions in the activity of NF-
B and iNOS expression were
observed at 50 mM mannitol in smooth muscle cultures and it is likely that
similar inhibition of iNOS gene expression could be achieved in vivo after
administration of mannitol.
In summary, we have demonstrated that hypertonicity regulates iNOS
expression and that this pathway involves inhibition of the NF-
B
transcription factor complex through inhibition of IKK activity and reduction
in I
B phosphorylation and degradation. Because iNOS plays an important
role in manifestation of inflammatory processes, in addition to septic shock,
these data suggest that mannitol may also be beneficial against these
inflammatory processes. Furthermore, we propose that hypertonic solutions may
be useful in suppressing the expression of other NF-
Bdependent
mediators of the inflammatory response, such as TNF-
, IL-1, and COX-2.
This inhibitory effect of hypertonic solutions is selective to cells of the
vasculature and is not observed in cells of the renal or hepatic systems
(Hao et al., 2000
;
Michalke et al., 2000
). Hence,
the use of hypertonic agents may be particularly beneficial in septic shock,
where it would selectively counter the effect of LPS and cytokines on the
vascular smooth muscles without reducing renal or hepatic blood flow.
| Footnotes |
|---|
ABBREVIATIONS: NF-
B, nuclear factor
B; IKK, I
B
kinase; iNOS, inducible nitric-oxide synthase; NO, nitric oxide; LPS,
lipopolysaccharide; TNF-
, tumor necrosis factor-
; IL,
interleukin.; PBS, phosphate-buffered saline; DTT, dithiothreitol; PMSF,
phenylmethylsulfonyl fluoride; DAF-2 DA, 4,5-diaminofluorescein diacetate;
GFP, green fluorescent protein; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase; RelAFl, full-length RelA; MG-132,
N-benzoyloxycarbonyl (Z)-Leu-Leu-leucinal.
Address correspondence to: Dr. Vickram Ramkumar, SIU School of Medicine, Box 19230, Springfield, IL 62974-1222. E-mail: vramkumar{at}siumed.edu
| References |
|---|
|
|
|---|
B activation. J Biol Chem
270:
2451824524.
Ayata C, Ayata G, Hara H, Matthews RT, Beal MF, Ferrante RJ, Endres
M, Kim A, Christie RH, Waeber C, et al. (1997) Mechanisms of
reduced striatal NMDA excitotoxicity in type I nitric oxide synthase knock-out
mice. J Neurosci 17:
69086917.
Bell LM, Leong ML, Kim B, Wang E, Park J, Hemmings BA, and
Firestone GL (2000) Hyperosmotic stress stimulates promoter
activity and regulates cellular utilization of the serum- and
glucocorticoid-inducible protein kinase (Sgk) by a p38 MAPK-dependent pathway.
J Biol Chem 275:
2526225272.
Bogdan C, Rollinghoff M, and Diefenbach A (2000) The role of nitric oxide in innate immunity. Immunol Rev 173: 1726.[CrossRef][Medline]
Burg MB, Kwon ED, and Kultz D (1997) Regulation of gene expression by hypertonicity. Annu Rev Physiol 59: 437455.[CrossRef][Medline]
Cohen DM, Wasserman JC, and Gullans SR (1991) Immediate early gene and HSP70 expression in hyperosmotic stress in MDCK cells. Am J Physiol 261: C594C601.
Cohen DM, Chin WW, and Gullans SR (1994) Hyperosmotic
urea increases transcription and synthesis of Egr-1 in murine inner medullary
collecting duct (mIMCD3) cells. J Biol Chem
269:
2586525870.
Cohen DM, Gullans SR, and Chin WW (1996) Urea signaling in cultured murine inner medullary collecting duct (mIMCD3) cells involves protein kinase C, inositol 1,4,5-trisphosphate (IP3) and a putative receptor tyrosine kinase. J Clin Investig 97: 18841889.[Medline]
Curry HA, Clemens RA, Shah S, Bradbury CM, Botero A, Goswami P, and
Gius D (1999) Heat shock inhibits radiation-induced activation of
NF-
B via inhibition of I-
B kinase. J Biol
Chem 274:
2306123067.
de Vera ME, Shapiro RA, Nussler AK, Mudgett JS, Simmons RL, Morris
SM, Billiar TR, and Geller DA (1998) Transcriptional regulation
of human inducible nitric oxide synthase (NOS2) gene by cytokines: initial
analysis of the human NOS2 promoter. Proc Natl Acad Sci
USA 93:
10541059.
Doyle C, Holscher C, Rowan MJ, and Anwyl R (1996) The
selective neuronal NO synthase inhibitor 7-nitro-indazole blocks both
long-term potentiation and depotentiation of field EPSPs in rat hippocampal
CA1 in vivo. J Neurosci
16:
418424.
Geller DA, Lowenstein CJ, Shapiro RA, Nussler AK, Di Silvio M, Wang
SC, Nakayama DK, Simmons RL, Snyder SH, and Billiar TR (1993)
Molecular cloning and expression of inducible nitric oxide synthase from human
hepatocytes. Proc Natl Sci USA
90:
34913495.
Hao C-M, Yull F, Blackwell T, Komhoff M, Davis LS, and Breyer MD
(2000) Dehydration activates an NF-
B-driven,
COX2-dependent survival mechanism in renal medullary interstitial cells.
J Clin Investig 106:
973982.[Medline]
Hattori Y, Hattori S, Sato N, and Kasai K (2000)
High-glucose-induced nuclear factor
B activation in vascular smooth
muscle cells. Cardiovasc Res
46:
188197.
Hawiger J, Veach RA, Liu X-Y, Timmons S, and Ballard DW
(1999) I
B kinase complex is an intracellular target for
endotoxic lipopolysaccharide in human monocytic cells.
Blood 94:
17111716.
Hecker M, Preiss C, and Schini-Kerth VB (1997) Induction by staurosporine of nitric oxide synthase expression in vascular smooth muscle cells: role of NF-kappa B, CREB and C/EBP beta. Br J Pharmacol 120: 10671074.[CrossRef][Medline]
Hershko DD, Robb BW, Hungness ES, Luo G, and Hasselgren PO
(2002) Arsenite stabilizes I
B
and prevents
NF-
B activation in IL-1
-stimulated Caco-2 cells independent of
the heat shock response. J Cell Biochem
84:
687698.[CrossRef][Medline]
Holmes-McNary M and Baldwin AS Jr (2000)
Chemopreventive properties of transresveratrol are associated with inhibition
of activation of the I
B kinase. Cancer Res
60:
34773483.
Jenq W, Cooper DR, Bittle P, and Ramirez G (1999) Aquaporin-1 expression in proximal tubule epithelial cells of human kidney is regulated by hyperosmolarity and contrast agents. Biochem Biophys Res Commun 256: 240248.[CrossRef][Medline]
Karin M and Ben-Neriah Y (2000) Phosphorylation meets
ubiquitination: the control of NF-
B activity. Annu Rev
Immunol 18:
621663.[CrossRef][Medline]
Kilbourn RG, Gross SS, Jubran A, Adams J, Griffith OW, Levi R, and
Lodato RF (1990)
NG-methyl-L-arginine inhibits tumor necrosis
factor-induced hypotension: implications for the involvement of nitric oxide.
Proc Natl Acad Sci USA
87:
36293632.
Kim H, Seo JY, and Kim KH (1999) Effects of mannitol and dimethylthiourea on Helicobacter pylori-induced IL-8 production in gastric epithelial cells. Pharmacology 59: 201211.[CrossRef][Medline]
Kojima H, Nakatsubo N, Kikuchi K, Urano Y, Higuchi T, Tanaka J, Kudo Y, and Nagano T (1998) Direct evidence of NO production in rat hippocampus and cortex using a new fluorescent indicator: DAF-2 DA. Neuroreport 9: 33453348.[Medline]
Kopp E and Ghosh S (1994) Inhibition of NF-
B by
sodium salicylate and aspirin. Science (Wash DC)
265:
956959.
Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (Lond) 227: 680685.[CrossRef][Medline]
Lee DH and Goldberg AL (1996) Selective inhibitors of
the proteasome-dependent and vacuolar pathways of protein degradation in
Saccharomyces cerevisiae. J Biol Chem
271:
2728027284.
Liu SF, Ye X, and Malik AB (1999) Pyrrolidine
dithiocarbamate prevents I-
B degradation and reduces microvascular
injury induced by lipopolysaccharide in multiple organs. Mol
Pharmacol 55:
658667.
Malek AM, Goss GG, Jiang L, Izumo S, and Alper SL
(1998) Mannitol at clinical concentrations activates multiple
signaling pathways and induces apoptosis in endothelial cells. Stroke
29: 26312640Meier R, Thelen M and Hemmings B (1998) Inactivation and
dephosphorylation of protein kinase B
(PKB
) promoted by
hyperosmotic stress. EMBO (Eur Mol Biol Organ) J
17:
72947303.[CrossRef][Medline]
Michalke M, Cariers A, Schliess F, and Haussinger D
(2000) Hypoosmolarity influences the activity of transcription
factor NF-
B in rat H4IIE hepatoma cells. FEBS
Lett 465:
6468.[CrossRef][Medline]
Morrison D and Ryan JL (1987) Endotoxins and disease mechanisms. Annu Rev Med 38: 417432.[Medline]
Nakatsubo N, Kojima H, Kikuchi K, Nagoshi H, Hirata Y, Maeda D, Imai Y, Irimura T, and Nagano T (1998) Direct evidence of nitric oxide production from bovine aortic endothelial cells using new fluorescence indicators: diaminofluoresceins. FEBS Lett 427: 263266.[CrossRef][Medline]
Nishiya T, Uehara T, Kaneko M, and Nomura Y (2000)
Involvement of nuclear factor-kappaB (NF-
B) signaling in the expression
of inducible nitric oxide synthase (iNOS) gene in rat C6 glioma cells.
Biochem Biophys Res Commun
275:
268273.[CrossRef][Medline]
O'Connell MA, Bennett BL, Mercurio F, Manning AM, and Mackman N
(1998) Role of IKK1 and IKK2 in lipopolysaccharide signaling in
human monocytic cells. J Biol Chem
273:
3041030414.
Rackow EC and Astiz ME (1991) Pathophysiology and treatment of septic shock. J Am Med Assoc 266: 548554.[Abstract]
Ramirez SH, Sanchez JF, Dimitri CA, Gelbard HA, Dewhurst S, and
Maggirwar SB (2001) Neurotrophins prevent HIV Tat-induced
neuronal apoptosis via a nuclear factor-kappaB (NF-
B)-dependent
mechanism. J Neurochem
78:
874889.[CrossRef][Medline]
Roussel RR and Barchowsky A (2000) Arsenic inhibits
NF-
B-mediated gene transcription by blocking I
B kinase activity
and I
B
phosphorylation and degradation. Arch Biochem
Biophys 377:
204212.[CrossRef][Medline]
Ruan QR, Zhang WJ, Hufnagl P, Kaun C, Binder BR, and Wojta J
(2001) Anisodamine counteracts lipopolysaccharide-induced tissue
factor and plasminogen activator inhibitor-1 expression in human endothelial
cells: contribution of the NF-
B pathway. J Vasc
Res 38:
1319.[CrossRef][Medline]
Ruetten H and Thiemermann C (1997) Effect of calpain
inhibitor I, an inhibitor of the proteolysis of I-
B, on the circulatory
failure and multiple organ dysfunction caused by endotoxin in the rat.
Br J Pharmacol 121:
695704.[CrossRef][Medline]
Schreiber E, Matthias P, Muller MM, and Schaffner W
(1989) Rapid detection of octamer binding proteins with
`mini-extracts', prepared from a small number of cells. Nucleic
Acids Res 17:
6419.
Scheinman RI, Cogswell PC, Lofquist AK, and Baldwin AS Jr
(1995) Role of transcriptional activation of I
B alpha in
mediation of immunosuppression by glucocorticoids. Science (Wash
DC) 270:
283286.
Shanley TP, Ryan MA, Eaves-Pyles T, and Wong HR (2000)
Heat shock inhibits phosphorylation of I-
B
.
Shock 14:
447450.[Medline]
Spitkovsky D, Hehner SP, Hofmann TG, Moller A, and Schmitz ML
(2002) The human papillomavirus oncoprotein E7 attenuates
NF-
B activation by targeting the I
B kinase complex. J
Biol Chem 277:
2557625582.
Spitsin SV, Farber JL, Bertovich M, Moehren G, Koprowski H, and
Michaels FH (1997) Human- and mouse-inducible nitric oxide
synthase promoters require activation of phosphatidylcholine-specific
phospholipase C and NF-
B. Mol Med
3:
315326.[CrossRef][Medline]
Sun SC, Ganchi PA, Ballard DW, and Greene WC (1993)
NF-
B controls expression of inhibitor I
B
: evidence for
an inducible autoregulatory pathway. Science (Wash DC)
259:
19121915.
Taylor BS, de Vera ME, Ganster RW, Wang Q, Shapiro RA, Morris SM,
Billiar TR, and Geller DA (1998) Multiple NF-
B enhancer
elements regulate cytokine induction of the human inducible nitric oxide
synthase gene. J Biol Chem
273:
1514815156.
Titheradge M (1999) Nitric oxide in septic shock. Biochim Biophys Acta 1411: 437455.[Medline]
Waldman SA and Murad F (1988) Biochemical mechanisms underlying vascular smooth muscle relaxation: the guanylate cyclase-cyclic GMP system. J Cardiovasc Pharmacol 12: S115S118.
Xie Q, Kashiwabara Y, and Nathan C (1994) Role of
transcription factor NF-
B/Rel in induction of nitric oxide synthase.
J Biol Chem 269:
47054708.
Yaron A, Hatzubai A, Davis M, Lavon I, Amit S, Manning AM, Anderson
JS, Mann M, Mercurio F, and Ben-Neriah Y (1998) Identification of
the receptor component of the I
B
-ubiquitin ligase.
Nature (Lond) 396:
590594.[CrossRef][Medline]
Zhang Z, Yang X-Y, Soltoff SP, and Cohen DM (2000) PI3K signaling in the murine kidney inner medullary cell response to urea. Am J Physiol 278: F155F164.
This article has been cited by other articles:
![]() |