|
|
|
|
Departments of Pharmaceutical Sciences (N.F.K., T.L.B., E.Y.K., W.D., J.C.P., W.E.E.) and Hematology-Oncology (C.-H.P.), St. Jude Children's Research Hospital, Memphis, Tennessee; and University of Tennessee, Memphis, Tennessee (N.F.K., E.Y.K., C.-H.P., W.E.E.)
Received January 21, 2003; accepted May 9, 2003
| Abstract |
|---|
|
|
|---|
Thiopurines (e.g., 6-mercaptopurine, MP, and 6-thioguanine, TG) are widely
used medications for the treatment of pediatric ALL, representing an important
component of essentially all modern treatment protocols
(Elion, 1989
;
Pui and Evans, 1998
). The
incorporation of 6-thiodeoxyguanosine (dGS) into DNA after MP or TG
treatment results in DNA damage and is considered the major mechanism of
thiopurine cytotoxicity (LePage,
1963
; Maybaum and Mandel,
1983
; Krynetskaia et al.,
1999
). It has been shown in vitro that GS-inserts in
DNA change DNA-protein interactions with restriction endonucleases, RNaseH and
topoisomerase II (Iwaniec et al.,
1991
; Krynetskaia et al.,
1999
; Krynetskaia et al.,
2000
). The mechanisms of cellular response to DNA damaged by
thiopurine incorporation are not well defined but presumably involve cellular
systems such as DNA repair, transcription control, cell cycle arrest, and/or
apoptosis (Karran and Bignami,
1996
; Das-Gupta et al.,
2000
). The putative mechanism by which the MMR system promotes
thiopurine cytotoxicity involves the initiation of apoptosis after futile
efforts to repair DNA containing thioguanine mismatch pairs
(Karran and Bignami, 1996
;
Durant et al., 1999
). In vitro
experiments have demonstrated that the human MMR complex interacts with
S6-thioG · T mismatches (but not with S6-thioG
· C) in DNA (Branch et al.,
1993
; Krynetski et al.,
2001
) and with S6-methylthioG · T mismatch pairs
formed after nonenzymatic methylation of thioguanine in DNA
(Swann et al., 1996
).
The current studies were undertaken to evaluate the extent of heterogeneity in MSH2 protein expression in pediatric ALL cells and to assess the influence of MSH2 deficiency on thiopurine hematopoietic toxicity in an in vivo mouse model.
| Materials and Methods |
|---|
|
|
|---|
In Vivo Model. Mice in which the Msh2 gene had been
disrupted by homologous recombination were generously provided by Dr. Tak Mak
(Amgen Institute, Toronto, ON, Canada)
(Reitmair et al., 1995
).
Heterozygous (Msh2+/-) mice with a mixed C57BL/6J
and 129/Ola genetic background were bred, resulting in a Mendelian ratio of
viable wild-type (Msh2+/+), heterozygous
(Msh2+/-), and knockout
(Msh2-/-) mice. These mice were genotyped by a
previously described polymerase chain reaction technique
(Reitmair et al., 1996
), and
the level of Msh2 protein expression was determined by Western blot analysis
of bone marrow, liver, kidney, and spleen, using an MSH2 antibody (Ab-2)
(Oncogene Research Products, San Diego, CA). Mice aged 6 to 14 weeks were used
in all studies.
In Vitro Model. Primary cultures of Msh2+/+ and Msh2-/- murine embryonic fibroblasts (MEFs) were produced from embryos of wild-type (Msh2+/+) and knockout (Msh2-/-) mice, collected between 12 and 14 days of gestation (Charles River Laboratories, Wilmington, MA). The washed cells were resuspended in growth media containing 1x Dulbecco's modified Eagle's medium (Cambrex Bio Science Walkersville, Inc., Walkersville, MD), 10 to 20% fetal bovine serum (Hyclone Laboratories, Logan, UT), 4 mM L-glutamate (Cambrex Bio Science Walkersville), and 1x nonessential amino acids (Irvine Scientific, Santa Ana, CA) and incubated at 37°C in 5% CO2 in humidified air.
Western Blot Analysis of MSH2 Protein
Patient Samples. Human bone marrow cells (1 x 106)
were lysed in 250 µl of triple-detergent lysis buffer
(Sambrook et al., 1989
),
incubated on ice for 10 min, and then sheared by aspirating through a syringe
with a 25-gauge needle. The lysate was centrifuged at +4°C for 10 min, and
then concentrated in an Ultrafree concentration cartridge 10K (Millipore
Corporation, Bedford, MA). All lysates were analyzed by 12% SDS-polyacrylamide
gel electrophoresis with Laemmli buffer system (Bio-Rad, Hercules, CA).
Separated proteins were electroblotted onto Hybond-P membranes in a Mini
Trans-Blot electrotransfer cell (Bio-Rad). The membrane was then incubated
with a monoclonal anti-hMSH2 antibody (Ab-2; Oncogene Science, Cambridge, MA)
or with anti-GAPDH monoclonal antibody (Chemicon International, Temecula, CA),
both at 1:500 dilution for 1 h at room temperature, and developed using
secondary goat anti-mouse horseradish peroxidase-conjugated antibody at 1:5000
dilution (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and the ECL Plus
protein detection system with a detection limit of about 20 ng of protein/band
(Amersham Biosciences Inc., Piscataway, NJ). Lysates from 697 human ALL cells
[German Collection of Microorganisms and Cell Cultures (DSMZ), Braunschweig,
Germany] were used for quality control in each membrane. Western blot of MSH2
protein in 697 human ALL cells demonstrated a linear increase of the signal
corresponding to the amount of MSH2 (data not shown). Intensity of the band
corresponding to MSH2 protein was normalized versus the GAPDH signal. Bands
were visualized and quantified by PhosphorImager with the ImageQuaNT Software
system (Amersham Biosciences Inc.), using blue fluorescence/chemifluorescence
at 488 nm excitation.
Murine Tissues. Mouse tissues (
200 mg of liver, spleen, or
kidney) were homogenized using a Polytron homogenizer (Brinkmann Instruments,
Westbury, NY) at 4°C for 0.5 min at 5000 rpm in 5 volumes of ice-cold
buffer, containing 50 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 0.5 mM EGTA, 2 mM
dithiothreitol, 7 mM glutathione, 10% (v/v) glycerol. Complete protease
inhibitor (1 tablet per 50 ml; Roche Diagnostics, Mannheim, Germany) and 0.2
mM phenylmethylsulfonyl fluoride were added. The lysate was centrifuged for 20
min at 10,000g (4°C); supernatant was transferred to a fresh tube
and further centrifuged for 1 h at 100,000g at 4°C. Then, 20
µg of total protein was loaded onto the gel and analyzed by Western blot
analysis using polyclonal anti-hMSH2 antibody (Santa Cruz Biotechnology,
Inc.).
Cytotoxicity Studies
In Vivo Murine Model. Msh2+/+,
Msh2+/-, and Msh2-/-
mice were stratified according to age and gender, and randomized to receive
i.p. injections of MP, 2.5 to 150 mg/kg/day (Sigma-Aldrich, St. Louis, MO) or
0.9% NaCl (American Pharmaceutical Partners Inc., Los Angeles, CA) up to 21
days. The solution of MP (2.64 mg/ml, pH 8.0) was prepared by dissolving MP in
1 N NaOH and then adjusting with 2 M Na2HPO4 to pH 7.8
to 8.0. This method of preparation was utilized for all subsequent experiments
including the preparation of MP-free 0.9% NaCl. The i.p. route of
administration was selected to minimize variability in MP systemic exposure.
Complete blood count was obtained before and after MP treatment. Complete
blood count was performed with the Hemavet 3700 (CDC Technologies Inc.,
Oxford, CT) using 100 µl of blood in EDTA obtained by orbital bleed. Mice
were euthanized on day 15, approximately 12 to 16 h post-MP, according to a
protocol approved by the Institutional Animal Care and Use Committee.
In Vitro Model. Cytotoxic effects of MP were evaluated using the
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium assay, after incubation
of Msh2+/+ and
Msh2-/- primary MEFs with MP (0.001100
µM) for 3 to 6 days (Pieters et al.,
1990
). The 96-well plates were read by a microplate spectrometer
(Bio-Rad). The IC50 values were obtained by fitting a sigmoid
Emax model to the cell viability (percentage) versus drug
concentration (micromolar) data, determined in triplicate.
Hypoxanthine Guanine Phosphoribosyl Transferase (HPRT) and Thiopurine
Methyltransferase (TPMT) Activity
HPRT activity in WBC lysates was determined by formation of
[14C]inosine monophosphate from [14C]hypoxanthine, as
previously reported (Krynetskaia et al.,
1999
). TPMT activities in WBC and RBC lysates were determined by
the nonchelated radiochemical assay
(Weinshilboum et al.,
1978
).
DNA Modification
Mice. Msh2+/+ and
Msh2-/- mice were injected i.p. with a single
dose of [14C]MP solution (11.4 mg/kg, 80 µCi; Moravek
Biochemicals, Brea, CA) that was prepared as described above. Whole blood was
collected and bone marrow was harvested from the femurs and sternum after 24,
72, or 168 h. DNA was extracted with the QIAGEN Blood and Cell Culture DNA
Midi Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions.
DNA (10 µg) was used for analysis. 14C incorporation into DNA
was determined in duplicate using a Beckman LS 6500 Scintillation Counter
(Beckman Coulter Inc., Fullerton, CA).
MEFs. Genomic DNA was isolated from 2 x 107 primary
MEFs (Msh2+/+ and
Msh2-/-) after 24- to 120-h incubation of cells
with 10 µM MP, using the QIAGEN Blood and Cell Culture DNA Midi Kit, per
the manufacturer's instructions. DNA (10 µg) was used for analysis. The
level of 2'-deoxy-6-thioguanosine (dGS) incorporation into
DNA after MP treatment was determined in triplicate by high-performance liquid
chromatography analysis, as previously described in detail
(Krynetskaia et al.,
1999
).
DNA-Protein Interaction by Electromobility Shift Assay (EMSA)
Nuclear extracts were prepared from the primary MEF cells (2.5 x
108) as previously described
(Dignam et al., 1983
). Protein
concentrations of nuclear extracts were determined by the Bradford dye-binding
procedure, using the Bio-Rad Protein assay (Bio-Rad). Aliquots (25 µl) of
nuclear protein extracts were stored at -70°C. Nuclear extracts from HeLa
cells were used as positive controls (Promega, Madison, WI). The
oligodeoxyribonucleotides d(ACTCTTGCCTTTAAGGAAAGTATCTAAATGCTTC), the
complementary strands d(GAAGCATTTAGATACTTTCCTTAAAGGCAAGAGT) to form
GC-duplex, and d(GAAGCATTTAGATACTTTTCTTAAAGGCAAGAGT) to form GT-duplex
were synthesized using standard protocols with an automatic synthesizer (380B,
Applied Biosystems, Foster City, CA) in the Hartwell Center of St. Jude
Children's Research Hospital. Modified strand
d(ACTCTTGCCTTTAAGGSAAAGTATCTAAATGCTTC) to form
GST-duplex, containing one thioguanosine insert (dGS),
was synthesized by standard phosphoramidite chemical methods with S6-DNP-dG-CE
phosphoramidite (Krynetskaia et al.,
1999
). The 5'-ends of the single-stranded
oligodeoxyribonucleotides were labeled using [32P]ATP and the RTS
T4 Kinase Labeling System (Invitrogen, Carlsbad, CA). Oligodeoxyribonucleotide
duplexes containing GC-, GT- and GST-pairs were prepared by
annealing complementary single strands and template strand. DNA duplexes were
then purified by nondenaturing gel electrophoresis on a 12% polyacrylamide gel
at 4°C, as previously described
(Krynetski et al., 2001
) or by
fast protein liquid chromatography using a Superdex 75 column (Amersham
Biosciences Inc.). DNA-protein binding assays (EMSA) were performed as
described (Griffin et al.,
1994
) using 10 to 100 nM 32P-labeled DNA duplex,
5x "cold" GC-duplex, and 10 to 50 µg of total
protein.
Modeling, Statistics, and Parameter Estimation. Differences among
genotypes regarding percentage change in hematopoietic cell numbers were
determined by Kruskal-Wallis analysis of variance. Differences in cumulative
doses in Msh2-/- mice were determined by the
Mann-Whitney U test. The survival curves were determined by
Kaplan-Meier estimation. Differences in survival between
Msh2+/+ and Msh2-/-
mice were determined by the Cox proportional hazard regression model.
Incorporation of dGS into DNA was modeled using the sigmoid
Emax model. Model parameter estimates including the
IC50 were determined by the maximum likelihood method, using the
Adapt II software. (D'Argenio and
Schumitzky, 1997
) The t test was used to determine
significant differences in the IC50 between
Msh2+/+ and Msh2-/-
mice.
| Results |
|---|
|
|
|---|
|
|
The Msh2 phenotype in mice was confirmed by Western analysis of several murine tissues, including bone marrow, liver, spleen, and kidney (Fig. 2). Msh2 was expressed in all analyzed tissues of Msh2+/+ mice (see relative Msh2 protein level normalized per GAPDH, Fig. 2B), whereas no Msh2 protein was detected in any tissues from Msh2-/- mice (Fig. 2).
|
In Vivo Thiopurine Cytotoxicity. MP hematopoietic toxicity was
assessed in the Msh2+/+,
Msh2+/-, and Msh2-/-
mice with two treatment protocols: 2.5 to 20 mg/kg/day (i.p.) for 21 days and
30 to 150 mg/kg/day (i.p.) for 14 days
(Hara et al., 1989
).
Administration of 2.5 to 20 mg/kg/day of MP (i.p.) for 21 days caused
negligible changes in leukocyte and erythrocyte counts (data not shown).
Therefore, 30 mg/kg/day of MP (i.p.) for 14 days was further utilized for
assessing hematological toxicity, because it did not result in
treatment-related deaths in either group and consistently decreased WBC count
in Msh2+/+ and
Msh2+/- mice by more than 50%. Cytotoxicity data
were obtained from three independent studies using 14 mice in each group
(Msh2+/+, Msh2+/-,
and Msh2-/- mice) after treatment with MP (30
mg/kg/day) and 12 to 13 mice in each control group (treated with 0.9% NaCl).
Msh2+/+ and Msh2+/-
mice exhibited a significant drop in total leukocytes [median (quartiles):
-53.6% (-64.5%, -41.0%) and -49.6% (-60.0%, -39.7%)] following 14 days of MP
(30 mg/kg/day i.p.), compared with the Msh2-/-
mice [median (quartiles): +16.3% (-25.9%, 48.6%)]
(Fig. 3A, p <
0.002). It is noteworthy that similar changes were found in neutrophils
[median: -72.5% and -68.7% in Msh2+/+ and
Msh2+/- compared with +18.8% in
Msh2-/- mice, p = 0.0025] and in
lymphocytes [median: -50.8% and -50.53 in Msh2+/+
and Msh2+/- compared with -1.4% in
Msh2-/- mice, p = 0.016], but no
significant differences were found in monocytes [median: -8.7% and +45.2% in
Msh2+/+ and Msh2+/-
compared with +37.9% in Msh2-/- mice, p
= 0.15]. Likewise, Msh2+/+ and
Msh2+/- mice demonstrated a significantly greater
decrease in erythrocyte count [median (quartiles): -54.0% (-62.2%, -44.7%) and
-41.1% (-48.1%, -36.8%)] following MP treatment compared with -15.6% (-22.3%,
-10.6%) [median (quartiles)] in Msh2-/- mice
(Fig. 3B, p <
0.0001).
|
As depicted in Fig. 4, MP doses of more than 50 mg/kg/day (50, 100, and 150 mg/kg/day with three mice in each group and three in each control group treated with 0.9% NaCl) for 14 days resulted in treatment-related deaths. However, Msh2-/- mice had a survival advantage compared with Msh2+/+ mice (Fig. 4A, p = 0.02). In addition, Msh2-/- mice tolerated significantly higher cumulative doses of MP after treatment with 50 mg/kg/day and 150 mg/kg/day (Fig. 4B, p < 0.05).
|
In Vitro Thiopurine Cytotoxicity. After 4 days of MP treatment (0.001100 µM), only Msh2+/+ MEFs revealed cytotoxicity (IC50 = 31.4 ± 15.1 µM). After 5 to 6 days of MP treatment, Msh2-/- fibroblasts were 3- to 4-fold less sensitive, compared with MEFs from Msh2+/+ mice (IC50-day5 = 18.4 ± 6.8 versus 6.8 ± 1.9 and IC50-day6 = 11.9 ± 1.3 versus 3.8 ± 0.1, p = 0.0001). Cytotoxicity for MEFs with different Msh2 genotypes after 6 days of MP treatment are shown in Fig. 5.
|
ThioG Incorporation in DNA and Nuclear Protein-DNA Interactions. Figure 6 shows the level of 6-thiodeoxyriboguanosine in genomic DNA after [14C]MP administration in a single dose (11.4 mg/kg) to mice with each Msh2 genotype, and in MEFs after 10 µM MP treatment. No statistically significant differences in GS-insert accumulations into genomic DNA were found between Msh2+/+ and Msh2-/- mice after treatment for 24, 72, or 168 h (p = 0.83, 0.08, and 0.28, respectively). Also, there were no significant differences in the activity of thiopurine-activating (i.e., HPRT, p = 0.6) or -inactivating (i.e., TPMT) enzymes in leukocytes (p = 0.17) and erythrocytes (p = 0.8) from Msh2+/+ and Msh2-/- mice (Table 2). HPRT activities are similar for MEFs from Msh2+/+ and Msh2-/- mice (p = 0.6). Note that TPMT activity was higher in MEFs from Msh2+/+ mice versus MEFs from Msh2-/- mice (26.2 ± 5.3 versus 6.1 ± 3.9 nmol/h/109 cells; Table 2; p = 0.043).
|
|
Western blot analysis of Msh2 protein in nuclear extracts from
Msh2-proficient and -deficient MEFs is shown in
Fig. 8A. Using
[32P]GT-duplex (positive control) and [32P]GC-duplex
(negative control), we demonstrated that only nuclear proteins from
Msh2+/+ MEFs interact with
[32P]GT-duplex (Fig.
7), corroborating previously published data
(Dewind et al., 1995
).
Likewise, a DNA-protein complex containing Msh2 protein was formed only with
Msh2+/+ nuclear extracts and
[32P]GST-duplex (Fig.
8B, lane 2, band a). This complex was attenuated by 2.5 mM ATP
(Fig. 8B, compare lanes 1 and
2), had mobility similar to that of the GT-DNA-protein complex from human
nuclear extract (Fig. 8B, band
a, lane 6), and contained Msh2 protein as documented by Western analysis of
the EMSA gel using anti-MSH2 antibody (Fig.
8C, lanes 1 and 2). Titration of the GST-DNA duplex
with increasing amounts of total nuclear protein from
Msh2+/+ MEFs resulted in an increase of
Msh2-containing DNA-protein complex formation
(Fig. 8E). In contrast, no such
GST-DNA-protein complex was formed in the
Msh2-/- MEFs
(Fig. 8B, lanes 3 and 4).
However, the increased formation of another DNA-protein complex was observed
with Msh2-/- nuclear extracts
(Fig. 8B, band b, lanes
12 versus 34; and Fig.
8D, open bars). The intensity of bands (percentage of total
radioactivity) corresponding to complexes a and b is shown in
Fig. 8D.
|
|
| Discussion |
|---|
|
|
|---|
In the current study, we initially established that MSH2 protein levels
exhibit substantial interindividual differences in primary leukemia cells from
children with newly diagnosed ALL, with the absence of detectable MSH2 protein
in 17% of patients and more than a 10-fold range in MSH2 in ALL blasts with
detectable MSH2 protein (Fig.
1). These findings are consistent with earlier studies in adults
and children with ALL and acute myelogenous leukemia
(Matheson and Hall, 1999
;
Zhu et al., 1999
) and suggest
that therapeutic effects could differ if MSH2 protein is an important
determinant of cytotoxicity with genotoxic chemotherapy. There were no
statistically significant differences in patient demographics, ALL lineage, or
molecular subtypes, or MSH2 cDNA sequences between patients who had detectable
versus undetectable MSH2 protein in ALL blasts
(Table 1), although the
relatively small number of patients limits the power of these comparisons.
In vitro experiments have indicated that cells with inactive components of
the mismatch repair system (i.e., MSH2, MSH6, or MLH1), have greater
resistance to thiopurines than do their MMR-proficient counterparts
(Berry et al., 2000
). To
determine whether MSH2 was essential for hematopoietic toxicity in vivo, we
performed cytotoxicity studies using an Msh2 knockout mouse model and
mercaptopurine treatment. Thiopurines have been used for the treatment of
human leukemia for more than 50 years
(Elion, 1989
), yet the
molecular events underlying their therapeutic effects remain obscure. Both MP
and TG are inactive prodrugs that require intracellular anabolism to
nucleoside triphosphates, with subsequent incorporation of fraudulent
nucleoside (dGS) into DNA, to induce cytotoxicity
(Pennington and Bronk, 1995
;
McLeod et al., 2000
;
Chen et al., 2001
).
dGS-inserts in DNA-template result in an increased frequency of
GST-mismatch pair formation compared with nonmodified DNA-template,
although in vitro replication showed that formation of GSC-pairs
was 300-fold preferential compared with GST-pairs
(Ling et al., 1992
;
Rappaport, 1993
;
Krynetski et al., 2001
). We
recently showed that the presence of GSC-pairs in DNA results in
local alterations of DNA structure
(Somerville et al., 2003
)
distinct from DNA structural changes caused by GT-mismatches
(Roongta et al., 1990
).
Nonenzymatic alkylation of the thio group in GS-DNA was
hypothesized to convert thioguanosine to a highly toxic
S-methylthioguanosine moiety
(Swann et al., 1996
;
Waters and Swann, 1997
),
increasing the formation of GSmeT mismatch pairs during DNA
replication across S-methyl deoxythioguanosine template
(Spratt and Levy, 1997
). In
both scenarios, the MSH2-MSH6 complex plays an important role in detecting the
mismatched base pair formed at the site of thioguanosine incorporation.
To study the role of MSH2 protein in determining thiopurine hematopoietic toxicity, we compared treatment-induced changes in leukocytes (i.e., neutrophils, lymphocytes, and monocytes) and erythrocytes in Msh2-deficient and -proficient mice. We found significantly greater reduction of total WBCs (Fig. 3A) including neutrophils and lymphocytes, and RBCs in MMR-proficient mice compared with Msh2-/- mice following MP treatment (30 mg/kg/day; Fig. 3B), but no changes were found with 2.5 to 20 mg/kg/day of MP for 21 days. These results indicate that MMR proficiency is important for cytotoxicity in hematopoietic cells at 30 mg/kg/day of MP. Likewise, in vitro experiments revealed a 3-fold difference in MP cytotoxicity in Msh2+/+ versus Msh2-/- murine embryo fibroblast cells (Fig. 5, p = 0.0001). No differences in nutrition or general well being were observed between the untreated or low-dose (2.5 to 30 mg/kg/day) MP-treated MMR-deficient and MMR-proficient mice. Furthermore, treatment with higher MP doses (50150 mg/kg/day i.p.) resulted in mortality of mice with each Msh2 genotype (Fig. 4). However, MMR-deficient mice survived longer while receiving higher MP dosages (Fig. 4A, p = 0.02), and they tolerated higher cumulative doses of MP compared with MMR-proficient mice (Fig. 4B, p < 0.05).
Because the MMR system interacts with mismatches generated due to
thioguanosine incorporation into DNA, we compared the level of
GS-inserts in DNA of mice with both Msh2 genotypes.
Fig.6 demonstrates accumulation
of similar levels of GS-inserts in genomic DNA after MP treatment
in mice and in MEFs with different genotypes, yet
Msh2+/+ mice and
Msh2+/+ MEFs had greater cytotoxicity compared
with Msh2-/- mice and
Msh2-/- MEFs after MP treatment (Figs.
3 and
5). It has been hypothesized
that futile DNA repair of GST or GSmeT mismatches
eventually triggers apoptosis via mechanisms that remain unknown
(Fink et al., 1998
;
Berry et al., 2000
). Our in
vivo findings are consistent with the hypothesis that the MMR system is unable
to remove GS-inserts from DNA in mice treated with MP.
To confirm that GST-DNA is recognized by MMR, we performed
DNA-protein interaction studies using EMSA. These experiments demonstrated
that nuclear proteins extracted from Msh2+/+
MEFs, but not Msh2-/-, recognized GT-as well as
GST-mismatch pairs of DNA, forming DNA-protein complexes containing
Msh2 (Figs. 7 and
8) No similar DNA-protein
complexes were found in experiments with nuclear extracts from
Msh2-/- MEF cells. However, another DNA-protein
complex formed between GST-containing DNA duplex and nuclear
proteins from Msh2-/- MEFs
(Fig. 8B, lanes 3 and 4),
indicating the existence of alternative proteins recognizing
thioguanosine-modified DNA in Msh2-/- mice. An
alternative GS-DNA-protein complex, distinct from the known
DNA-mismatch repair protein complex, has recently been found in human MSH2-
and MSH6-negative ALL cells (Krynetski et
al., 2001
; Krynetski et al.,
2003
).
In summary, the current studies have documented that a subgroup of patients
(17%) have undetectable MSH2 protein in their ALL cells and revealed marked
heterogeneity of MSH2 protein in leukemia cells from the remainder of children
with newly diagnosed acute lymphoblastic leukemia. In vivo experiments with
Msh2+/+ and Msh2-/-
mice revealed a significant effect of MSH2 protein on the cytotoxicity of
genotoxic thiopurine agents. Our in vivo findings indicate that MMR cannot
repair newly synthesized DNA, consistent with the hypothesis that futile
mismatch repair triggers apoptosis (Berry
et al., 2000
). The difference in thiopurine cytotoxicity and
delayed mortality in Msh2-deficient mice indicates the in vivo importance of
Msh2 in thiopurine hematopoietic toxicity and provides the first in vivo
evidence that MMR deficiency attenuates, but does not abolish, the
cytotoxicity of thiopurines.
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: ALL, acute lymphoblastic leukemia; MMR, mismatch repair; MSH2, MutS homolog 2; MP, mercaptopurine; TG, 6-thioguanine; dGS, deoxythioguanosine; MEF, murine embryonic fibroblast; HPRT, hypoxanthine guanine phosphoribosyl transferase; TPMT, thiopurine methyltransferase; WBC, white blood cell; RBC, red blood cell; EMSA, electromobility shift assay; RU, relative unit(s).
Address correspondence to: Dr. William E. Evans, St. Jude Children's Research Hospital, 332 N. Lauderdale, Memphis, TN 38105. E-mail: william.evans{at}stjude.org
| References |
|---|
|
|
|---|
Blanco JG, Dervieux T, Edick MJ, Mehta PK, Rubnitz JE, Shurtleff S,
Raimondi SC, Behm FG, Pui CH, and Relling MV (2001) Molecular
emergence of acute myeloid leukemia during treatment for acute lymphoblastic
leukemia. Proc Natl Acad Sci USA
98:
1033810343.
Branch P, Aquilina G, Bignami M, and Karran P (1993) Defective mismatch binding and a mutator phenotype in cells tolerant to DNA damage. Nature (Lond) 362: 652654.[CrossRef][Medline]
Chen ZS, Lee K, and Kruh GD (2001) Transport of cyclic
nucleotides and estradiol 17-beta-D-glucuronide by multidrug resistance
protein 4. Resistance to 6-mercaptopurine and 6-thioguanine. J Biol
Chem 276:
3374733754.
Chessells JM (1998) Relapsed lymphoblastic leukemia in children: a continuing challenge. Br J Haematol 102: 423438.[CrossRef][Medline]
D'Argenio DZ and Schumitzky A (1997) ADAPT II User's Guide: Pharmacokinetic/ Pharmacodynamic Systems Analysis Software. Biomedical Simulations Resource, Los Angeles.
Das-Gupta EP, Seedhouse CH, and Russell NH (2000) DNA repair mechanisms and acute myeloblastic leukemia. Hematol Oncol 18: 99110.[CrossRef][Medline]
Dewind N, Dekker M, Berns A, Radman M, and Riele HT (1995) Inactivation of the mouse Msh2 gene results in mismatch repair deficiency, methylation tolerance, hyperrecombination and predisposition to cancer. Cell 82: 321330.[CrossRef][Medline]
Dignam JD, Lebovitz RM, and Roeder RG (1983) Accurate
transcription initiation by RNA polymerase II in a soluble extract from
isolated mammalian nuclei. Nucleic Acids Res
11:
14751489.
Durant ST, Morris MM, Illand M, Mckay HJ, McCormick C, Hirst GL, Borts RH, and Brown R (1999) Dependence on RAD52 and RAD1 for anticancer drug resistance mediated by inactivation of mismatch repair genes. Curr Biol 9: 5154.[CrossRef][Medline]
Elion GB (1989) The purine path to chemotherapy.
Science (Wash DC) 244:
4147.
Fink D, Aebi S, and Howell SB (1998) The role of DNA mismatch repair in drug resistance. Clin Cancer Res 4: 16.[Abstract]
Flores-Rozas H and Kolodner RD (2000) Links between replication, recombination and genome instability in eukaryotes. Trends Biochem Sci 25: 196200.[CrossRef][Medline]
Griffin S, Branch P, Xu YZ, and Karran P (1994) DNA mismatch binding and incision at modified guanine bases by extracts of mammalian cells: implications for tolerance to DNA methylation damage. Biochemistry 33: 47874793.[CrossRef][Medline]
Hara T, Makita T, Horiya N, Ozawa S, Ohba M, Naito J, and Shibuya T (1989) Micronucleus test with 6-mercaptopurine monohydrate administered intraperitoneally and orally. Mutat Res 223: 349352.[CrossRef][Medline]
Iwaniec LM, Kroll JJ, Roethel WM, and Maybaum J (1991) Selective inhibition of sequence-specific protein-DNA interactions by incorporation of 6-thioguanine: cleavage by restriction endonucleases. Mol Pharmacol 39: 299306.[Abstract]
Johnstone RW, Ruefli AA, and Lowe SW (2002) Apoptosis: a link between cancer genetics and chemotherapy. Cell 108: 153164.[CrossRef][Medline]
Karran P and Bignami M (1996) Drug-related killings: a case of mistaken identity. Chem Biol 3: 875879.[CrossRef][Medline]
Krynetskaia NF, Cai X, Nitiss JL, Krynetski EY, and Relling MV
(2000) Thioguanine substitution alters DNA cleavage mediated by
topoisomerase II. FASEB J
14:
23392344.
Krynetskaia NF, Krynetski EY, and Evans WE (1999)
Human RNaseH-mediated RNA cleavage from DNA-RNA duplexes is inhibited by
6-deoxyguanosine incorporation into DNA. Mol Pharmacol
56:
841848.
Krynetski EY, Krynetskaia NF, Bianchi ME, and Evans WE
(2003) A nuclear protein complex containing high mobility group
protein B1 and B2, heat shock cognate protein 70, ERp60 and
glyceraldehyde-3-phosphate dehydrogenase is involved in the cytotoxic response
to DNA modified by incorporation of anticancer nucleoside analogues.
Cancer Res 63:
100106.
Krynetski EY, Krynetskaia NF, Gallo AE, Murti KG, and Evans WE
(2001) A novel protein complex distinct from mismatch repair
binds thioguanylated DNA. Mol Pharmacol
59:
367374.
Krynetski EY, Schuetz JD, Galpin AJ, Pui C-H, Relling MV, and Evans
WE (1995) A single point mutation leading to loss of catalytic
activity in human thiopurine S-methyltransferase. Proc Natl Acad
Sci USA 92:
949953.
LePage GA (1963) Basic biochemical effects and mechanism of action of 6-thioguanine. Cancer Res 23: 12021206.
Ling YH, Chan JY, Beattie KL, and Nelson JA (1992) Consequences of 6-thioguanine incorporation into DNA on polymerase, ligase and endonuclease reactions. Mol Pharmacol 42: 802807.[Abstract]
Matheson EC and Hall AG (1999) Expression of DNA mismatch repair proteins in acute lymphoblastic leukaemia and normal bone marrow. Drug Resist Leukemia Lymphoma 457: 579583.
Maybaum J and Mandel HG (1983) Unilateral chromatid
damage: a new basis for 6-thioguanine cytotoxicity. Cancer
Res 43:
38523856.
McLeod HL, Krynetski EY, Relling MV, and Evans WE (2000) Genetic polymorphism of thiopurine methyltransferase and its clinical relevance for childhood acute lymphoblastic leukemia. Leukemia (Baltimore) 14: 567572.[CrossRef][Medline]
Olipitz W, Hopfinger G, Aguiar RC, Gunsilius E, Girschikofsky M, Bodner C, Hiden K, Linkesch W, Hoefler G, and Sill H (2002) Defective DNA-mismatch repair: a potential mediator of leukemogenic susceptibility in therapy-related myelodysplasia and leukemia. Genes Chromosomes Cancer 34: 243248.[CrossRef][Medline]
Pennington AM and Bronk JR (1995) The absorption of 6-mercaptopurine from 6-mercaptopurine riboside in rat small intestine: effect of phosphate. Cancer Chemother Pharmacol 36: 136142.[Medline]
Pieters R, Loonen AH, Huismans DR, Broekema GJ, Dirven MW,
Heyenbrok MW, Hahlen K, and Veerman AJ (1990) In vitro drug
sensitivity of cells from children with leukemia using the MTT assay with
improved culture conditions. Blood
76:
23272336.
Pui CH and Evans WE (1998) Acute lymphoblastic
leukemia. N Engl J Med
339:
605615.
Rappaport HP (1993) Replication of the base pair 6-thioguanine/5-methyl-2-pyrimidine with the large Klenow fragment of Escherichia coli DNA polymerase I. Biochemistry 32: 30473057.[CrossRef][Medline]
Reitmair AH, Redston M, Cai JC, Chuang TCY, Bjerknes M, Cheng H,
Hay K, Gallinger S, Bapat B, and Mak TW (1996) Spontaneous
intestinal carcinomas and skin neoplasms in Msh2-deficient mice.
Cancer Res 56:
38423849.
Reitmair AH, Schmits R, Ewel A, Bapat B, Redston M, Mitri A, Waterhouse P, Mittrucker HW, Wakeham A, Liu B, et al. (1995) Msh2 deficient mice are viable and susceptible to lymphoid tumors. Nat Genet 11: 6470.[CrossRef][Medline]
Roongta VA, Jones CR, and Gorenstein DG (1990) Effect of distortions in the deoxyribose phosphate backbone conformation of duplex oligodeoxyribonucleotide dodecamers containing GT, GG, GA, AC and GU base-pair mismatches on P-31 NMR-spectra. Biochemistry 29: 52455258.[CrossRef][Medline]
Sambrook J, Fritsch EF, and Maniatis T (1989) Detection and analysis of proteins expressed from cloned genes, in Molecular Cloning: A Laboratory Manual (Nolan C ed) pp 18.32, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
Somerville L, Krynetski EY, Krynetskaia NF, Beger RD, Zhang W,
Marhefka CA, Evans WE, and Kriwacki RW (2003) Structure and
dynamics of thioguanine-modified duplex DNA. J Biol
Chem 278:
10051011.
Spratt TE and Levy DE (1997) Structure of the hydrogen
bonding complex of O6-methylguanine with cytosine and thymine during DNA
replication. Nucleic Acids Res
25:
33543361.
Swann PF, Waters TR, Moulton DC, Xu YZ, Zheng Q, Edwards M, and Mace R (1996) Role of postreplicative DNA mismatch repair in the cytotoxic action of thioguanine. Science (Wash DC) 273: 11091111.[Abstract]
Wang Y, Cortez D, Yazdi P, Neff N, Elledge SJ, and Qin J
(2000) BASC, a super complex of BRCA1-associated proteins
involved in the recognition and repair of aberrant DNA structures.
Genes Dev 14:
927939.
Waters TR and Swann PF (1997) Cytotoxic mechanism of
6-thioguanine: HMutS
, the human mismatch binding heterodimer, binds to
DNA containing S6-methylthioguanine.
Biochemistry 36:
25012506.[CrossRef][Medline]
Weinshilboum RM, Raymond FA, and Pazmino PA (1978) Human erythrocyte thiopurine methyltransferase: radiochemical microassay and biochemical properties. Clin Chim Acta 85: 323333.[CrossRef][Medline]
Zhu YM, Das-Gupta EP, and Russell NH (1999)
Microsatellite instability and P53 mutations are associated with abnormal
expression of the MSH2 gene in adult acute leukemia.
Blood 94:
733740.
This article has been cited by other articles:
![]() |
P. Karran Thiopurines, DNA damage, DNA repair and therapy-related cancer Br. Med. Bull., February 2, 2007; (2007) ldl020v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. C. Davis, E. R. Lazarowski, J. M. Hickman-Davis, J. A. Fortenberry, F.-P. Chen, X. Zhao, E. Sorscher, L. M. Graves, W. M. Sullender, and S. Matalon Leflunomide Prevents Alveolar Fluid Clearance Inhibition by Respiratory Syncytial Virus Am. J. Respir. Crit. Care Med., March 15, 2006; 173(6): 673 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamane and T. J. Kinsella Casein Kinase 2 Regulates Both Apoptosis and the Cell Cycle Following DNA Damage Induced by 6-Thioguanine Clin. Cancer Res., March 15, 2005; 11(6): 2355 - 2363. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Brown, E. Y. Krynetski, N. F. Krynetskaia, D. Grieger, S. T. Mukatira, K. G. Murti, C. A. Slaughter, H.-W. Park, and W. E. Evans A Novel CRM1-mediated Nuclear Export Signal Governs Nuclear Accumulation of Glyceraldehyde-3-phosphate Dehydrogenase following Genotoxic Stress J. Biol. Chem., February 13, 2004; 279(7): 5984 - 5992. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||