QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bo, X. Articles by North, R. A. Search for Related Content PubMed PubMed Citation Articles by Bo, X. Articles by North, R. A.

Pharmacological and Biophysical Properties of the Human P2X₅ Receptor

Institute of Molecular Physiology, University of Sheffield, Sheffield, United Kingdom (X.B., L.-H.J., H.L.W., M.K., A.S., R.A.N.); and Autonomic Neuroscience Institute, Royal Free and University College Medical School, London, United Kingdom (G.B.)

Received August 26, 2002; accepted March 6, 2003.

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
We constructed a full-length human P2X₅ purinoceptor cDNA by incorporating a sequence corresponding to exon 10, which is missing in cDNAs cloned previously from human tissues. We studied the functional properties by patch-clamp recording and fluorescence imaging after expression in human embryonic kidney 293 cells. ATP (1–100 µM; half-maximal current at 4 µM) elicited inward currents at –60 mV; these persisted during brief (2 s) applications but declined during longer applications. The peak current was dependent on the holding potential and showed little rectification; however, both the desensitization during the application and the decline in the current when ATP was washed out were slower at +30 mV than at –60 mV. 2',3'-O-(4-Benzoyl)-benzoyl-ATP and -methylene-ATP mimicked the action of ATP (half-maximal concentrations 6 and 161 µM, respectively). The currents were inhibited by suramin, pyridoxal-5-phosphate-6-azo-2',4'-disulfonic acid and Brilliant Blue G, with half-maximal inhibition at 3, 0.2, and 0.5 µM, respectively; 2',3'-O-(2',4',6'-trinitrophenol)-ATP (1 µM) was ineffective. Removing divalent cations did not significantly alter ATP concentration-response curves. Reversal potential measurements showed that the human P2X₅ receptor was permeable to calcium (P_Ca/P_Na = 1.5) and N-methyl-D-glucamine (NMDG) (P_NMDG/P_Na = 0.4); it was also permeable to chloride (P_Cl/P_Na = 0.5) but not gluconate (P_gluc/P_Na = 0.01) ions. The permeability to NMDG developed as quickly as the channel opened, in contrast to the P2X₇ receptor where the NMDG permeability develops over several seconds. Cells expressing human P2X₅ receptors also rapidly accumulated the propidium dye YO-PRO-1 in response to ATP.

When expressed in HEK293 cells, the rat P2X₅ subunit cDNAs gave rise to currents activated by ATP, but these were very small and their properties not extensively studied. The current was elicited by ATP [half-maximal concentration (EC₅₀) about 10 µM] but not by meATP, and it was readily blocked by suramin and PPADS in the 1 to 10 µM concentration range (Collo et al., 1996; Garcia-Guzman et al., 1996). A mouse cDNA has also been cloned and expressed; again, the currents recorded from HEK293 cells were only a few tens of picoamperes and they were not studied in detail (Cox et al., 2001). On the other hand, although these two mammalian receptors do not express well as homomeric channels, their coexpression with P2X₁ subunits leads to the appearance of a large membrane current with several distinct properties indicative of a functional P2X₁/P2X₅ heteromer (Torres et al., 1998; Lê et al., 1999; Surprenant et al., 2000).

Three nonmammalian vertebrate P2X₅ receptor subunits have recently been cloned. The zebrafish (Danio rerio) receptor expressed very poorly in HEK293 cells, even though the zebrafish P2X₄ receptor gave good currents in parallel experiments (Diaz-Hernandez et al., 2002). The bullfrog (Rana catesbeiana) receptor cloned from larval skin and the chicken (Gallus gallus) receptor cloned from skeletal muscle provided substantive currents in HEK293 cells (Ruppelt et al., 2001) and Xenopus laevis oocytes (Bo et al., 2000; Jensik et al., 2001). These nonmammalian receptors share basic pharmacological properties with their mammalian counterparts (e.g., sensitivity to PPADS and suramin) but also exhibit some interesting features not seen in the limited prior studies of the mammalian receptors. For example, Soto's group (Ruppelt et al., 2001) showed that the homomeric chicken P2X₅ receptor was significantly permeable to chloride ions, and Jensik et al. (2001) found that the bullfrog receptor became permeable to NMDG and propidium iodide when divalent cations were removed from the solution.

The human P2X₅ receptor cDNA was isolated from brain, and its RNA was particularly enriched in thymus and other immune cells (Lê et al., 1997). However, alignment with other members of the P2X families showed that this cDNA lacked exon 10. This form was originally designated P2X_5A; P2X_5B also misses exon 3 (GenBank accession number Q93086 [GenBank] ). Exon 10 encodes a 22-amino acid segment of protein including much of the second of the two membrane-spanning domains. This cDNA did not encode functional channels, but a chimeric receptor in which the C-terminal region of the rat receptor (starting at the position equivalent to the beginning of exon 10) was joined to the human receptor provided robust ATP-activated currents when expressed in X. laevis oocytes (Lê et al., 1997). The human P2X₅ gene occupies about 21 kilobases near the end of the short arm of chromosome 17 (p13.3). We found a sequence corresponding to exon 10 of the P2X₅ receptor at the appropriate place in the gene (NCBI contig NT 010692, bases 3,048,945–3,049,010). However, the sequence at the 3' splice site (GGTGCTgggagt) contains gg on the intronic side rather than the gt, which is the consensus for RNA splicing; gt is found at the corresponding position in the mouse (Cox et al., 2001) and chick (Ruppelt et al., 2001) genomic sequences. Remarkably, a single nucleotide polymorphism at precisely this position has been reported (position 3,049,012; NCBI dbSNP ss1321072). In persons with thymidine, exon 10 will be recognized during processing of the P2X₅ receptor mRNA and this will be translated to a `full-length' receptor; persons with guanine at this position will make a receptor that does not include exon 10. Most expressed sequence tags in the dbEST database that contain appropriate fragments of the P2X₅ receptor show that exon 10 is missing, but there are cases in which it is present (GenBank accession numbers BG116171 [GenBank] , duodenal adenocarcinoma; AW402829 [GenBank] , B cell germinal center). In the current release of dbEST, 12 ESTs are missing exon 10, and two ESTs contain it; this provides a crude estimate of the frequency of the G > T polymorphism of 14%.

We therefore undertook to construct and express a full-length human P2X₅ receptor cDNA. This seemed to be a worthwhile goal in view of 1) the widespread tissue distribution of the subunit, 2) the limited expression studies of other mammalian homomeric P2X₅ receptors, 3) the interesting properties of the channels formed by the chick and bullfrog subunits, and 4) the indication from genomic sequence and ESTs that the `exon 10-containing' receptor will in fact be made by a subset of individuals.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Construction of Full-Length Human P2X₅ cDNA. Several hP2X₅ receptor-related cDNA sequences were identified by a BLAST search of human dbEST database with the coding region of hP2X₅ cDNA (GenBank accession number AF016709 [GenBank] ). One of the clones from a human lung small cell carcinoma was purchased (GenBank accession number BE791872 [GenBank] ; Incyte Genomics Inc., Palo Alto, CA) and sequenced. A TBLASTN search of human genomic DNA with the exon 10 sequence of rat P2X₅ cDNA identified a corresponding sequence (AF168787 [GenBank] , translation is Ala³²⁵-Gly-Lys-Phe-Ser-Ile-Ile-Pro-Thr-Ile-Ile-Asn-Val-Gly-Ser-Gly-Val-Ala-Leu-Met-Gly-Ala, which has three conservative differences from the equivalent rat sequence) (Fig. 1A). To produce the full-length hP2X₅ receptor, the cDNA of the EST clone was subcloned from the original pOTB7 vector into pRS7T vector with EcoRI and XhoI. The 5' nontranslated region was removed by digesting with NcoI and the plasmid was religated. To insert the missing exon 10 into the modified EST clone, the following four primers were used for overlap extension-based mutagenesis: 5'-cccaccatcatcaacgtgggctctggggtggcgctcatgggtgctggtgctttcttctgcgacctg, 5'-agagcccacgttgatgatggtgggaatgatgctgaacttccctgccttgccgttcaccatcacgtc, 5'-tattaccgagacgcagccggggt, and 5'-agctcgagtcacgtgctcctgtggggctccag. The fragment obtained with overlap extension, which contained the inserted exon 10, was digested with BamHI and XhoI and was used to replace the sequence between BamHI site inside the P2X₅ receptor cDNA and the downstream XhoI site in the vector. This procedure essentially removed all the 3' nontranslated region of the EST clone. The full-length coding sequence was subcloned into pcDNA3.1Zeo(+) with HindIII and XhoI.

View larger version (80K): [in this window] [in a new window]   Fig. 1. Construction and expression of full-length hP2X5 receptor. A, amino acid sequence alignment of human, rat, and chick P2X5 receptors. Transmembrane domains (TM1, TM2) are underlined, exon 10 is indicated by two arrows, and the C-terminal truncation site on rat and human P2X5 is indicated by . B, Western blot of epitope-tagged human and rat P2X5 receptors; lane 1 is untransfected HEK cells. C, GFP fluorescence in HEK293 cells transfected with full-length hP2X5-EGFP or C-terminal truncated hP2X5-EGFP. Both proteins localize to the plasma membrane.

For comparison of expression levels between human P2X₅ and rat P2X₅ receptors we used a C-terminal EYMPME (EE) epitope (Kim et al., 2001a). We also truncated the receptors at a position corresponding to the end of exon 11 (Cox et al., 2001); the final amino acid of these constructs was Gly³⁷⁸ in both the human and rat receptors; this construct is termed P2X₅C (Fig. 1A). The full-length and truncated forms of the human receptor were also subcloned into pEGFP-N2 or pEGFP-N3 vectors (BD Biosciences Clontech, Palo Alto, CA) to make P2X₅-EGFP and P2X₅C-EGFP. We made point-mutated receptors using QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA).

Transient Transfections, GFP Fluorescence, and Immunoblots. The methods were as described in detail previously (Kim et al., 2001a,b). In brief, HEK293 cells were plated in 35-mm Petri dishes, transfected using LipofectAMINE 2000 (Invitrogen) (1 µg of cDNA/2 x 10⁵ cells), and studied 24 to 48 h after transfection. GFP-fused P2X₅ receptors were plated on glass coverslips, fixed for 10 min with 4% paraformaldehyde, washed twice with physiological saline, and photographed using a CCD camera and an Olympus BX40 fluorescence microscope. Immunoprecipitation and Western blots were carried out using EE-tagged P2X₅ receptors as described previously (Kim et al., 2001a,b). Protein was bound to anti-EE monoclonal antibody (BabCo, Richmond, CA) and precipitated with -bind G-Sepharose (Amersham Biosciences, Uppsala, Sweden). Immune complex was then dissociated from -bind G-Sepharose, applied to SDS-PAGE, and blotted with anti-EE polyclonal Ab. Molecular weights were calculated using GeneSnap and GeneTools software (Syngene, Cambridge UK).

Electrophysiology and Fluorescent Imaging. Whole-cell patch clamp recordings were obtained using a HEKA EPC9 amplifier and Pulse software (HEKA, Lambrecht Germany) as described previously (Virginio et al., 1998a; Jiang et al., 2001). The internal solution was 172 mM Na⁺ 148 mM Cl^–, 10 mM EGTA, and 10 mM HEPES. An agar bridge (3 M KCl) was used for the indifferent electrode. The standard external solution was 151 mM Na⁺, 2 mM Ca²⁺, 1 mM Mg²⁺, 2 mM K⁺, 155 mM Cl^–, 10 mM HEPES, and 13 mM glucose. We used simplified external solutions for measurements of permeability ratios. Solution 147NaCl contained 151 mM Na⁺, 0.3 mM Ca²⁺, and 148 mM Cl^–; solution 40NaCl contained 44 mM Na⁺, 0.3 mM Ca²⁺, and 41 mM Cl^–; solution 110CaCl₂ contained 112 mM Ca²⁺ and 220 mM Cl^–; solution 154NMDG contained 154 mM NMDG⁺ and 146 mM Cl^–; and solution 147gluc contained 151 mM Na⁺ and 147 mM gluconate^–. These solutions also contained HEPES and glucose; osmolarity was 295 to 315 mOsm, and the adjustment of the pH to 7.3 with NaOH, Ca(OH)₂, or HCl accounts for the difference between the added salt concentrations and the final ion concentrations. Drug applications were made using the RSC 200 system (Biologic Science Instruments, Grenoble, France). In these experiments, solution exchange times were estimated from changes in junction potentials when a solution of 147 mM potassium gluconate was applied; these averaged 80 ms. Antagonists were applied for 1 to 4 min before, and throughout, agonist applications; agonist applications were repeated at 2- to 4-min intervals.

For reversal potential measurements, the whole-cell configuration was established in standard external solution and the external solution was changed to solution 147NaCl; the reversal potential was obtained by a ramp voltage command (–120 to 40 mV; 1-s duration). The solution was then exchanged with one of solutions described above, and the reversal potential was measured again. The reversal potentials reported have been corrected for liquid junction potentials, which were calculated using Henderson's equation (Ives and Janz, 1961), and in any case did not exceed 4 mV. The permeability ratios (P_X/P_Na) were derived from the reversal potentials (E_rev) as follows [where x = E_rev F/RT (F is the Faraday constant, R is the gas constant, and T is the absolute temperature)]:

• For solution 40NaCl: P_Cl/P_Na = {(1 – exp(–x)) ([Na]_o – [Na]_i exp(x))}/{([Cl]_iexp(–x) – [Cl]_o) (1 – exp(x))}. The estimate of P_Cl/P_Na (0.52) was used for further estimates of permeability ratios.
  
• For solution 110CaCl₂:P_Ca/P_Na = (A + B)/4[Ca]_o where A = {[Na]_i exp(x)(1 + exp(x))} and B = P_Cl/P_Na (1 + exp(x)) ([Cl]_o exp(x) – [Cl]_i).
  
• For solution 147NMDG:P_NMDG/P_Na = (C + D)/E where C = ([Na]_i exp(x))/(1 – exp(x)), D = P_Cl/P_Na ([Cl]_iexp(–x) – [Cl]_o)/(1 – exp(–x)) and E = [NMDG]_o/(1 – exp(x)).
  
• For solution 147gluc: P_gluc/P_Na = (C+D)/F where F = [gluc]_o/(1 – exp(–x)).
  

Ion concentrations were converted to activities using the following coefficients: _Na = 0.75, _Cl = 0.75, _Ca = 0.28, _NMDG = 0.81, and _gluc = 0.81.

YO-PRO-1 fluorescence was measured as described previously (Virginio et al., 1999a); we used a Zeiss Axiovert 100 and Fluar 20x objective with Photonics monochrometer imaging (Photonics, Germany).

Data Analysis. Figures show mean ± S.E.M for number of cells and curves fitted from pooled data using Kaleidagraph (Synergy Software, Reading PA). Onset and offset of ATP action were approximated by single exponentials of time constant _on and _off; the corresponding rate constants (k₁ = {(1/_on) – k_–1}/[ATP] and k_–1 = 1/_off) were assumed to be related to membrane potential by an expression of the form k(V) = k(0) exp(–z V F/R T) where V is the membrane potential, is the fraction of the membrane electric field acting on a sensor of valence z, and k(0) is the rate constant at 0 mV. Agonist concentration-response curves were fit by I/I_max = 100 ([A]^nH/([A]^nH + EC₅₀^nH)), where I is the peak current evoked by agonist concentration [A] expressed as percentage of maximal current evoked by ATP, n_H is the Hill coefficient, and EC₅₀ is the half-maximal agonist concentration. Antagonist concentration-inhibition curves were fit to I/I_o = 100 ([B]^nH/([B]^nH + EC₅₀^nH)), where I is the peak current at a given antagonist concentration [B] as a percentage of current in absence of antagonist (I_o) and IC₅₀ is the antagonist concentration that inhibits agonist current by 50%. Numerical estimates of EC₅₀ and IC₅₀ were obtained by curve-fitting to individual cells.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Expression of Human P2X₅ Receptor. Transfection of HEK293 cells with either human P2X₅ or rat P2X₅ receptor cDNAs resulted, within 1 to 2 days, in strong expression of the protein (Fig. 1, B and C). Immunoblotting of proteins from these cells showed single bands at 61 and 62 kDa, respectively (Fig. 1B), which is appropriate to glycosylated proteins with calculated molecular masses of the two P2X₅ proteins (51 and 52 kDa). This was primarily localized to the plasma membrane by immunocytochemistry (Fig. 1C). Although Western blotting showed equivalent protein expression of the rat and human P2X₅ receptor, currents evoked by ATP at the rat P2X₅ receptor were extremely small (<50 pA in these experiments; see also Collo et al., 1996; Garcia-Guzman et al., 1996), whereas ATP-evoked currents at the human P2X₅ receptor were large (1–5nAat –60 mV) (Fig. 2). We observed no significant differences in the immunohistochemistry or in the ATP-evoked currents between HEK293 cells transfected with an epitope-tagged human P2X₅ receptor (hP2X₅-EE) or with an EGFP-fused hP2X₅ receptor (hP2X₅-EGFP) (Fig. 1C); therefore, we have included some experiments with these constructs in the results of the functional experiments.

View larger version (29K): [in this window] [in a new window]   Fig. 2. Pharmacological properties of full-length human P2X5 receptor. A, inward currents recorded at –60 mV in response to 5-s applications of ATP. B, agonist concentration-response curves for ATP, BzATP, and meATP. Results are plotted as percentage of maximum ATP current recorded in each cell; each point is mean ± S.E.M. (n = 4–12 points). C, maximum currents caused by various agonists (100 µM) relative to that evoked by ATP; each bar is mean ± S.E.M. (n = 3–12). D, antagonist inhibition curves for PPADS, Brilliant Blue G, and suramin at human P2X5 receptor; ATP (10 µM) was the agonist. Each point is mean ± S.E.M. (n = 3–8).

Agonist and Antagonist Actions at Human P2X₅ Receptor. Application of ATP (0.3–3 µM; 1–5 s) evoked inward currents (at –60 mV) that were sustained; the currents elicited by higher concentrations declined during the application (Fig. 2A). Concentration-response curves for ATP, BzATP, and meATP yielded EC₅₀ values of 4.1 ± 0.5 (n = 5), 5.7 ± 0.9 (n = 5), and 161 ± 35 µM (n = 4), respectively (Fig. 2B). BzATP, meATP, and 2-methylthio-ATP elicited >85% of the maximal ATP current; adenosine-5'-O-(3-thio)triphosphate, ADP, and -methylene-ATP acted as less full agonists (Fig. 2C). Thus, the sensitivity to meATP is much greater than that observed for the rat P2X₅ receptor (no effect of 300 µM meATP; Collo et al., 1996), somewhat greater than that found for the rat P2X₂ receptor (Spelta et al., 2002) but considerably less than that reported for P2X₁, P2X₃, P2X_2/3, and rP2X_1/5 receptors (see North and Surprenant, 2000).

PPADS, Brilliant Blue G (BBG), and suramin inhibited the ATP-evoked current; this was concentration-dependent with IC₅₀ values of 0.2 ± 0.02 (n = 3), 0.53 ± 0.04 (n = 3), and 2.9 ± 0.4 (n = 5) µM, respectively (Fig. 2D). The sensitivity to inhibition by PPADS observed for the human P2X₅ receptor is about 10-fold higher than previously reported for other heterologously expressed P2X receptors (North and Surprenant, 2000). The inhibition by BBG is intermediate between the high sensitivity of the rat and human P2X₇ receptor (IC₅₀, 10 and 200 nM, respectively) and the very low sensitivity of the other P2X receptors (IC₅₀ values >5–10 µM) (Jiang et al., 2000). 2',3'-O-(2',4',6'-Trinitrophenol)-ATP, which is a nanomolar affinity antagonist at the P2X₁, P2X₃, and P2X_2/3 receptors (Virginio et al., 1998b; North and Surprenant, 2000), only minimally inhibited the ATP-evoked currents at the human P2X₅ receptor (11 ± 5% inhibition at 1 µM, n = 3).

Kinetics of Agonist Action. There were some features of the action of ATP that differed from those observed previously at other P2X receptors. First, the onset of the current was slower. We measured _on at the human P2X₅ and rat P2X₂ receptors under the similar conditions using near-maximal ATP concentrations (10 and 30 µM, respectively; holding potential, –60 mV); the values were 410 ± 50 ms (n = 8) and 161 ± 10 ms (n = 4). The rate of onset of the current showed little if any dependence on membrane potential (Fig. 3A), but the rate of the offset of the response upon removal of agonist was almost 10-fold slower at +30 mV than at –60 mV (Fig. 3, B and C). The offset rate constant was 0.2/s at 0 mV, and the fraction of the membrane field sensed by the channel closing (assuming a monovalent sensor) was 0.6. The offset of the current at the rat P2X₂ receptor was some 10 times faster and was not voltage-dependent (_off was about 300 ms at all potentials; Fig. 3C).

View larger version (12K): [in this window] [in a new window]   Fig. 3. Kinetics of human P2X5-mediated currents. A, upper traces show inward currents (holding potential –30 mV) in response to 2- and 10-s applications of ATP (3 µM, approximately EC50). Lower traces show typical outward currents at +30 mV. B, offset of response to ATP (3 µM) at –60, –30, and 30 mV (current at +30 mV inverted; currents scaled for comparison); broken lines are exponential fits (time constants 1, 3.3, and 6.3 s). C, summary data from experiments such as those shown in B. , results from parallel experiments on rat P2X2 receptor; ATP was applied at 30 µM, which is close to the EC90 (n = 5 for all points).

The desensitization of the current that occurred with longer agonist applications was also voltage-dependent (Fig. 3A). At a holding potential of –30 mV, the current at the end of a 10-s application of ATP (3 µM) had declined to 48 ± 11% (n = 6) of its peak value; the corresponding value at +30 mV was 86 ± 3% (n = 8). The ATP-evoked current at the chick and bullfrog P2X₅ receptor shows rapid desensitization (at –60 mV) that is prevented by removal of external calcium (Bo et al., 2000; Ruppelt et al., 2001). However, in the present study on the human P2X₅ receptor, removal of calcium from the superfusion solution did not alter the ATP concentration-response curve (n = 3), the onset or offset kinetics of the ATP current at any membrane potential (n = 6), or the desensitization during the continued presence of agonist (n = 3).

Ion Permeability. We investigated the ion permeability at the human P2X₅ receptor by measuring reversal potentials with patch pipettes containing 147 mM NaCl, and changing the composition of the external solutions. The reversal potential in solution 147NaCl was –0.4 ± 1.1 mV (n = 6). We first estimated P_Cl/P_Na with solution 40NaCl (Fig. 4). Table 1 shows that the shift in reversal potential (–12 mV) was much less than expected for a chloride-impermeable channel (the theoretical value would be –33 mV). Thus, the human P2X₅ receptor has a very significant permeability to chloride ions (P_Cl/P_Na, 0.5; Table 1), and this was taken into account in estimates of other permeability ratios when chloride ions were present (see Materials and Methods). We substituted extracellular chloride with gluconate (solution 147gluc) and found that gluconate permeability was insignificant (Table 1). By using extracellular NMDG (solution 154NMDG) and calcium chloride (solution 110CaCl₂), we found that that the human P2X₅ receptor was quite permeable to NMDG (P_NMDG/P_Na, 0.37) and calcium (P_Ca/P_Na, 1.5) (Fig. 4; Table 1). Parallel experiments were carried out for direct comparison on cells expressing the rat P2X₂ and P2X_2/3 receptors; we found that these receptors have very low permeability to NMDG (P_NMDG/P_Na < 0.05) (see also Virginio et al., 1999b) and chloride (P_Cl/P_Na < 0.02) ions (Table 1).

View larger version (17K): [in this window] [in a new window]   Fig. 4. Human P2X5 receptor ion channel is permeable to large cations and chloride. Currents in response to ramp voltage commands in external solutions containing (each control) 147NaCl, and solution 40NaCl, solution 110CaCl2, solution 147NMDG, and solution 147gluc. In each case, arrows indicate change in reversal potential on changing from 147NaCl.

The significant difference in chloride permeability between the human P2X₅ receptor and the P2X₂ receptor led us to search for amino acid residues in or around the transmembrane domains that might differ between the two channels. A possible candidate is Lys⁵² of the hP2X₅ receptor, which corresponds in position to Gln⁵² of the rat P2X₂ receptor; P2X₅ receptors are unusual in having lysine in this position, where P2X₁, P2X₂, P2X₃, P2X₄, and P2X₇ subunits have a negatively charged side chain (Gln, Asp, Asn, or Glu). This position is at the outer end of the first transmembrane domain, and we speculated that the difference in charge might contribute to the difference in anion permeability. We reversed the charge by mutagenesis and measured the P_Cl/P_Na ratios. The value for the human P2X₅ receptor was not different from wild type, and the rat P2X₂ receptor with the complementary mutation [Q52K] remained impermeable to chloride (Table 1).

In the case of the P2X₇ receptor (Surprenant et al., 1996; Virginio et al., 1999b), the permeability to NMDG is very low at the beginning of the ATP application and progressively increases over several seconds. Indeed, when the application of agonist is kept brief (2 s), there is no significant permeability to NMDG (Surprenant et al., 1996). NMDG permeability has also been found for the P2X₂ and P2X₄ receptor, but in these cases, it also develops during several seconds of agonist application (Khakh et al., 1999; Virginio et al., 1999b). This progressive increase in permeability is detected as a time-dependent change in reversal potential during a sustained application of agonist. We therefore directly compared the kinetics of NMDG permeability at the rat P2X₇ and the human P2X₅ receptors under the same conditions (Fig. 5). As reported previously (Virginio et al., 1999a,b), the reversal potential in NMDG chloride shifted over an exponential time course from about –90 mV (P_NMDG/P_Na < 0.02) in the first several seconds of agonist application to a steady-state value of approximately –21 mV (P_NMDG/P_Na 0.25) after 30 s (Fig. 5, B and C). However, for the human P2X₅ receptor, the reversal potential in NMDG chloride was –15 ± 2 mV (n = 7) as soon as it was feasible to measure it (1–4 s after ATP application) and did not change during the subsequent 30 s of receptor stimulation (Fig. 5, A and C). Indeed, the onset kinetics of the inward current were no different in solutions containing sodium or NMDG as the only extracellular cation (Figs. 3 and 5), indicating that, within our resolution, the channel is NMDG-permeable from the time at which it opens. The permeability to NMDG was observed in external solutions containing no divalent cations (used for more accurate measurement of reversal potentials), but it was also observed in solutions containing NMDG, calcium (2 mM), and magnesium (1 mM) (n = 4).

View larger version (20K): [in this window] [in a new window]   Fig. 5. NMDG permeability is not time-dependent at the human P2X5 receptor. A, left, with NMDG as the extracellular cation, application of ATP evokes an inward current that declines during 30 s. Holding potential, –60 mV. Right, the reversal potential of the current remains at about –15 mV throughout. B, left, a similar experiment on a cell expressing rat P2X7 receptor. The current is initially outward, because the reversal potential is negative to the holding potential (–60 mV). Right, the reversal potential shifts in a positive direction during 20 s of BzATP application. C, summary of results from experiments shown in A and B [n = 4 (human P2X5), n = 3 (rat P2X7)].

YO-PRO-1 Permeability of Human P2X₅ Receptor. YO-PRO-1 is a propidium dye that becomes fluorescent when it intercalates nucleic acid. We followed its entry into cells by fluorescence imaging. We compared the rate of YO-PRO-1 uptake induced by ATP and BzATP at the human P2X₅ and rat P2X₇ receptors (Fig. 6). Neither BzATP (100 µM) nor ATP (1 mM) evoked any YO-PRO-1 fluorescence in mock-transfected HEK293 cells (n > 40 cells from three separate experiments; Fig. 6A). The absolute fluorescence measured 60 s after the addition of a maximal concentration of either ATP or BzATP was 2-fold greater at the human P2X₅ receptor (Fig. 6A), whereas the rate of YO-PRO-1 uptake was almost 4-fold greater at the human P2X₅ receptor (Fig. 6B). For the rat P2X₇ receptor, the rate of YO-PRO-1 uptake was greater when the external solutions contained no divalent cations (see Surprenant et al., 1996), but this difference was not present for the P2X₅ receptor (Fig. 6B).

View larger version (13K): [in this window] [in a new window]   Fig. 6. Uptake of YO-PRO-1 by cells expressing human P2X5 receptors. A, fluorescence of individual HEK cells was measured, and average values are plotted with S.E.M. Top, increase in fluorescence occurring during application of ATP as shown. Middle, a similar experiment on HEK cells expressing rat P2X7 receptors. Bottom, a similar experiment on mock-transfected HEK cells. B, summary of results from experiments such as those shown in A. , experiments in standard extracellular solution; , experiments in solution containing 0.3 mM calcium and 0 mM magnesium. Agonist concentrations used were hP2X5, 10 µM ATP, 100 µM BzATP; rP2X7, 1 mM ATP, 100 µM BzATP (n = 3–5). **, p < 0.05.

Comparison of Human and Rat P2X₅ Receptors. We were struck by the robust expression of ionic currents by HEK cells transfected with the human P2X₅ receptor, compared with the rat P2X₅ receptor (Collo et al., 1996; Garcia-Guzman et al., 1996). Moreover, there were clear functional differences between the properties of the two homomers (e.g., increased sensitivity to ATP and meATP, voltage-dependent kinetics). We sought to determine whether these differences might be related to the different C-terminal regions between the two receptors (Fig. 1A).

In general, the C-terminal regions of the P2X receptors show little conservation of sequence among the seven subtypes, but within each subtype, there is significant homology among species orthologs. However, for the P2X₅ receptor, the C-terminal regions are related in sequence only between rat and mouse but not in the case of bullfrog, zebrafish, chicken, and human; in these species, all relatedness ends at the splice site between exons 11 and 12 (Cox et al., 2001). We therefore compared the properties of the human and rat receptors truncated at this point (Fig. 1A). Both truncated receptors (with C-terminal EGFP fusions) localized to the plasma membrane in a manner similar to that of the wild-type receptors, although they both showed a lower level of immunofluorescence than did the wild type. The maximum current amplitudes were slightly lower in each of the truncated receptors compared with their respective wild-type receptors. The maximum ATP-evoked currents at wild-type and truncated rat P2X₅ receptors were 49 ± 14 pA and 28 ± 9 pA (n = 10 each); at wild-type and truncated human P2X₅ receptor, maximum currents were 2.9 ± 0.5 and 0.95 ± 0.1 nA (n = 9 each). However, no other significant differences in the functional properties were observed. The EC₅₀ for ATP was 3.3 ± 0.2 µM (n = 3) at the truncated human P2X₅ receptor; meATP (100 µM) did not evoke any current at the truncated rat P2X₅ receptor but was almost a full agonist at the truncated human P2X₅ receptor (n = 4), and the truncated human P2X₅ receptor also showed a voltage-dependence time course of current offset (n = 5).

There are three amino acid differences between human and rat receptors in the part of the protein encoded by exon 10. We made a chimeric receptor in which the sequence coded by exon 10 from the rat receptor was used to replace the equivalent sequence of the human receptor. The resulting human receptor [P2X₅, V337I/V340I/V344L] had properties indistinguishable from those of the human P2X₅ receptor. There are only minor differences between the human and rat P2X₅ receptors in the regions before and including the first transmembrane domain (1–50) and between the end of the second transmembrane domain and the truncation point (334–379); it is likely that different residues in the ectodomains may account for the different properties.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
Our work shows that a P2X₅ receptor containing all 13 exons encoded by the human gene expresses well in HEK293 cells and produces robust currents in response to ATP. It has previously been well documented that the form of the receptor that does not contain exon 10 can not form homomeric channels despite apparently good membrane expression (Lê et al., 1997). Human tissues seem to contain more P2X receptor forms that are spliced so as to produce nonfunctional proteins than are found in rodent orthologs (e.g., P2X₂, Lynch et al., 1999; P2X₆, Urano et al., 1997; see North, 2002); this might reflect a loss of function during evolution. The presence of a polymorphism at a critical position in the human P2X₅ gene strongly indicates that a subset of humans will process and translate their RNA to make the protein that we have expressed. Presumably, mice and chickens also make a protein corresponding to the `full-length' 13-exon form (see Introduction).

When expressed in mammalian cells or oocytes from cDNAs, the human (this study), chick (Bo et al., 2000; Ruppelt et al., 2001), and bullfrog (Jensik et al., 2001) P2X₅ receptors express well; it is less clear why currents at the rat (this study; Collo et al., 1996; Garcia-Guzman et al., 1996), mouse (Cox et al., 2001), and zebrafish receptors (Diaz-Hernandez et al., 2002) do not. The rat sequence contains in its C terminus a sequence Arg⁴⁰⁴-Val-Arg; this is similar in the mouse (Arg⁴⁰⁴-Val-His). The RXR motif is a well known endoplasmic reticulum retention motif and has been implicated in the trafficking of several ion channels to the plasma membrane (Ma and Jan, 2002). We mutated this sequence to Ala-Ala-Ala in the rat P2X₅ receptor but found that the currents recorded from transfected HEK293 cells were still very small (L.-H. Jiang, unpublished observations). In any event, using Western blotting and immunohistochemistry, we detected no obvious difference between the expression of rat and human P2X₅ receptors.

Compared with other homomeric P2X receptors, the pharmacological profile of the human P2X₅ receptor is most similar to the P2X₂ receptor (North and Surprenant, 2000). It is rather more sensitive to the agonists ATP (EC₅₀ 5 µM) and meATP (EC₅₀ 150 µM) and the antagonist PPADS (IC₅₀ < 1 µM). The current shows much less rectification than is observed for the P2X₂ receptor; in this respect, it is more similar to homomeric P2X₄ and P2X₇ receptors (see North, 2002). Compared with P2X₅ receptors from other species [chick (Bo et al., 2000; Ruppelt et al., 2001) and bullfrog (Jensik et al., 2001)], the most noticeable difference is the relatively slower desensitization of the current at the human receptor. As seen for the chick receptor (Ruppelt et al., 2001), we observed that holding the membrane potential at positive could largely prevent desensitization. In the chick, calcium entry might contribute to the desensitization because removing the extracellular calcium ions also prevented it; we did not find this to be the case for the human P2X₅ receptor.

The kinetics of channel opening, as best we could estimate with the present approach, corresponded to a macroscopic k₊₁ of 1 µM/s, which is approximately similar to that observed for P2X₂ receptors (Ding and Sachs, 1999); this rate showed only little voltage dependence. On the other hand, the rate of decline of the current ranged from 1/s at –60 mV to 0.15/s at +30 mV (Fig. 2). This is in contrast to the rat P2X₂ receptor, where the offset of current shows little or no voltage-dependence (Fig. 2). Taken together, the results indicate that depolarized membrane potentials tend to stabilize the human P2X₅ receptor in an open state, from which it less easily enters either a desensitized or a closed state.

The permeability of the human P2X₅ receptors also shows several unique features. Our measurements of reversal potential when the concentration of extracellular sodium chloride ions was reduced to 40 mM indicate clearly that the channel has substantial chloride permeability (P_Cl/P_Na 0.5). Although it has been widely assumed that P2X receptors are cation-selective, this has often not been tested directly in heterologous expression systems. In the present study, we measured the reversal potential for currents at the homomeric P2X₂ and heteromeric P2X_2/3 receptors; these corresponded to the theoretical value for a channel that was impermeable to chloride (Table 1). However, the chick P2X₅ receptor has substantial chloride permeability (Ruppelt et al., 2001); their value for P_Cs/P_Cl of about 2 corresponds well with our present measurement for the human P2X₅ receptor (if we assume that P_Na P_Cs). The molecular basis for the relative high permeability to chloride ions is not understood. We noticed a lysine residue near the outer end of the first transmembrane domain of the P2X₅ receptor sequences. Of the other P2X receptor subunits, lysine is found only in P2X₆ and no permeability information is available; the residue at this position is negatively charged in all the other subunits. However, we were unable to change the chloride permeability by making the appropriate amino acid exchanges at this position. Further knowledge of the anion permeabilities of other (homomeric) P2X receptors would be very helpful to inform the continuation of such a mutagenesis approach to the structural basis of chloride permeability in the human P2X₅ channel.

The chloride permeability of the receptor is of particular interest because ATP-activated currents in skeletal muscle have been repeatedly shown to involve a chloride permeability. The original evidence that ATP directly gates the opening of ion channels was based on whole-cell and single-channel recordings from embryonic chick skeletal muscle myotubes (Kolb and Wakelam, 1983). Subsequent studies in chick and frog showed striking developmental regulation of these channels; they disappear during late embryogenesis but reappear in the adult after denervation (Hume and Honig, 1986; Igusa, 1988; Thomas and Hume, 1990a; Thomas et al., 1991; Wells et al., 1995). They are also characterized by both cation permeability and a "substantial increase in chloride permeability" (Hume and Thomas, 1988; Thomas and Hume, 1990b). More recently, chick embryonic skeletal muscle has been shown to express high levels of both P2X₅ and P2X₆ receptor immunoreactivity, which disappears with development (Meyer et al., 1999).

All these observations might be consistent with the notion that ATP-gated channels in embryonic chick skeletal muscle are composed of P2X₅ receptors. There is, however, evidence against the view that the chick receptor is homomeric P2X₅. For example, meATP was ineffective at the receptor on muscle cells cultured from 10- or 11-day-old chick embryos (Hume and Honig, 1986; Thomas et al., 1991), whereas it does activate currents in oocytes expressing chick P2X₅ receptors (EC₅₀ 30 µM; Ruppelt et al., 2001). A recent study of ATP-gated currents and intracellular calcium responses in mouse and human skeletal muscle has shown a similar developmental pattern of expression of ATP-activated responses as that observed in chick. The ATP responses activated by ATP and BzATP, but they were activated only very weakly by meATP, and they showed no desensitization (Cseri et al., 2002). As for the chick, these observations suggest that the native mammalian receptor is not likely to be homomeric P2X₅. The predominant expression of P2X₆ subunits in skeletal muscle (Urano et al., 1997) suggests that possibility that the native receptor might include both P2X₅ and P2X₆ subunits. A functional role for ATP in the differentiation of rat skeletal muscle has recently been suggested (Ryten et al., 2002). The regeneration of skeletal muscle cells after damage involves resident satellite cells being stimulated to differentiate into myotubes. ATP stimulated this differentiation, and evidence from immunohistochemistry, reverse transcription-polymerase chain reaction, and electrophysiology strongly implicated involvement of the P2X₅ subunit.

The cation permeation properties of the human P2X₅ receptor also exhibit some novel features. Permeability to the large cation NMDG has been demonstrated in the case of homomeric P2X₂, P2X₄, and P2X₇ receptors and heteromeric P2X_2/3 receptors (Virginio et al., 1999a,b; Khakh et al., 1999). The human P2X₅ receptor is also permeable to NMDG and the relative permeability (Table 1; P_NMDG/P_Na = 0.37) is similar that described previously for the other receptors. The striking difference for the human P2X₅ receptor is that there is no detectable time delay in the development of the NMDG-permeable state. NMDG permeability was also reported for oocytes expressing the bullfrog P2X₅ receptor, but this was only observed when the extracellular solution contained no divalent cations (Jensik et al., 2001); it seemed to develop over several seconds, but it is difficult to make direct kinetic comparisons when whole oocytes and small mammalian cells are used as expression systems. YO-PRO-1 is a larger cation than NMDG (19 x 10 x 5.5 Å compared with 10 x 7.6 x 5.5 Å) and divalent rather than monovalent. It has the advantage that its permeation can be followed in physiological solutions, which is of course not possible when reversal potentials are measured. Human P2X₅ receptors exhibit uptake of YO-PRO-1, which is at least as robust as that observed for P2X₇ receptors (Fig. 5; also Surprenant et al., 1996; Rassendren et al., 1997). It is not possible to say from these experiments how rapidly the permeability to YO-PRO-1 develops in human P2X₅ receptors, but it would seem to be considerably slower than that observed for NMDG.

In summary, we have constructed and expressed a human P2X₅ receptor cDNA and characterized some of its pharmacological and biophysical properties. Several of these properties are quite distinct from those of other mammalian P2X receptors. These include a significant permeability to chloride ions, which is of interest because skeletal muscle expresses abundant P2X₅ receptor subunits and because ATP-activated currents in skeletal muscle are also chloride-permeable. There is permeability to the large cation NMDG that seems to develop as quickly as that to sodium ions; in other P2X receptors, the increase in NMDG permeability occurs only several seconds after the initial increase in sodium permeability. Finally, we have drawn attention to a single-nucleotide polymorphism that will effectively determine whether an individual organism makes a functioning P2X₅ receptor or a nonfunctional form that lacks exon 10.

	Footnotes

 
This work was supported by financial assistance from The Wellcome Trust (to A.S.) and AstraZeneca (to R.A.N.).

X.B. and L.-H.J. contributed equally to this work.

ABBREVIATIONS: HEK, human embryonic kidney; meATP, -methylene-ATP; PPADS, pyridoxal-5-phosphate-6-azo 2',4'-disulfonic acid; NMDG, N-methyl-D-glucamine; EST, expressed sequence tag; EE, EYMPME epitope; GFP, green fluorescent protein; EGFP, enhanced green fluorescent protein; YO-PRO-1, quinolinium,4-[(3-methyl-2-(3H)-benzoxazolylidene)methyl]-1-[3-(triethylammonio)propyl]di-iodide; BzATP, 2',3'-O-(4 benzoyl)benzoyl-ATP.

¹ Present address: Section of Functional Genomics, Division of Genomic Medicine, University of Sheffield, Royal Hallamshire Hospital, M-floor, Sheffield S10 2JF, United Kingdom.

Address correspondence to: R. Alan North, Institute of Molecular Physiology, University of Sheffield, Alfred Denny Building, Western Bank, Sheffield S10 2TN, UK. E-mail: r.a.north{at}sheffield.ac.uk

	References

Top Abstract Materials and Methods Results Discussion References

 
Bo X, Schoepfer R, and Burnstock G (2000) Molecular cloning and characterization of a novel ATP P2X receptor subtype from embryonic chick skeletal muscle. J Biol Chem 275: 14401–14407.[Abstract/Free Full Text]

Collo G, North RA, Kawashima E, Merlo-Pich E, Neidhart S, Surprenant A, and Buell G (1996) Cloning of P2X₅ and P2X₆ receptors and the distribution and properties of an extended family of ATP-gated ion channels. J Neurosci 16: 2495–2507.[Abstract/Free Full Text]

Cox JA, Barmina O, and Voigt MM (2001) Gene structure, chromosomal localization and expression of the mouse ATP-gated ionotropic receptor P2X₅ subunit. Gene 270: 145–152.[CrossRef][Medline]

Cseri J, Szappanos H, Szigeti GP, Csernátony Z, Kovács L, and Csernoch L (2002) A purinergic signal tranduction pathway in mammalian skeletal muscle cells in culture. Pfleug Arch Eur J Physiol 443: 731–738.[CrossRef][Medline]

Diaz-Hernandez M, Cox JA, Migita K, Haines W, Egan TM, and Voigt MM (2002) Cloning and characterization of two novel zebrafish P2X receptor subunits. Biochem Biophys Res Commun 295: 849–853.[CrossRef][Medline]

Ding S and Sachs F (1999) Single channel properties of P2X₂ purinoceptors. J Gen Physiol 113: 695–720.[Abstract/Free Full Text]

Garcia-Guzman M, Soto F, Laube B, and Stühmer M (1996) Molecular cloning and functional expression of a novel rat heart P2X purinoceptor. FEBS Lett 388: 123–127.[CrossRef][Medline]

Glass R and Burnstock G (2001) Immunohistochemical identification of cells expressing ATP-gated cation channels (P2X receptors) in the adult rat thyroid. J Anat 198: 569–579.[CrossRef][Medline]

Groschel-Stewart U, Bardini M, Robson T, and Burnstock G (1999) Localisation of P2X₅ and P2X₇ receptors by immunohistochemistry in rat stratified squamous epithelia. Cell Tissue Res 296: 599–605.[CrossRef][Medline]

Hume RI and Honig MG (1986) Excitatory action of ATP on embryonic chick muscle. J Neurosci 6: 681–690.[Abstract]

Hume RI and Thomas SA (1988) Multiple actions of adenosine 5'triphosphate on chick skeletal muscle. J Physiol 406: 503–524.[Abstract/Free Full Text]

Igusa Y (1988) Adenosine 5'-triphosphate activates acetylcholine receptor channels in cultured Xenopus myotomal muscle cells. J Physiol 405: 169–185.[Abstract/Free Full Text]

Ives DJG and Janz GJ (1961) Cells with liquid junctions, in Reference Electrodes: Theory and Practice (Ives DJG and Janz GJ eds), pp 48–56, Academic Press, New York.

Jiang L-H, Mackenzie AB, North RA, and Surprenant A (2000) Brilliant blue G selectively blocks ATP-gated rat P2X₇ receptors. Mol Pharmacol 58: 82–88.[Abstract/Free Full Text]

Jiang L-H, Rassendren F, Spelta V, Surprenant A, and North RA (2001) Amino acid residues involved in gating identified in the first membrane-spanning domain of the rat P2X₂ receptor. J Biol Chem 276: 14902–14908.[Abstract/Free Full Text]

Jensik PJ, Holbird D, Collard MW, and Cox TC (2001) Cloning and characterization of a functional P2X receptor from larval bullfrog skin. Am J Physiol 281: C954–C962.

Khakh BS, Bao XR, Labarca C, and Lester HA (1999) Neuronal P2X transmittergated cation channels change their ion selectivity in seconds. Nat Neurosci 2: 322–330.[CrossRef][Medline]

Kim M, Jiang L-H, Wilson HL, North RA, and Surprenant A (2001a) Proteomic and functional evidence for a P2X₇ receptor signalling complex. EMBO (Eur Mol Biol Organ) J 20: 6347–6358.[CrossRef][Medline]

Kim M, Spelta V, Sim JA, North RA, and Surprenant A (2001b) Differential assembly of rat purinergic P2X₇ receptor in immune cells of the brain and periphery. J Biol Chem 276: 23262–23267.[Abstract/Free Full Text]

Kolb HA and Wakelam MJ (1983) Transmitter-like action of ATP on patched membranes of cultured myoblasts and myotubes. Nature (Lond) 303: 621–623.[CrossRef][Medline]

Lê K-T, Boue-Grabot E, Archambault V, and Séguéla P (1999) Functional and biochemical evidence for heteromeric ATP-gated channels composed of P2X₁ and P2X₅ subunits. J Biol Chem 274: 15415–15419.[Abstract/Free Full Text]

Lê K-T, Paquet M, Nouel D, Babinski K, and Séguéla P (1997) Primary structure and expression of a naturally truncated human P2X ATP receptor subunit from brain and immune system. FEBS Lett 418: 195–199.[CrossRef][Medline]

Lynch KJ, Touma E, Niforatos W, Kage KL, Burgard EC, Van Bisen T, Kowaluk EA, and Jarvis MF (1999) Molecular and functional characterization of human P2X₂ receptors. Mol Pharmacol 56: 1171–1181.[Abstract/Free Full Text]

Ma D and Jan LY (2002) ER transport signals and trafficking of potassium channels and receptors. Curr Opin Neurobiol 12: 287–292.[CrossRef][Medline]

Meyer MP, Groschel-Stewart U, Robson T, and Burnstock G (1999) Expression of two ATP-gated ion channels, P2X₅ and P2X₆, in developing chick skeletal muscle. Dev Dyn 216: 442–449.[CrossRef][Medline]

North RA (2002) The molecular physiology of P2X receptors. Physiol Rev 82: 1013–1067.[Abstract/Free Full Text]

North RA and Surprenant A (2000) Pharmacology of P2X receptors. Annu Rev Pharmacol Toxicol 40: 563–580.[CrossRef][Medline]

Rassendren F, Buell GN, Virginio C, Collo G, North RA, and Surprenant A (1997) The permeabilizing ATP receptor, P2X₇. Cloning and expression of a human cDNA. J Biol Chem 272: 5482–5486.[Abstract/Free Full Text]

Ruppelt A, Ma W, Borchardt K, Silberberg SD, and Soto F (2001) Genomic structure, developmental distribution and functional properties of the chicken P2X₅ receptor. J Neurochem 77: 1256–1265.[CrossRef][Medline]

Ryten M, Dunn PM, Neary JT, and Burnstock G (2002) ATP regulates the differentiation of mammalian skeletal muscle by activation of a P2X₅ receptor on satellite cells. J Cell Biol 158: 345–355.[Abstract/Free Full Text]

Ryten M, Hoebertz A, and Burnstock G (2001) Sequential expression of three receptor subtypes for extracellular ATP in developing rat skeletal muscle. Dev Dyn 221: 331–341.[CrossRef][Medline]

Spelta V, Jiang L-H, Surprenant A, and North RA (2002) Kinetics of antagonist actions at rat P2X_2/3 heteromeric receptors. Br J Pharmacol 135: 1524–1530.[CrossRef][Medline]

Surprenant A, Rassendren F, Kawashima E, North RA, and Buell G (1996) The cytolytic P2Z receptor for extracellular ATP identified as a P2X receptor (P2X7). Science (Wash DC) 272: 735–738.[Abstract]

Surprenant A, Schneider DA, Wilson HL, Galligan JJ, and North RA (2000) (2000) Functional properties of heteromeric P2X_1/5 receptors expressed in HEK cells and excitatory junction potentials in guinea-pig submucosal arterioles. J Autonom Nerv Syst 81: 249–263.[CrossRef][Medline]

Thomas SA and Hume RI (1990a) Irreversible desensitisation of ATP response in developing chick skeletal muscle. J Physiol 430: 373–388.[Abstract/Free Full Text]

Thomas SA and Hume RI (1990b) Permeation of both cations and anions through a single class of ATP-activated channels in developing chick skeletal muscle. J Gen Physiol 95: 569–590.[Abstract/Free Full Text]

Thomas SA, Zawisa MJ, Lin X, and Hume RI (1991) A receptor that is highly specific for extracellular ATP in developing chick skeletal muscle in vitro. Br J Pharmacol 103: 1963–1969.[Medline]

Torres GE, Haines WR, Egan TM, and Voigt MM (1998) Co-expression of P2X₁ and P2X₅ receptor subunits reveals a novel ATP-gated ion channel. Mol Pharmacol 54: 989–993.[Abstract/Free Full Text]

Urano T, Nishimori H, Han H-J, Furuhata T, Kimura Y, Nakamura Y, and Tokino T (1997) Cloning of P2XM, a novel human P2X receptor gene regulated by p53. Cancer Res 57: 3281–3287.[Abstract/Free Full Text]

Virginio C, MacKenzie A, North RA, and Surprenant A (1999a) Kinetics of cell lysis, dye uptake and permeability changes in cells expressing the rat P2X₇ receptor. J Physiol 519: 335–346.[Abstract/Free Full Text]

Virginio C, MacKenzie A, Rassendren FA, North RA, and Surprenant A (1999b) Pore dilation of neuronal P2X receptor channels. Nat Neurosci 2: 315–321.[CrossRef][Medline]

Virginio C, North RA, and Surprenant A (1998a) Calcium permeability and block at homomeric and heteromeric P2X₂ and P2X₃ receptors and receptors in rat nodose neurones. J Physiol 510: 27–35.[Abstract/Free Full Text]

Virginio C, Robertson G, Surprenant A, and North RA (1998b) Trinitrophenyl substituted nucleotides are potent antagonists selective for P2X₁, P2X₃ and heteromeric P2X_2/3 receptors. Mol Pharmacol 53: 969–973.[Abstract/Free Full Text]

Wells DG, Zawisa MJ, and Hume RI (1995) Changes in responsiveness to extracellular ATP in chick skeletal muscle during development and upon denervation. Dev Biol 172: 585–590.[CrossRef][Medline]

This article has been cited by other articles:

				R. Xia, Z.-Z. Mei, H.-J. Mao, W. Yang, L. Dong, H. Bradley, D. J. Beech, and L.-H. Jiang Identification of Pore Residues Engaged in Determining Divalent Cationic Permeation in Transient Receptor Potential Melastatin Subtype Channel 2 J. Biol. Chem., October 10, 2008; 283(41): 27426 - 27432. [Abstract] [Full Text] [PDF]

				M. T. Young, J. A. Fisher, S. J. Fountain, R. C. Ford, R. A. North, and B. S. Khakh Molecular Shape, Architecture, and Size of P2X4 Receptors Determined Using Fluorescence Resonance Energy Transfer and Electron Microscopy J. Biol. Chem., September 19, 2008; 283(38): 26241 - 26251. [Abstract] [Full Text] [PDF]

				S. Chaumont and B. S. Khakh Patch-clamp coordinated spectroscopy shows P2X2 receptor permeability dynamics require cytosolic domain rearrangements but not Panx-1 channels PNAS, August 19, 2008; 105(33): 12063 - 12068. [Abstract] [Full Text] [PDF]

				D. S.K. Samways and T. M. Egan Acidic Amino Acids Impart Enhanced Ca2+ Permeability and Flux in Two Members of the ATP-gated P2X Receptor Family J. Gen. Physiol., March 26, 2007; 129(3): 245 - 256. [Abstract] [Full Text] [PDF]

				C. M. Turner, B. F. King, K. S. Srai, and R. J. Unwin Antagonism of endogenous putative P2Y receptors reduces the growth of MDCK-derived cysts cultured in vitro Am J Physiol Renal Physiol, January 1, 2007; 292(1): F15 - F25. [Abstract] [Full Text] [PDF]

				W. Duckwitz, R. Hausmann, A. Aschrafi, and G. Schmalzing P2X5 Subunit Assembly Requires Scaffolding by the Second Transmembrane Domain and a Conserved Aspartate J. Biol. Chem., December 22, 2006; 281(51): 39561 - 39572. [Abstract] [Full Text] [PDF]

				D. Yeung, K. Zablocki, C.-F. Lien, T. Jiang, S. Arkle, W. Brutkowski, J. Brown, H. Lochmuller, J. Simon, E. A. Barnard, et al. Increased susceptibility to ATP via alteration of P2X receptor function in dystrophic mdx mouse muscle cells FASEB J, April 1, 2006; 20(6): 610 - 620. [Abstract] [Full Text] [PDF]

				L. A. P. Chaves, E. P. Pontelli, and W. A. Varanda P2X receptors in mouse Leydig cells Am J Physiol Cell Physiol, April 1, 2006; 290(4): C1009 - C1017. [Abstract] [Full Text] [PDF]

				W. Ma, A. Korngreen, S. Weil, E. B.-T. Cohen, A. Priel, L. Kuzin, and S. D. Silberberg Pore properties and pharmacological features of the P2X receptor channel in airway ciliated cells J. Physiol., March 15, 2006; 571(3): 503 - 517. [Abstract] [Full Text] [PDF]

				M. Masin, D. Kerschensteiner, K. Dumke, M. E. Rubio, and F. Soto Fe65 Interacts with P2X2 Subunits at Excitatory Synapses and Modulates Receptor Function J. Biol. Chem., February 17, 2006; 281(7): 4100 - 4108. [Abstract] [Full Text] [PDF]

				L.-H. Jiang, F. Rassendren, A. Mackenzie, Y.-H. Zhang, A. Surprenant, and R. A. North N-methyl-D-glucamine and propidium dyes utilize different permeation pathways at rat P2X7 receptors Am J Physiol Cell Physiol, November 1, 2005; 289(5): C1295 - C1302. [Abstract] [Full Text] [PDF]

				S. S. Wildman, J. Marks, L. J. Churchill, C. M. Peppiatt, A. Chraibi, D. G. Shirley, J.-D. Horisberger, B. F. King, and R. J. Unwin Regulatory Interdependence of Cloned Epithelial Na+ Channels and P2X Receptors J. Am. Soc. Nephrol., September 1, 2005; 16(9): 2586 - 2597. [Abstract] [Full Text] [PDF]

				L. Liang, A. Zsembery, and E. M. Schwiebert RNA interference targeted to multiple P2X receptor subtypes attenuates zinc-induced calcium entry Am J Physiol Cell Physiol, August 1, 2005; 289(2): C388 - C396. [Abstract] [Full Text] [PDF]

				Q. Li, X. Luo, and S. Muallem Regulation of the P2X7 Receptor Permeability to Large Molecules by Extracellular Cl- and Na+ J. Biol. Chem., July 22, 2005; 280(29): 26922 - 26927. [Abstract] [Full Text] [PDF]

				X. Zhang, M. Zhang, A. M. Laties, and C. H. Mitchell Stimulation of P2X7 Receptors Elevates Ca2+ and Kills Retinal Ganglion Cells Invest. Ophthalmol. Vis. Sci., June 1, 2005; 46(6): 2183 - 2191. [Abstract] [Full Text] [PDF]

				Kelvin. C. Agboh, T. E. Webb, R. J. Evans, and S. J. Ennion Functional Characterization of a P2X Receptor from Schistosoma mansoni J. Biol. Chem., October 1, 2004; 279(40): 41650 - 41657. [Abstract] [Full Text] [PDF]

				S. Chaumont, L.-H. Jiang, A. Penna, R. A. North, and F. Rassendren Identification of a Trafficking Motif Involved in the Stabilization and Polarization of P2X Receptors J. Biol. Chem., July 9, 2004; 279(28): 29628 - 29638. [Abstract] [Full Text] [PDF]

				R. E. Bucheimer and J. Linden Purinergic regulation of epithelial transport J. Physiol., March 1, 2004; 555(2): 311 - 321. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bo, X. Articles by North, R. A. Search for Related Content PubMed PubMed Citation Articles by Bo, X. Articles by North, R. A.