MolPharm xPharm- The Comprehensive Pharmacology Reference

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


0026-895X/03/6402-298-307$20.00
Mol Pharmacol 64:298-307, 2003

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cowley, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cowley, E. A.

Isoprostane-Mediated Secretion from Human Airway Epithelial Cells

Elizabeth A. Cowley

Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia, Canada

Received January 3, 2003; accepted April 10, 2003


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Isoprostanes are liberated when reactive oxygen species (ROS) mediate the peroxidation of arachidonic acid or other polyunsaturated fatty acids. Because exposure to ROS is associated with tissue damage in the lung, we examined whether exposure to isoprostanes elicited a response in airway epithelial cells, potentially implicating isoprostane production in the epithelial response to oxidant stress. Application of the isoprostane 8-iso-prostaglandin E2 (8-iso-PGE2) produced an increase in transepithelial anion secretion across monolayers of the human airway epithelial cell line Calu-3, measured as an increase in short circuit current (Isc). This increase in Isc was greater when 8-iso-PGE2 was applied to the basolateral rather than the apical face of the Calu-3 monolayers and was almost entirely abolished by the addition of diphenylamine-2-carboxylate, implicating the cystic fibrosis transmembrane conductance regulator Cl- channel in the response. Experiments with electrically isolated apical and basolateral membrane preparations revealed that 8-iso-PGE2 stimulated both apical Cl- and basolateral K+ conductances. Using reverse transcription-polymerase chain reaction, we found that Calu-3 cells express the TP{alpha}, but not the TP{beta}, isoform of the receptor, and that these cells secrete in response to the thromboxane A2 (TP) receptor agonist 9,11-dideoxy-9{alpha},11{alpha}-methanoepoxy-prostaglandin F2{alpha} (U-46619). However, although part of the response seems to mediated via TP receptors, there are significant non—TP receptor-mediated effects on both the apical and basolateral membranes of Calu-3 cells. This is the first report of an isoprostane eliciting an effect in airway epithelial cells and suggests a potential role for this class of molecules in pulmonary host defense.


Oxidative stress has been implicated in the pathogenesis of a number of respiratory diseases, including asthma (Dworski 2000Go), adult respiratory distress syndrome (Lamb et al., 1999Go), cystic fibrosis (CF; van der Vliet et al., 1997Go) and chronic obstructive pulmonary disease (Repine et al., 1997Go). The recruitment of activated inflammatory cells to the airways results in the generation of highly cytotoxic reactive oxygen species (ROS), including superoxide (O2.) and hydrogen peroxide (H2O2), agents that may damage tissue via direct oxidation of proteins, DNA, or lipids. In addition to the potential for direct oxidative damage, exposure to ROS such as H2O2 also results in the production of a large class of prostaglandin-like compounds termed isoprostanes. Isoprostanes are generated when oxygen-centered free radicals such as H2O2 and superoxide react with the unsaturated bonds of fatty acids such as membrane-bound arachidonic acid (Morrow and Roberts, 1996Go) or other polyunsaturated fatty acids such as docosahexaenoic acid (Fam et al., 2002Go). Although structurally similar to the prostaglandins, differing in the cis-orientation of their side chains compared with the trans-orientation of prostaglandins, isoprostanes are believed to be produced independently of the cyclooxygenase pathway (Morrow et al., 1990Go; Morrow and Roberts, 1996Go). Isoprostanes have been described as markers of oxidative stress and lipid peroxidation in an enormous number of pathologies, including several pulmonary conditions. To date, markedly elevated levels of isoprostanes have been reported in exhaled breath condensates from patients with asthma (Montuschi et al., 1999Go), chronic obstructive pulmonary disease (Montuschi et al., 2000aGo), and CF (Montuschi et al., 2000bGo) and in the bronchoalveolar lavage fluid from patients with various interstitial lung diseases (Montuschi et al., 1998Go). Thus, they clearly can be viewed as markers of oxidant stress associated with a wide variety of inflammatory lung conditions. However, isoprostanes themselves are biologically active molecules, and there are increasing reports of their eliciting a wide variety of responses in a tissues including vascular (Janssen et al., 2001Go) and airway smooth muscle (Janssen et al., 2000Go; Catalli et al., 2002Go), platelets (Kobzar et al., 1997Go; Leitinger et al., 1997Go), and endothelial (Fukunaga et al., 1992Go; Zahler and Becker, 1999Go) and inflammatory cells (Zahler and Becker, 1999Go).

To date, no studies have been performed investigating the effects of isoprostanes on airway epithelial cells, although these cells will be exposed to incidents of oxidant stress in vivo. We have recently reported that H2O2 stimulates transepithelial anion secretion across intact monolayers of the human airway epithelial cell line Calu-3 (Cowley and Linsdell, 2002aGo). Calu-3 cells have become a widely used model of human airway submucosal gland serous cells (Shen et al., 1994Go; Moon et al., 1997Go; Cowley and Linsdell, 2002aGo,bGo). In vivo submucosal gland serous cells play a crucial role in maintaining a sterile environment in the airways because they secrete a number of antimicrobial compounds, such as lysozyme, lactoferrin, secretory protease inhibitor, and secretory IgA (Basbaum et al., 1990Go). Essentially, they also maintain effective mucociliary clearance, because they are responsible for the glandular secretion of salt and water (Pilewski and Frizzell, 1999Go), hydrating mucus as it is secreted from mucous cells, and regulating the volume of the airway surface liquid lining the respiratory epithelial cells. In vitro, Calu-3 cells retain several of the markers of serous cell function, secreting antimicrobials and demonstrating active transepithelial anion secretion in response to a number of pharmacological stimuli that raise intracellular cAMP or Ca2+ concentrations (Shen et al., 1994Go; Moon et al., 1997Go). Serous cells also express the highest levels of the cystic fibrosis transmembrane conductance regulator (CFTR) Cl- channel (Engelhardt et al., 1992Go), mutations in which result in CF. Indeed, the high degree of CFTR expression in the serous cell in relation to other airway cell types has led to the proposal that these cells represent the primary site of CF pathology (Pilewski and Frizzell, 1999Go).

Thus, we now sought to investigate whether isoprostanes, potentially produced during airway inflammation when H2O2 acts on arachidonic acid in the airways, elicit a biological effect on Calu-3 cells, a human airway epithelial cell line, and how those effects are mediated.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Measurement of Transepithelial Short-Circuit Current (Isc). Calu-3 cells (American Type Culture Collection, Manassas, VA) were maintained and plated on Snapwell inserts (Corning Costar, Cambridge, MA) as described previously (Cowley and Linsdell, 2002aGo). Cells were grown at an air-liquid interface with medium present only on the basolateral side and experiments performed 10 to 20 days after the establishment of this interface. Inserts were mounted in an Ussing chamber (World Precision Instruments, Sarasota, FL), and the transepithelial potential difference clamped to zero using a DVC-1000 voltage-clamp apparatus (World Precision Instruments). The transepithelial short-circuit current (Isc) was recorded using Ag-AgCl electrodes in agar bridges. Apical and basolateral solutions were maintained at 37°C by heated water jackets and were separately perfused and oxygenated with a 95% O2/5% CO2 mixture. Bath solutions for intact monolayers were 120 mM NaCl, 25 mM NaHCO3, 3.3 mM KH2PO4, 0.8 mM K2HPO4, 1.2 mM MgCl2, 1.2 mM CaCl2, 10 mM glucose (basolateral) or mannitol (apical), pH 7.4 at 37°C, when gassed with 95% O2/5% CO2.

Permeabilized Monolayers. To investigate the activity of apical Cl- and basolateral K+ channels in isolation, the opposite membrane was permeabilized by addition of 180 µg/ml nystatin (Sigma, Oakville, ON, Canada) in the presence of appropriate buffers (Cowley and Linsdell, 2002aGo). Thus, apical Cl- conductance was studied in the presence of a serosal to mucosal Cl- gradient with the following bath solutions: apical, 145 mM Na-gluconate, 3.3 mM NaH2PO4, 0.8 mM Na2HPO4, 1.2 mM Mg(gluconate)2, 4 mM Ca(gluconate)2, 10 mM glucose, and 10 HEPES; basolateral, 145 mM NaCl, 3.3 mM NaH2PO4, 0.8 mM Na2HPO4, 1.2 mM MgCl2, 1.2 mM CaCl2, 10 mannitol, and 10 mM HEPES.

Basolateral K+ channels were studied by permeabilization of the apical membrane in the presence of a mucosal to serosal K+ gradient established by the following bath solutions: apical, 145 mM K-gluconate, 3 mM KH2PO4, 0.8 mM K2HPO4, 1.2 mM Mg(gluconate)2, 4 mM Ca(gluconate)2, 10 mM glucose, and 10 mM HEPES; basolateral, 145 mM Na-gluconate, 3.3 mM NaH2PO4, 0.8 mM Na2HPO4, 1.2 mM Mg(gluconate)2, 4 mM Ca(gluconate)2, 10 mM glucose, and 10 mM HEPES. All solutions were pH 7.4 at 37°C.

RNA Extraction. Total RNA was extracted from Calu-3s cells using TRIzol reagent (Invitrogen, Burlington, ON, Canada). RNA was then DNase-treated with RQ1 RNase-free DNase (Promega, Madison, WI), and the product was run on a 1% agarose gel to check integrity. DNase-treated RNA (2 µg) was then reverse transcribed using Moloney murine leukemia virus reverse transcriptase (Invitrogen) in the presence of 5 mM dNTP and 1 µM oligo(dT) (Amersham Biosciences, Baie d'Urfe, PQ, Canada) to produce cDNA.

Polymerase Chain Reaction. After reverse transcription, PCR was performed to amplify DNA fragments using the primers described by Miggin and Kinsella (1998Go). A common primer (5' GAGATGATGGCTCAGCTCCT 3') was used to look for both TP isoforms, whereas different primers were used to distinguish between the TP{alpha} (5' CCAGCCCCTGAATCCTCA 3') and TP{beta} isoforms (5' AGACTCCGTCTGGGCCG 3'). All custom primers were obtained from Invitrogen (Burlington, ON, Canada), and reactions were performed using primer pairs at 10 µM with 2.5 units of Taq polymerase (MBI Fermentas, Burlington, ON, Canada), 25 mM MgCl2, and 5 mM dNTP in a total reaction volume of 25 µl. The amplification conditions were: denaturation at 95°C for 1 min, annealing at 58°C for 30 s, and elongation at 72°C for 3 min. PCR products were visualized by loading a 8-µl sample on a 1.5% agarose gel containing 250 µg/l ethidium bromide, alongside a 100-base pair DNA ladder (Invitrogen).

DNA Sequencing. To confirm the identity of the amplified PCR fragments, the product was isolated from the gel using the QIAquick gel extraction kit (QIAGEN, Mississauga, ON, Canada). DNA was then ligated into the pGEM vector (Promega), propagated in Escherichia coli strain JM109 and sequenced using the Sequenase DNA sequencing kit (U.S. Biochemical, Cleveland, OH).

Chemicals. 8-iso-Prostaglandin E2, 8-iso-prostaglandin F2{alpha}, SQ 29,548 and U-46619 were obtained from Caymen Chemical (Ann Arbor, MI). Diphenylamine-2-carboxylate (DPC), nystatin, 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS), clotrimazole, and clofilium tosylate were obtained from Sigma Aldrich (Oakville, ON, Canada). The cell-permeable protein kinase A inhibitor 14–22 amide, myristoylated, and chelerythrine chloride and BAPTA-AM were from Calbiochem (San Diego, CA). Stock solutions of the isoprostanes, DPC, and clotrimazole were made up in ethanol, whereas nystatin, DIDS, SQ 29,548, U-46619, clofilium, and the protein kinase A (PKA) inhibitor were made up in dimethyl sulfoxide so that the final bath concentration of solvent was <=0.1%. DIDS was made up in buffer. Application of dimethyl sulfoxide or ethanol alone had no effects upon the monolayers.

Statistics. All data are presented as means ± S.E.M. Differences between groups were tested for statistical significance using the Student's t test or one-way analysis of variance followed by a Bonferroni t test where appropriate. Significance was determined as p < 0.05.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Effect of Isoprostanes on Isc across Intact Calu-3 Monolayers. The basal Isc was increased in a dose-dependent manner by the addition of 8-iso-PGE2 to either the apical or the basolateral face of monolayers of Calu-3 cells (Fig. 1). Such an increase in Isc is consistent with increased transepithelial anion secretion across the cells. However, a larger increase in Isc was consistently seen when 8-iso-PGE2 was applied to the basolateral side of the cells (Fig. 1, A and D) rather than the apical (Fig. 1, B and D). In either situation however, application of 8-iso-PGE2 initially produced a large, transient increase in Isc that was followed by a sustained component (Fig. 1). This response is similar in magnitude and duration to that seen with the addition of forskolin (Fig. 1C), an agent known to elevate intracellular cAMP that we reported previously to produce an increase in Isc of 23.2 ± 2.6 µA/cm2 (Cowley and Linsdell, 2002bGo).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Isoprostanes 8-iso-PGE2 and 8-iso-PGF2{alpha} stimulates short circuit current (Isc) cross Calu-3 monolayers. Application of 8-iso-PGE2 to either the basolateral (A) or apical (B) side of monolayers of Calu-3 cells results in a rapid increase in Isc. A much larger response is seen for the same concentration (300 nM) of 8-iso-PGE2 when applied to the basolateral rather than the apical aspect. For comparison, the response to a maximal dose of forskolin (2 µM) is shown in C. Application of 8-iso-PGE2 (D) or 8-iso-PGF2{alpha} (E) increased Isc across Calu-3 monolayers in a dose-dependent manner. However, the response to 8-iso-PGF2{alpha} was small and elicited only at the highest concentrations. Basolateral application of either isoprostane produces a larger response than apical application. Each point represents the mean of between three and nine experiments; when no error bar is shown, the size of the error bar was less than the size of the symbol.

 

The addition of 8-iso-PGF2{alpha} to the basolateral aspect of cells did increase Isc, although to a much lesser extent than 8-iso-PGE2 (Fig 1E). When 8-iso-PGF2{alpha}was added apically, the increase in Isc was also minor compared with 8-iso-PGE2. Because 8-iso-PGE2 produced a much larger increase in Isc than 8-iso-PGF2{alpha} (Fig. 1) we went on to investigate the mechanism of the 8-iso-PGE2 response in more detail. 300 nM 8-iso-PGE2 was chosen as the dose for all subsequent investigations. The increase in Isc recorded when 300 nM 8-iso-PGE2 was applied to the basolateral side of Calu-3 cells was 47.2 ± 2.5 µA/cm2 (n = 9) compared with 24.4 ± 1.7 µA/cm2 (n = 4) for apical application. For comparison, 300 nM 8-iso-PGF2{alpha} applied basolaterally produced an increase in Isc of 4.7 ± 1.1 µA/cm2 (n = 3), whereas no increase could be detected for the same dose applied apically.

EC50 values were determined as 53 and 160 nM for 8-iso-PGE2 applied to the basolateral and apical sides, respectively, whereas 8-iso-PGF2{alpha}had an EC50 of 300 nM for basolateral application. The dose-response curves in Fig. 1, D and E, show a supramaximal decline to the agonist. This may well reflect some degree of desensitization, or it may be that at the higher concentrations, additional receptor types are recruited in a nonspecific manner, some of which act to inhibit secretion in these cells.

Effect of Chloride Channel Inhibitors on the 8-iso-PGE2–Mediated Increase in Isc across Calu-3 Monolayers. Both basal and stimulated anion secretion from Calu-3 cells has previously been shown to be dependent upon the activity of CFTR Cl- channels (Shen et al., 1994Go; Singh et al., 1997Go; Moon et al., 1997Go; Cowley and Linsdell 2002aGo). To investigate whether the 8-iso-PGE2–mediated increase in Isc seen across monolayers of Calu-3 cells was dependent upon CFTR, we examined the effect of the Cl- channel inhibitors DPC and DIDS (Schultz et al., 1999Go). When 0.5 mM DPC was applied to the apical side of the monolayers after 300 nM 8-iso-PGE2, the secretory response was immediately inhibited (Fig. 2A). Furthermore, when 0.5 mM DPC was applied before the isoprostane (Fig. 2B), the basal Isc was initially inhibited, and the subsequent increase in Isc to 300 nM 8-iso-PGE2 was significantly reduced to 6.5 ± 1.2 µA/cm2 (n = 3) or 13% of the control response (Fig. 2C). In contrast, prior application of the disulfonic stilbene DIDS (250 µM) had no effect on the magnitude of the response to 300 nM 8-iso-PGE2 (48.1 ± 5.2 µA/cm2, n = 6, Fig. 2C). Although DIDS inhibits a variety of Cl- channels (Schultz et al., 1999Go), CFTR is insensitive to extracellularly applied DIDS. This combination of sensitivity to DPC and insensitivity to DIDS suggests that the anion secretion in response to 8-iso-PGE2 may be mediated via CFTR, and a further series of experiments was performed to investigate the PKA-dependence of the channel mediating the 8-iso-PGE2 response.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. Effect of chloride channel inhibitors on the 8-iso-PGE2-mediated increase in Isc across Calu-3 monolayers. The duration of this response was reduced and the sustained component inhibited when DPC (0.5 mM) was applied to the apical aspect of the monolayers after 8-iso-PGE2 application (A; compare with Fig. 1A). When 0.5 mM DPC was applied before 8-iso-PGE2 application (B), the subsequent response to the stimulus was significantly reduced (C). Application of 250 µM DIDS had no effect (C).

 

Effect of 8-iso-PGE2 on Apical Cl- Conductance. To further examine the mechanism of the increase in transepithelial anion secretion in response to this isoprostane, we isolated the apical membrane Cl- conductance by permeabilizing the basolateral membrane with the pore-forming antibiotic nystatin in the presence of a serosal-to-mucosal Cl- gradient. Addition of 300 nM 8-iso-PGE2 to the apical face of the permeabilized monolayers resulted in an increase in Isc of 46.4 ± 1.6 µA/cm2, n = 5 (Fig. 3A), which under these conditions represents increased efflux of Cl- ions across the apical membrane down their concentration gradient. Again, this increase in Isc was insensitive to DIDS (250 µM) applied to the extracellular aspect of the membrane but inhibitable by DPC (0.5 mM; Fig. 3A, n = 4). To investigate the mechanism responsible for the increase in apical membrane Cl- conductance (GCl), we used an inhibitor of protein kinase A, PKA inhibitor 14–22 amide, because the activity of CFTR is known to be regulated via the PKA/cAMP pathway (Sheppard and Welsh, 1999Go). Monolayers of Calu-3 cells were incubated in 10 µM PKA inhibitor 14–22 amide, myristoylated for 60 min, after which the basolateral membrane was permeabilized by the addition of nystatin. Under these conditions, the subsequent application of 300 nM 8-iso-PGE2 to the apical aspect of the membrane did not result in an increase in the Isc (Fig. 3B; n = 4).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. 8-iso-PGE2 increases the apical Cl- efflux in permeabilized Calu-3 monolayers. Apical Cl- conductance was isolated by permeabilizing the basolateral membrane with nystatin (NYS) in the presence of a serosal to mucosal Cl- gradient, so that an increase in Isc reflects Cl- efflux. Addition of 300 nM 8-iso-PGE2 to the apical face of the membrane induced an increase in Cl- conductance (n = 5), which was insensitive to 250 µM DIDS (n = 4) but inhibited by 0.5 mM DPC applied apically (n = 4; A). Incubation with protein kinase inhibitor 14–22 amide for 60 min before permeabilizing the basolateral membrane completely abolished the increase in Cl- conductance normally seen with 300 nM 8-iso-PGE2 (n = 4; B). Preincubation with either the Ca2+ chelator BAPTA-AM (50 µM for 60 min, n = 3; C) or the PKC inhibitor chelerythrine chloride (10 µM for 30 min, n = 3; D) had no effect on the subsequent response to 300 nM 8-iso-PGE2.

 

An additional series of experiments was undertaken to investigate whether the response to 8-iso-PGE2 was mediated via increases in intracellular Ca2+ and the protein kinase C (PKC) pathway. Preincubation of cells with 50 µM of the Ca2+ chelator BAPTA-AM before permeabilization of the basolateral membrane with nystatin had no effect on the magnitude of the subsequent response to 300 nM 8-iso-PGE2 (mean increase in Isc = 44.1 ± 7.7 µA/cm2; n = 3, Fig. 3C). Furthermore, the possible involvement of PKC was investigated by preincubating cells for 60 min with the PKC inhibitor chelerythrine chloride (mean increase in Isc = 10 µM; 45. 2 ± 2.0 µA/cm2; n = 3, Fig. 3D.) Thus, we are able to conclude that the 8-iso-PGE2–mediated increase in GCl is dependent on the PKA pathway, whereas we can find no evidence that the PKC pathway is involved.

Effect of 8-iso-PGE2 on Basolateral K+ Conductance. To isolate basolateral K+ conductance, the apical membrane was permeabilized with nystatin in the presence of Cl--free buffers to establish a mucosal to serosal K+ gradient. Under these conditions, application of 300 nM 8-iso-PGE2 to the basolateral side of the monolayers produced a transient increase in Isc of 24.2 ± 2.8 µA/cm2, n = 5 (Fig. 4, A and B), which reflects an increase in K+ conductance (GK). We have previously demonstrated that agonist-stimulated secretion across Calu-3 monolayers can be inhibited by the K+ channel inhibitors clofilium and clotrimazole, agents that probably inhibit the KvLQT1 and Ca2+-activated hSK4 (or hIK) channels present in these cells and are encoded by the genes KCNQ1 and KCNN4, respectively (Cowley and Linsdell, 2002bGo). In cell monolayers pretreated with 30 µM clotrimazole before the addition of 300 nM 8-iso-PGE2, the increase in Isc was only 5.8 ± 0.8 µA/cm2 (Fig. 4B; n = 4), or approximately 24% of the control value. The addition of 100 µM clofilium also significantly reduced the subsequent response to 8-iso-PGE2, this time to 12.8 ± 2.8 µA/cm2 (Fig. 4B, n = 4) or 52% of control values. It seems that the major component of the increase in GK we see in response to 8-iso-PGE2 is probably mediated via a clotrimazole-sensitive channel, probably Ca2+-activated K+ channel hSK4, whereas the clofilium-sensitive channels such as KvLQT1 seem less important.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. Basolateral K+ conductance in permeabilized Calu-3 cells is increased by 8-iso-PGE2. Basolateral K+ conductance was isolated by permeabilization of the apical membrane with nystatin in the presence of a mucosal to serosal K+ gradient. The application of 300 nM 8-iso-PGE2 to the basolateral membrane under these conditions caused an increase in Isc, reflecting an increase in K+ efflux (A and B). Application of the K+ channel blockers clotrimazole (30 µM) or clofilium (100 µM) reduced the 8-iso-PGE2–mediated response to 24% (n = 4) or 52% (n = 4), respectively, of the control value (n = 4).

 

Mechanism of 8-iso-PGE2 Action. There is evidence that 8-iso-PGE2 (and 8-iso-PGF2{alpha}) may achieve their effects via binding to the thromboxane A2 (TP) receptor (Elmhurst et al., 1997Go; Sametz et al., 2000Go; Janssen, 2001Go; Kinsella, 2001Go). However, there are also reports suggesting that unique isoprostane-selective receptors may exist (Longmire et al., 1994Go). Presently, it is unclear which receptor types could be responsible for the effects of 8-iso-PGE2 that we see in Calu-3 cells. To investigate whether the TP receptor could be mediating this effect, we first examined whether the response to 8-iso-PGE2 could be inhibited by SQ 29,548, a specific TP receptor antagonist (Fukunaga et al., 1993Go; Elmhurst et al., 1997Go). Application of 10 µM SQ 29,548 10 min before the addition of 300 nM 8-iso-PGE2 significantly reduced the increase in Isc when the isoprostane was applied to the apical (35% of control, n = 3; Fig. 5A) but not the basolateral (n = 6; Fig. 5B) side of the Calu-3 monolayers.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 5. Calu-3 cells express functional TP receptors and transcripts for the TP {alpha} receptor. Application of the TP receptor antagonist SQ 29,548 (10 µM) 10 min before the addition of 300 nM 8-iso-PGE2 significantly reduced the increase in Isc when the isoprostane was applied to the apical (n = 3; A) but not the basolateral (n = 6; B) side of the Calu-3 monolayers. Application of 3 µM U46619 [GenBank] , a TP receptor agonist, resulted in an increase in the Isc across monolayers of Calu-3 cells (C). Transcripts were detected for the thromboxane A2 (TP) receptor {alpha} isoform (D; lane 2) but not {beta} (lane 3). Lane A contains a 100-base pair marker.

 

To establish the presence of functional TP receptors on Calu-3 cells, we next used a specific thromboxane A2 mimetic, U-46619 (Walsh and Kinsella, 2000Go; Janssen and Tazzeo, 2002Go). Addition of 3 µM U-46619 to both sides of intact monolayers of Calu-3 cells stimulated an increase in Isc (22.9 ± 2.0 µA/cm2; Fig. 5C; n = 3), indicating that functional TP receptors are indeed present on Calu-3 cells. Application of the TP receptor agonist to either the apical or the basolateral face stimulated an increase in Isc, suggesting that TP receptors are present on both sides of the monolayers. Basolateral application of 3 µM U-46619 increased Isc by 11.46 ± 2.1 µA/cm2 (n = 4), whereas apical application increased Isc by 10.86 ± 1.7 µA/cm2.

Two isoforms of the TP receptor have been described, TP{alpha} and TP{beta}, both members of the G-protein-coupled receptor superfamily that differ with regard to their C termini (Narumiya et al., 1999Go; Kinsella, 2001Go). Using specific primers designed to distinguish between these two splice variants (Miggin and Kinsella, 1998Go), we performed RT-PCR on total RNA extracted from confluent cultures of Calu-3 cells (Fig. 5D). We were able to detect a 400-base pair fragment of the TP{alpha} isoform and were unable to detect the TP{beta} isoform (expected fragment size was 269 base pairs). The band detected using the TP{alpha}-specific primers was excised, subcloned into the pGEM vector, and sequenced to confirm its identity. Comparison of the sequence produced with the published sequence (National Center for Biotechnology Information) confirmed 100% identity with the human TP receptor (NCBI accession number XM0476330).

To further investigate the mode of action of U-46619 in Calu-3 cells and compare this with the effects of 8-iso-PGE2, permeabilized monolayers were used to investigate the second-messenger pathways responsible for its secretory effect. Again, monolayers were preincubated for 60 min in the presence of the either PKA inhibitor 14–22 amide (10 µM) or the PKC inhibitor chelerythrine chloride (10 µM). After incubation, the basolateral membrane was permeabilized by the addition of nystatin, and the GCl was recorded in response to 3 µM U-46619. A typical response to U-46619 is shown in Fig 6A. Preincubation with the PKA inhibitor 14–22 amide virtually abolished the response to U-46619 (Fig. 6B; n = 3), as did incubation with chelerythrine chloride (Fig. 6C; n = 3).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 6. The increase in apical Cl- efflux in permeabilized Calu-3 monolayers in response to the TP receptor agonist is inhibited by inhibition of PKA and PKC. Apical Cl- conductance was isolated by permeabilizing the basolateral membrane with nystatin (NYS) in the presence of a serosal-to-mucosal Cl- gradient, so that an increase in Isc reflects Cl- efflux. Application of the TP receptor agonist U-44619 (3 µM) to the apical face of the membrane induced an increase in Cl- conductance (A) that was inhibited by preincubation with protein kinase inhibitor 14–22 amide for 60 min (B; n = 3), and chelerythrine chloride for 30 min (C; n = 3).

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we investigated whether isoprostanes elicited a physiological response from human airway epithelial cells. Our finding, that the isoprostane 8-iso-PGE2 stimulates transepithelial anion secretion across intact monolayers of Calu-3 cells, is the first report of the effects of an isoprostane on airway epithelial cells and has important implications for our understanding of the pulmonary host defense response to oxidant stress.

To date, there has only been one report of the effect of isoprostanes on epithelial tissue (Elmhurst et al., 1997Go), despite the potential importance of the epithelium in mediating responses to oxidant stress. This found application of 8-iso-PGE2 to the serosal (basolateral) side of epithelial sheets from canine proximal colon induced dose-dependent increases in the Isc. We report here that 8-iso-PGE2 also increases Isc measured across cultured monolayers of a human airway epithelial cell line, Calu-3, a widely used and accepted model of the human submucosal gland serous cell (Shen et al., 1994Go; Moon et al., 1997Go; Cowley and Linsdell, 2002aGo,bGo).

The most widely studied isoprostanes have been 8-iso-PGE2 and 8-iso-PGF2{alpha}; therefore, these are the molecules we chose to investigate. We found that 8-iso-PGE2 stimulates anion secretion from Calu-3 cells measured as an increase in Isc. For any given concentration, the increase in Isc was always larger when 8-iso-PGE2 was applied to the basolateral compared with the apical side of the cells (Fig. 1). In contrast, application of 8-iso-PGF2{alpha} produced only very small increases in Isc even at large doses (Fig. 1E), and was not subsequently investigated further.

The increase in Isc seen in response to 8-iso-PGE2 was almost entirely inhibited by DPC (Figs. 2 and 3A) and unaffected by the disulfonic stilbene DIDS (Figs. 2C and 3A). This DPC sensitivity and DIDS insensitivity suggests that the increases we are seeing are mediated via the activation of CFTR. However, DPC is far from a specific inhibitor of CFTR, and this result does not entirely rule out the involvement of another Cl- channel type. Therefore, we further investigated the role of PKA in mediating this response, because CFTR activity in Calu-3 cells is regulated by PKA activity (Cobb et al., 2002Go). Preincubation with the PKA inhibitor 14–22 amide abolished the apical membrane increase in GCl in response to 8-iso-PGE2 (Fig. 3B) and is additional evidence that we are looking at a CFTR-mediated response. Furthermore, we could find no evidence that the PKC pathway is involved in mediating the response to 8-iso-PGE2, because the increase in GCl was unaffected by either the Ca2+ chelator BAPTA-AM or the PKC inhibitor chelerythrine chloride.

In addition to stimulating apical GCl, 8-iso-PGE2 also stimulated GK across the basolateral membrane of Calu-3 cells, an increase that was significantly reduced by the K+ channel blockers clofilium and clotrimazole (Fig. 4B). Halm and Halm (2001Go) reported that 8-iso-PGE2 stimulated K+ secretion across guinea pig distal colon, although the K+ channels responsible were not investigated. Clofilium inhibits the cAMP-activated K+ channel KvLQT1, whereas clotrimazole inhibits the Ca2+-activated K+ channel hSK4 (or hIK), both previously demonstrated to be present in Calu-3 cells (Cowley and Linsdell, 2002bGo.) At the dose used (100 µM), we cannot be certain that clofilium is acting exclusively to inhibit only KvLQT1; it may well be that other K+ channel types are inhibited, because the entire complement of K+ channels in Calu-3 cells has not been described. However, the overall effect of opening basolateral K+ channels would be to increase anion secretion across the apical membrane, because this K+ exit would hyperpolarize the cell, increasing the electrochemical driving force for anions to leave the cell. Thus, 8-iso-PGE2 stimulation of basolateral K+ channels in concert with the stimulation of apical CFTR would effectively maximize the secretory response to the isoprostane. This coordinated increase in both GCl and GK is not unique to 8-iso-PGE2; indeed, we have found a similar result for both cAMP and H2O2 (Cowley and Linsdell, 2002aGo,bGo), suggesting that this may be a common physiological mechanism to facilitate secretion from these cells.

The sidedness of the response to 8-iso-PGE2, in which a larger response was always seen when agonist was applied basolaterally rather than apically, suggests that differences exist in the receptor complement or type available to mediate the cellular response. Although it has been proposed that some isoprostane effects may be mediated via a unique (asyet unidentified) isoprostane receptor (Morrow and Roberts, 1996Go), many of their effects seem to be mediated via prostanoid receptors. To date, there is evidence that 8-iso-PGE2 may act via the TP, FP, or EP receptors depending on the tissue type (Janssen, 2001Go). We examined whether 8-iso-PGE2 was acting via the TP receptor to mediate the secretory response from Calu-3 cells because this receptor type has been most widely implicated in mediating the 8-iso-PGE2 response (Elmhurst et al., 1997Go; Sametz et al., 2000Go; Janssen, 2001Go; Kinsella, 2001Go), Two isoforms, TP{alpha} and TP{beta}, which have been described previously (Narumiya et al., 1999Go), differ in the length of their C termini (Narumiya et al., 1999Go; Kinsella, 2001Go). Preapplication of the TP receptor antagonist SQ 29,548 (10 µM) significantly reduced the apical response to 8-iso-PGE2, although did not abolish it (Fig. 5A). However, the same concentration of SQ 29,548 had no effect on the basolateral response to this isoprostane (Fig. 5B). The most obvious interpretation of these results is that TP receptors are present predominately on the apical aspect of these cells. Furthermore, addition of U-46619, a TP receptor agonist, induced an increase in Isc across Calu-3 cells (Fig. 5C), whereas RT-PCR revealed that Calu-3s express mRNA for the TP{alpha} isoform of the receptor (Fig. 5D). Thus, we present functional and molecular evidence that Calu-3 cells express TP receptors. However, application of the TP receptor agonist induced an approximately equivalent increase in Isc when it was applied to either the apical or the basolateral side of the cells. This is in apparent contrast to the SQ 29,548 antagonist data suggesting that TP receptors are present predominately apically, because it would be expected that application of U-46619 would induce more of a response apically than basolaterally. One possibility is that U-46619 is rapidly diffusing into and across the monolayers of cells, so that the response we see is mediated predominately via apical TP receptors. Alternatively, it might be that at the concentration used (3 µM) U-46619 is not acting specifically at TP receptors, but influencing other prostanoid receptors present on these cells.

To further investigate how U-46619 mediates secretion from Calu-3 cells, we looked at how PKA and PKC inhibition affected its response. Although TP receptors are widely reported to be coupled to phospholipase C and the elevation of intracellular Ca2+ (Kinsella, 2001Go), we found that incubation with inhibitors of either PKA or PKC abolished the response to U-46619. Thus, in Calu-3 cells, it would seem that activation of TP receptors affects the PKC pathway; further downstream, however, there seems to be some complex cross-talk also leading to the activation of PKA.

Taken together, our results demonstrate that functional TP receptors are present on Calu-3 cells. However, the differences we observe in the responses to 8-iso-PGE2 and U-46619 suggest that TP receptors are, at best, only partly responsible for mediating the effects of 8-iso-PGE2 in Calu-3 cells and that other TP receptor-independent mechanisms, such as binding to additional receptor types, are probably also involved.

The major finding of this study, that 8-iso-PGE2 stimulates transepithelial anion secretion via CFTR, has potentially important implications for the pathogenesis of CF lung disease, because this mechanism would not function in the CF lung. In the normal submucosal gland serous cell in vivo, stimulated anion secretion via CFTR would be coupled to fluid secretion. This fluid would assist clearing any infectious agents from the airways because it would flush out and fully hydrate mucus secreted from submucosal gland mucous cells, and it would also be rich in endogenous antimicrobial compounds that would directly attack invading organisms (Basbaum et al., 1990Go). Thus, the release of this fluid would assist host defense mechanisms act to rid the airways of the initial inflammatory insult that leads to ROS production and isoprostane generation. CF lung disease, however, is characterized by repeated and persistent incidents of bacterial infection and consequent inflammatory responses, which ultimately lead to tissue damage and respiratory failure. In the absence of CFTR, this response would be absent, reducing the amount of fluid secreted from submucosal gland serous cells and potentially exposing the CF lung to oxidant stress for extended periods. Thus, loss of this CFTR-mediated response could compromise the CF lung and reduce its ability to carry out effective mucociliary clearance.

In conclusion, we here make the first report of the effects of an isoprostane, 8-iso-PGE2, on human airway epithelial cells. Isoprostanes are associated with incidents of oxidative stress, because they are produced via the action of ROS on polyunsaturated fatty acids, and elevated levels of isoprostanes have been recorded in a wide variety of inflammatory lung diseases. Because human airways are constantly exposed to instances of oxidant stress, resulting both from the inhalation of foreign material as well as the production of ROS by activated inflammatory cells, it is likely that airway epithelial cells are exposed to elevated levels of isoprostanes. 8-iso-PGE2–stimulated transepithelial anion secretion across monolayers of Calu-3 cells via concerted effects at apical CFTR Cl- channels and basolateral K+ channels. Stimulation of both channel types would maximize the secretory response from the cells, which we propose would help flush the airways of the agent responsible for producing the oxidant stress. Furthermore, our finding that this process is CFTR-mediated suggests that this response to isoprostanes (and oxidant stress in general) would be absent in the CF lung, reducing the effectiveness of host defense mechanisms and potentially exposing the CF lung to extended periods of oxidant stress. This is the first report of an isoprostane eliciting an effect in airway epithelial cells, and suggests a potential role for this class of molecules in pulmonary host defense.


    Acknowledgements
 
I thank Susan Burbridge for technical assistance and Dr. Paul Linsdell for comments on the manuscript.


    Footnotes
 
This work was supported by the Nova Scotia Lung Association and the Canadian Cystic Fibrosis Foundation.

ABBREVIATIONS: CF, cystic fibrosis; ROS, reactive oxygen species; CFTR, cystic fibrosis transmembrane conductance regulator; PCR, polymerase chain reaction; SQ 29,548, [1S-[1a,2a(Z),3a,4a]]-7-[3-[[2-[(phenylamino)carbonyl]hydrazino]methyl]-7-oxabicyclo(2.2.1)hept-2-yl]-5-heptenoic acid; U-46619, 9,11-dideoxy-9{alpha},11{alpha}-methanoepoxy-prostaglandin F2{alpha}; DPC, diphenylamine-2-carboxylate; DIDS, 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid; BAPTA, 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid; PKA, protein kinase A; PG, prostaglandin; PKC, protein kinase C; RT, reverse transcription.

Address correspondence to: Elizabeth Cowley, Department of Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia B3H 4H7, Canada. E-mail: elizabeth.cowley{at}dal.ca


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Basbaum CB, Berthold J, and Finkbeiner WE (1990) The serous cell. Annu Rev Physiol 52: 97–113.[CrossRef][Medline]

Catalli A, Zhang D, and Janssen LJ (2002) Receptors and signalling pathway underlying relaxations to isoprostanes in canine and porcine airway smooth muscle. Am J Physiol 283: L1151–L1159.

Cobb BR, Ruiz F, King CM, Fortenberry J, Greer H, Kovacs T, Sorscher EJ, and Clancy JP (2002) A2 adenosine receptors regulate CFTR through PKA and PLA2. Am J Physiol 282: L12–L25.

Cowley EA and Linsdell P (2002a) Oxidant stress stimulates anion secretion from the human airway epithelial cell line Calu-3: implications for cystic fibrosis lung disease. J Physiol 543: 201–209.[Abstract/Free Full Text]

Cowley EA and Linsdell P (2002b) Characterization of basolateral K+ channels underlying secretion in the human airway cell line Calu-3. J Physiol 538: 747–757.[Abstract/Free Full Text]

Dworski R (2000) Oxidant stress in asthma. Thorax 55 Suppl 2: S51–S53.[Medline]

Elmhurst JL, Betti PA, and Rangachari PK (1997) Intestinal effects of isoprostanes: evidence for the involvement of prostanoid EP and TP receptors. J Pharmacol Exp Ther 282: 1198–1205.[Abstract/Free Full Text]

Engelhardt JF, Yankaskas JR, Ernst SA, Yang Y, Marino CR, Boucher RC, Cohn JA, and Wilson JM (1992) Submucosal glands are the predominant site of CFTR expression in the human bronchus. Nat Gen 2: 240–248.[CrossRef][Medline]

Fam SS, Murphey LJ, Terry ES, Zackert WE, Chen Y, Gao L, Pandalai S, Milne GL, Roberts LJ, Porter NA, et al. (2002) Formation of highly reactive A-ring and J-ring isoprostane-like compounds (A4/J4-neuroprostanes) in vivo from docosahexaenoic acid. J Biol Chem 277: 26076–36084.

Fukunaga M, Yura T, and Badr KF (1992) Stimulatory effect of 8-epi-PGF2{alpha}, an F2-isoprostane, on endothelin-1 release. J Cardiovasc Pharmacol 26: S51–S52.

Fukunaga M, Takahashi K, and Badr KF (1993) Vascular smooth muscle actions and receptor interactions of 8-isoprostaglandin E2, an E2-isoprostane. Biochem Biophys Res Commun 195: 507–515.[CrossRef][Medline]

Halm DR and Halm ST (2001) Prostanoids stimulate K secretion and Cl secretion in guinea pig distal colon via distinct pathways. Am J Physiol 281: G984–G996.

Janssen LJ (2001) Isoprostanes: an overview and putative roles in pulmonary pathophysiology. Am J Physiol 280: L1067–L1082.

Janssen LJ, Premji M. Netherton S, Catalli A, Cox G, Keshavjee S and Crankshaw DJ (2000) Excitatory and inhibitory actions of isoprostanes in human and canine airway smooth muscle. J Pharmacol Exp Ther 295: 506–511.[Abstract/Free Full Text]

Janssen LJ, Premji M, Netherton S, Coruzzi J, and Cox PG (2001) Vasoconstrictor actions of isoprostanes via tyrosine phosphorylation and Rho kinase in human and canine pulmonary vascular smooth muscles. Br J Pharmacol 132: 127–134.[CrossRef][Medline]

Janssen LJ and Tazzeo T (2002) Involvement of TP and EP3 receptors in vasoconstrictor responses to isoprostanes in pulmonary vasculature. J Pharmacol Exp Ther 301: 1060–1066.[Abstract/Free Full Text]

Kinsella BT (2001) Thromboxane A2 signalling in humans: a "tail" of two receptors. Biochem Soc Trans 29: 641–654.[CrossRef][Medline]

Kobzar G, Mardla V, Järving I, Samel N, and Löhmus M (1997) Modulatory effect of 8-iso-PGE2 on platelets. Gen Pharmacol 28: 317–321.[Medline]

Lamb NJ, Gutteridge JM, Baker C, Evans TW and Quinlan GJ (1999) Oxidative damage to proteins of bronchoalveolar lavage fluid in patients with acute respiratory distress syndrome: evidence for neutrophil-mediated hydroxylation, nitration and chlorination. Crit Care Med 27: 1738–1744.[CrossRef][Medline]

Leitinger N, Blazek I, and Sinzinger H (1997) The influence of isoprostanes on ADP-induced platelet aggregation and cyclic AMP-generation in human platelets. Thromb Res 86: 337–342.[CrossRef][Medline]

Longmire AW, Roberts LJ, and Morrow JD (1994) Actions of the E2-isoprostane, 8-iso-PGE2, on the platelet thromboxane/endoperoxide receptor in humans and rats: additional evidence for the existence of a unique isoprostane receptor. Prostaglandins 48: 247–256.[CrossRef][Medline]

Miggin SM and Kinsella BT (1998) Expression and tissue distribution of the mRNAs encoding the human thromboxane A2 receptor (TP) {alpha} and {beta} isoforms. Biochim Biophys Acta 1425: 543–559.[Medline]

Montuschi P, Ciabattoni G, Paredi P, Pantelidis P, du Bois RM, Kharitonov SA, and Barnes PJ (1998) Exhaled 8-isoprostane as a biomarker of oxidative stress in interstitial lung diseases. Am J Respir Crit Care Med 158: 1524–1527.[Abstract/Free Full Text]

Montuschi P, Collins JV, Ciabattoni G, Lazzeri N, Corradi M, Kharitonov SA, and Barnes PJ (2000a) Exhaled 8-isoprostane as an in vivo biomarker of lung oxidative stress in patients with COPD and healthy smokers. Am J Respir Crit Care Med 162: 1175–1177.[Abstract/Free Full Text]

Montuschi P, Corradi M, Ciabattoni G, Nightingale J, Kharitonov SA, and Barnes PJ (1999) Increased 8-isoprostane, a marker of oxidative stress, in exhaled breath condensates of asthma patients. Am J Respir Crit Care Med 160: 216–220.[Abstract/Free Full Text]

Montuschi P, Kharitonov SA, Ciabattoni G, Corradi M, van Rensen L, Geddes DM, Hodson ME, and Barnes PJ (2000b) Exhaled 8-isoprostane as a new noninvasive biomarker of oxidative stress in cystic fibrosis. Thorax 55: 205–209.[Abstract/Free Full Text]

Moon S, Singh M, Krouse ME, and Wine JJ (1997) Calcium-stimulated Cl- secretion in Calu-3 human airway cells requires CFTR. Am J Physiol 273: L1208–L1219.

Morrow JD, Hill KE, Burk RF, Nammour TM, Badr KF, and Roberts LJ (1990) A series of prostaglandin F2-like compounds are produced in vivo in humans by a non-cyclooxygenase, free radical-catalyzed mechanism. Proc Natl Acad Sci USA 87: 9383–9387.[Abstract/Free Full Text]

Morrow JD and Roberts LJ (1996) The isoprostanes. Current knowledge and directions for future research. Biochem Pharmacol 51: 1–9.[CrossRef][Medline]

Narumiya S, Sugimoto Y, and Ushikubi F (1999) Prostanoid receptors: structures, properties and functions. Physiol Rev 79: 1193–1225.[Abstract/Free Full Text]

Pilewski JM and Frizzell RA (1999) Role of CFTR in airway disease. Physiol Rev 79: S215–S255.

Repine JE, Bast A, and Lankhorst I (1997) Oxidative stress in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 156: 341–357.[Free Full Text]

Sametz W, Hennerbichler S, Glaser S, Wintersteiger R, and Juan H (2000) Characterization of prostanoid receptors mediating actions of the isoprostanes, 8-iso-PGE2 and 8-iso-PGF2{alpha}, in some isolated smooth muscle preparations. Br J Pharmacol 130: 1903–1910.[CrossRef][Medline]

Schultz BD, Singh AK, Devor DC, and Bridges RJ (1999) Pharmacology of CFTR chloride channel activity. Physiol Rev 79: S109–S144.

Shen B-Q, Finkbeiner WE, Wine JJ, Mrsny RJ, and Widdicombe JH (1994) Calu-3: a human airway epithelial cell line that shows cAMP-dependent Cl- secretion. Am J Physiol 266: L493–L501.

Singh M, Krouse ME, Moon S, and Wine JJ (1997) Most basal Isc in Calu-3 human airway cells is bicarbonate-dependent Cl- secretion. Am J Physiol 272: L690–L698.

Sheppard DN and Welsh MJ (1999) Structure and function of the CFTR chloride channel. Physiol Rev 79: S23–S45.

van der Vliet A, Eiserich JP, Marelich GP, Halliwell B, and Cross CE (1997) Oxidative stress in cystic fibrosis: does it occur and does it matter? Adv Pharmacol 38: 491–513.

Walsh MT and Kinsella BT (2000) Regulation of the human prostanoid TP alpha and TP beta receptor isoforms mediated through activation of the EP1 and IP receptors. Br J Pharmacol 131: 601–609.[CrossRef][Medline]

Zahler S and Becker BF (1999) Indirect enhancement of neutrophil activity and adhesion to cultured human umbilical vein endothelial cells by isoprostanes (iPF2{alpha}-III and iPGE2-III). Prostaglandins Other Lipid Mediat 57: 319–331.[CrossRef][Medline]




This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. P. Joy and E. A. Cowley
8-iso-PGE2 Stimulates Anion Efflux from Airway Epithelial Cells via the EP4 Prostanoid Receptor
Am. J. Respir. Cell Mol. Biol., February 1, 2008; 38(2): 143 - 152.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
V. Seto, C. Hirota, S. Hirota, and L. J. Janssen
E-Ring Isoprostanes Stimulate a Cl Conductance in Airway Epithelium via Prostaglandin E2-Selective Prostanoid Receptors
Am. J. Respir. Cell Mol. Biol., January 1, 2008; 38(1): 88 - 94.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. Paredes, T. Tazzeo, and L. J. Janssen
E-Ring Isoprostane Augments Cholinergic Neurotransmission in Bovine Trachealis via FP Prostanoid Receptors
Am. J. Respir. Cell Mol. Biol., December 1, 2007; 37(6): 739 - 747.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
Y. Li, W. Wang, W. Parker, and J. P. Clancy
Adenosine Regulation of Cystic Fibrosis Transmembrane Conductance Regulator through Prostenoids in Airway Epithelia
Am. J. Respir. Cell Mol. Biol., May 1, 2006; 34(5): 600 - 608.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. Liu, A. M. Mamoon, and J. M. Farley, Sr.
Prostanoids Secreted by Alveolar Macrophages Enhance Ionic Currents in Swine Tracheal Submucosal Gland Cells
J. Pharmacol. Exp. Ther., November 1, 2005; 315(2): 729 - 739.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
D. L. Clarke, M. G. Belvisi, E. Hardaker, R. Newton, and M. A. Giembycz
E-Ring 8-Isoprostanes Are Agonists at EP2- and EP4-Prostanoid Receptors on Human Airway Smooth Muscle Cells and Regulate the Release of Colony-Stimulating Factors by Activating cAMP-Dependent Protein Kinase
Mol. Pharmacol., February 1, 2005; 67(2): 383 - 393.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cowley, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cowley, E. A.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition

Copyright © 2003 by the American Society for Pharmacology and Experimental Therapeutics