MolPharm

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


0026-895X/03/6402-456-465$20.00
Mol Pharmacol 64:456-465, 2003

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krynetskaia, N. F.
Right arrow Articles by Evans, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krynetskaia, N. F.
Right arrow Articles by Evans, W. E.

Msh2 Deficiency Attenuates But Does Not Abolish Thiopurine Hematopoietic Toxicity in Msh2-/- Mice

Natalia F. Krynetskaia, Timothy L. Brenner, Eugene Y. Krynetski, Weinan Du, John C. Panetta, Pui Ching-Hon, and William E. Evans

Departments of Pharmaceutical Sciences (N.F.K., T.L.B., E.Y.K., W.D., J.C.P., W.E.E.) and Hematology-Oncology (C.-H.P.), St. Jude Children's Research Hospital, Memphis, Tennessee; and University of Tennessee, Memphis, Tennessee (N.F.K., E.Y.K., C.-H.P., W.E.E.)

Received January 21, 2003; accepted May 9, 2003


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The amount of MSH2 protein, a major component of the mismatch repair system, was found to differ >10-fold in leukemia cells from children with newly diagnosed acute lymphoblastic leukemia, with a subgroup of patients (17%) having undetectable MSH2 protein. We therefore used a murine Msh2 knockout model to elucidate the in vivo importance of MSH2 protein expression in determining thiopurine hematopoietic cytotoxicity. After mercaptopurine (MP) treatment (30 mg/kg/day for 14 days), there was a significantly greater decrease in circulating leukocytes in Msh2+/+ and Msh2+/- mice when compared with Msh2-/- mice (p < 0.002). Likewise, the decrease in erythrocyte counts was more prominent in mice with at least one functional Msh2 allele. MP doses of more than 50 mg/kg/day for 14 days resulted in treatment-related deaths, but Msh2-/- mice had a significant survival advantage (p = 0.02). Murine embryonic fibroblasts (MEFs) from Msh2+/+ mice also exhibited increased sensitivity to MP when compared with MEFs from Msh2-/- mice (IC50, 3.8 ± 0.1 µM versus 11.9 ± 1.3 µM, p < 0.001). After MP treatment, deoxythioguanosine incorporation into DNA was similar in mice and MEFs with each of the Msh2 genotypes. Electromobility shift assay experiments identified an Msh2-containing GT- or GST-DNA-nuclear protein complex in Msh2+/+ but not Msh2-/- MEFs. Together, these findings establish that hematopoietic toxicity in vivo after treatment with mercaptopurine is attenuated but not abolished by MSH2 deficiency.


The therapeutic outcome for children with acute lymphoblastic leukemia (ALL) has improved dramatically over the past two decades (Pui and Evans, 1998Go). However, the emergence of drug-resistant leukemia cells contributes to treatment failure in approximately 20 to 25% of patients with ALL (Chessells, 1998Go; Pui and Evans, 1998Go). Drug resistance can emerge from altered metabolism or cellular accumulation of antileukemic agents, from altered drug targets, or from changes in cellular responses downstream of drug-target interactions (Johnstone et al., 2002Go). For example, abnormalities of DNA repair proteins have been linked to both the pathogenesis of several human malignancies and the therapeutic effects of medications (Das-Gupta et al., 2000Go; Flores-Rozas and Kolodner, 2000Go; Olipitz et al., 2002Go). The postreplicative mismatch repair (MMR) system has been shown to modulate in vitro cytotoxicity of several anticancer chemotherapeutic agents, including busulfan, cisplatin, temozolomide, doxorubicin, etoposide, thiopurines, and N-methyl-N'-nitro-N-nitrosoguanidine (Fink et al., 1998Go), each targeting DNA. These findings suggest that the MMR system plays an important role in recognizing DNA damage and triggering cell death under genotoxic stress. Characterized components of MMR include hMSH2 and hMSH6, which are associated with a protein complex interacting with mismatched DNA base pairs (Wang et al., 2000Go), and inactivation of MSH2 attenuates mismatch repair activity (Dewind et al., 1995Go).

Thiopurines (e.g., 6-mercaptopurine, MP, and 6-thioguanine, TG) are widely used medications for the treatment of pediatric ALL, representing an important component of essentially all modern treatment protocols (Elion, 1989Go; Pui and Evans, 1998Go). The incorporation of 6-thiodeoxyguanosine (dGS) into DNA after MP or TG treatment results in DNA damage and is considered the major mechanism of thiopurine cytotoxicity (LePage, 1963Go; Maybaum and Mandel, 1983Go; Krynetskaia et al., 1999Go). It has been shown in vitro that GS-inserts in DNA change DNA-protein interactions with restriction endonucleases, RNaseH and topoisomerase II (Iwaniec et al., 1991Go; Krynetskaia et al., 1999Go; Krynetskaia et al., 2000Go). The mechanisms of cellular response to DNA damaged by thiopurine incorporation are not well defined but presumably involve cellular systems such as DNA repair, transcription control, cell cycle arrest, and/or apoptosis (Karran and Bignami, 1996Go; Das-Gupta et al., 2000Go). The putative mechanism by which the MMR system promotes thiopurine cytotoxicity involves the initiation of apoptosis after futile efforts to repair DNA containing thioguanine mismatch pairs (Karran and Bignami, 1996Go; Durant et al., 1999Go). In vitro experiments have demonstrated that the human MMR complex interacts with S6-thioG · T mismatches (but not with S6-thioG · C) in DNA (Branch et al., 1993Go; Krynetski et al., 2001Go) and with S6-methylthioG · T mismatch pairs formed after nonenzymatic methylation of thioguanine in DNA (Swann et al., 1996Go).

The current studies were undertaken to evaluate the extent of heterogeneity in MSH2 protein expression in pediatric ALL cells and to assess the influence of MSH2 deficiency on thiopurine hematopoietic toxicity in an in vivo mouse model.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Patient Samples
Bone marrow samples were obtained from 63 patients with newly diagnosed ALL who were enrolled, after informed consent, on an Institutional Review Board-approved protocol at St. Jude Children's Research Hospital. Lymphoblasts from bone marrow aspirates were isolated using a Ficoll-Hypaque density gradient, and the final cell yield was determined by hemocytometer. The MSH2 protein level was estimated by Western blot analysis of total cellular lysates, as described below. MSH2 cDNA was prepared from ALL cells, cloned and sequenced as previously described (Krynetski et al., 1995Go).

In Vivo Model. Mice in which the Msh2 gene had been disrupted by homologous recombination were generously provided by Dr. Tak Mak (Amgen Institute, Toronto, ON, Canada) (Reitmair et al., 1995Go). Heterozygous (Msh2+/-) mice with a mixed C57BL/6J and 129/Ola genetic background were bred, resulting in a Mendelian ratio of viable wild-type (Msh2+/+), heterozygous (Msh2+/-), and knockout (Msh2-/-) mice. These mice were genotyped by a previously described polymerase chain reaction technique (Reitmair et al., 1996Go), and the level of Msh2 protein expression was determined by Western blot analysis of bone marrow, liver, kidney, and spleen, using an MSH2 antibody (Ab-2) (Oncogene Research Products, San Diego, CA). Mice aged 6 to 14 weeks were used in all studies.

In Vitro Model. Primary cultures of Msh2+/+ and Msh2-/- murine embryonic fibroblasts (MEFs) were produced from embryos of wild-type (Msh2+/+) and knockout (Msh2-/-) mice, collected between 12 and 14 days of gestation (Charles River Laboratories, Wilmington, MA). The washed cells were resuspended in growth media containing 1x Dulbecco's modified Eagle's medium (Cambrex Bio Science Walkersville, Inc., Walkersville, MD), 10 to 20% fetal bovine serum (Hyclone Laboratories, Logan, UT), 4 mM L-glutamate (Cambrex Bio Science Walkersville), and 1x nonessential amino acids (Irvine Scientific, Santa Ana, CA) and incubated at 37°C in 5% CO2 in humidified air.

Western Blot Analysis of MSH2 Protein
Patient Samples. Human bone marrow cells (1 x 106) were lysed in 250 µl of triple-detergent lysis buffer (Sambrook et al., 1989Go), incubated on ice for 10 min, and then sheared by aspirating through a syringe with a 25-gauge needle. The lysate was centrifuged at +4°C for 10 min, and then concentrated in an Ultrafree concentration cartridge 10K (Millipore Corporation, Bedford, MA). All lysates were analyzed by 12% SDS-polyacrylamide gel electrophoresis with Laemmli buffer system (Bio-Rad, Hercules, CA). Separated proteins were electroblotted onto Hybond-P membranes in a Mini Trans-Blot electrotransfer cell (Bio-Rad). The membrane was then incubated with a monoclonal anti-hMSH2 antibody (Ab-2; Oncogene Science, Cambridge, MA) or with anti-GAPDH monoclonal antibody (Chemicon International, Temecula, CA), both at 1:500 dilution for 1 h at room temperature, and developed using secondary goat anti-mouse horseradish peroxidase-conjugated antibody at 1:5000 dilution (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and the ECL Plus protein detection system with a detection limit of about 20 ng of protein/band (Amersham Biosciences Inc., Piscataway, NJ). Lysates from 697 human ALL cells [German Collection of Microorganisms and Cell Cultures (DSMZ), Braunschweig, Germany] were used for quality control in each membrane. Western blot of MSH2 protein in 697 human ALL cells demonstrated a linear increase of the signal corresponding to the amount of MSH2 (data not shown). Intensity of the band corresponding to MSH2 protein was normalized versus the GAPDH signal. Bands were visualized and quantified by PhosphorImager with the ImageQuaNT Software system (Amersham Biosciences Inc.), using blue fluorescence/chemifluorescence at 488 nm excitation.

Murine Tissues. Mouse tissues (~200 mg of liver, spleen, or kidney) were homogenized using a Polytron homogenizer (Brinkmann Instruments, Westbury, NY) at 4°C for 0.5 min at 5000 rpm in 5 volumes of ice-cold buffer, containing 50 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 0.5 mM EGTA, 2 mM dithiothreitol, 7 mM glutathione, 10% (v/v) glycerol. Complete protease inhibitor (1 tablet per 50 ml; Roche Diagnostics, Mannheim, Germany) and 0.2 mM phenylmethylsulfonyl fluoride were added. The lysate was centrifuged for 20 min at 10,000g (4°C); supernatant was transferred to a fresh tube and further centrifuged for 1 h at 100,000g at 4°C. Then, 20 µg of total protein was loaded onto the gel and analyzed by Western blot analysis using polyclonal anti-hMSH2 antibody (Santa Cruz Biotechnology, Inc.).

Cytotoxicity Studies
In Vivo Murine Model. Msh2+/+, Msh2+/-, and Msh2-/- mice were stratified according to age and gender, and randomized to receive i.p. injections of MP, 2.5 to 150 mg/kg/day (Sigma-Aldrich, St. Louis, MO) or 0.9% NaCl (American Pharmaceutical Partners Inc., Los Angeles, CA) up to 21 days. The solution of MP (2.64 mg/ml, pH 8.0) was prepared by dissolving MP in 1 N NaOH and then adjusting with 2 M Na2HPO4 to pH 7.8 to 8.0. This method of preparation was utilized for all subsequent experiments including the preparation of MP-free 0.9% NaCl. The i.p. route of administration was selected to minimize variability in MP systemic exposure. Complete blood count was obtained before and after MP treatment. Complete blood count was performed with the Hemavet 3700 (CDC Technologies Inc., Oxford, CT) using 100 µl of blood in EDTA obtained by orbital bleed. Mice were euthanized on day 15, approximately 12 to 16 h post-MP, according to a protocol approved by the Institutional Animal Care and Use Committee.

In Vitro Model. Cytotoxic effects of MP were evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium assay, after incubation of Msh2+/+ and Msh2-/- primary MEFs with MP (0.001–100 µM) for 3 to 6 days (Pieters et al., 1990Go). The 96-well plates were read by a microplate spectrometer (Bio-Rad). The IC50 values were obtained by fitting a sigmoid Emax model to the cell viability (percentage) versus drug concentration (micromolar) data, determined in triplicate.

Hypoxanthine Guanine Phosphoribosyl Transferase (HPRT) and Thiopurine Methyltransferase (TPMT) Activity
HPRT activity in WBC lysates was determined by formation of [14C]inosine monophosphate from [14C]hypoxanthine, as previously reported (Krynetskaia et al., 1999Go). TPMT activities in WBC and RBC lysates were determined by the nonchelated radiochemical assay (Weinshilboum et al., 1978Go).

DNA Modification
Mice. Msh2+/+ and Msh2-/- mice were injected i.p. with a single dose of [14C]MP solution (11.4 mg/kg, 80 µCi; Moravek Biochemicals, Brea, CA) that was prepared as described above. Whole blood was collected and bone marrow was harvested from the femurs and sternum after 24, 72, or 168 h. DNA was extracted with the QIAGEN Blood and Cell Culture DNA Midi Kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions. DNA (10 µg) was used for analysis. 14C incorporation into DNA was determined in duplicate using a Beckman LS 6500 Scintillation Counter (Beckman Coulter Inc., Fullerton, CA).

MEFs. Genomic DNA was isolated from 2 x 107 primary MEFs (Msh2+/+ and Msh2-/-) after 24- to 120-h incubation of cells with 10 µM MP, using the QIAGEN Blood and Cell Culture DNA Midi Kit, per the manufacturer's instructions. DNA (10 µg) was used for analysis. The level of 2'-deoxy-6-thioguanosine (dGS) incorporation into DNA after MP treatment was determined in triplicate by high-performance liquid chromatography analysis, as previously described in detail (Krynetskaia et al., 1999Go).

DNA-Protein Interaction by Electromobility Shift Assay (EMSA)
Nuclear extracts were prepared from the primary MEF cells (2.5 x 108) as previously described (Dignam et al., 1983Go). Protein concentrations of nuclear extracts were determined by the Bradford dye-binding procedure, using the Bio-Rad Protein assay (Bio-Rad). Aliquots (25 µl) of nuclear protein extracts were stored at -70°C. Nuclear extracts from HeLa cells were used as positive controls (Promega, Madison, WI). The oligodeoxyribonucleotides d(ACTCTTGCCTTTAAGGAAAGTATCTAAATGCTTC), the complementary strands d(GAAGCATTTAGATACTTTCCTTAAAGGCAAGAGT) to form GC-duplex, and d(GAAGCATTTAGATACTTTTCTTAAAGGCAAGAGT) to form GT-duplex were synthesized using standard protocols with an automatic synthesizer (380B, Applied Biosystems, Foster City, CA) in the Hartwell Center of St. Jude Children's Research Hospital. Modified strand d(ACTCTTGCCTTTAAGGSAAAGTATCTAAATGCTTC) to form GST-duplex, containing one thioguanosine insert (dGS), was synthesized by standard phosphoramidite chemical methods with S6-DNP-dG-CE phosphoramidite (Krynetskaia et al., 1999Go). The 5'-ends of the single-stranded oligodeoxyribonucleotides were labeled using [32P]ATP and the RTS T4 Kinase Labeling System (Invitrogen, Carlsbad, CA). Oligodeoxyribonucleotide duplexes containing GC-, GT- and GST-pairs were prepared by annealing complementary single strands and template strand. DNA duplexes were then purified by nondenaturing gel electrophoresis on a 12% polyacrylamide gel at 4°C, as previously described (Krynetski et al., 2001Go) or by fast protein liquid chromatography using a Superdex 75 column (Amersham Biosciences Inc.). DNA-protein binding assays (EMSA) were performed as described (Griffin et al., 1994Go) using 10 to 100 nM 32P-labeled DNA duplex, 5x "cold" GC-duplex, and 10 to 50 µg of total protein.

Modeling, Statistics, and Parameter Estimation. Differences among genotypes regarding percentage change in hematopoietic cell numbers were determined by Kruskal-Wallis analysis of variance. Differences in cumulative doses in Msh2-/- mice were determined by the Mann-Whitney U test. The survival curves were determined by Kaplan-Meier estimation. Differences in survival between Msh2+/+ and Msh2-/- mice were determined by the Cox proportional hazard regression model. Incorporation of dGS into DNA was modeled using the sigmoid Emax model. Model parameter estimates including the IC50 were determined by the maximum likelihood method, using the Adapt II software. (D'Argenio and Schumitzky, 1997Go) The t test was used to determine significant differences in the IC50 between Msh2+/+ and Msh2-/- mice.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
MSH2 Expression. Sixty-three patients were studied, the demographics of whom are summarized in Table 1. MSH2 protein was undetectable in ALL blasts (Fig. 1A) from 11 of 63 patients (17.5%), whereas a GAPDH signal was detectable in all samples (Fig. 1, A and B). Comparison of the normalized MSH2 signal across the group of MSH2-positive samples revealed a 10-fold difference in the level of MSH2 protein (median 0.21 RU, range 0.074–0.82 RU), as shown in Fig. 1C. Cloning and sequencing of MSH2 cDNA isolated from leukemia cells of three patients with undetectable MSH2 protein and three patients with high (0.51, 0.58, and 0.82 RU) MSH2 protein expression failed to identify MSH2 coding region sequence variants that differed in ALL blasts with low or high MSH2 protein levels.


View this table:
[in this window]
[in a new window]
 
TABLE 1 Demographic data for ALL patients at the time of initial diagnosis with different MSH2 status

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Western blot analysis of MSH2 protein in human acute lymphoblastic leukemia cells. In each experiment, total protein extracted from 1 x 106 cells was loaded per lane and developed with anti-MSH2 antibody or anti-GAPDH antibody. A, no MSH2 protein was found in 11 ALL patient samples (A–K). B, representative view of 10 from 52 samples with positive MSH2 expression in ALL patient samples (L–U). Arrows indicate MSH2 and GAPDH proteins in human 697 ALL cell line (positive quality control). C, histogram of relative amount of MSH2 protein normalized versus GAPDH for 63 ALL patient samples. The gray bar represents the number of patients with an undetectable level of MSH2. Expression of GAPDH was shown for all 63 patients.

 

The Msh2 phenotype in mice was confirmed by Western analysis of several murine tissues, including bone marrow, liver, spleen, and kidney (Fig. 2). Msh2 was expressed in all analyzed tissues of Msh2+/+ mice (see relative Msh2 protein level normalized per GAPDH, Fig. 2B), whereas no Msh2 protein was detected in any tissues from Msh2-/- mice (Fig. 2).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Msh2 expression in mice. A, Western blot analysis of Msh2 protein in murine tissues obtained from Msh2+/+ (lanes 1–4) and Msh2-/- mice (lanes 5–8). Lanes 1 and 5, liver; lanes 2 and 6, spleen; lanes 3 and 7, kidney; lanes 4 and 8, bone marrow. Total protein (20 µg) was loaded per lane and the membranes were developed with anti-MSH2 antibody or anti-GAPDH antibody (control). The expression of GAPDH was shown in all samples including samples from Msh2-/- mice. Histogram of the relative amount of Msh2 protein in mouse tissues, normalized versus GAPDH.

 

In Vivo Thiopurine Cytotoxicity. MP hematopoietic toxicity was assessed in the Msh2+/+, Msh2+/-, and Msh2-/- mice with two treatment protocols: 2.5 to 20 mg/kg/day (i.p.) for 21 days and 30 to 150 mg/kg/day (i.p.) for 14 days (Hara et al., 1989Go). Administration of 2.5 to 20 mg/kg/day of MP (i.p.) for 21 days caused negligible changes in leukocyte and erythrocyte counts (data not shown). Therefore, 30 mg/kg/day of MP (i.p.) for 14 days was further utilized for assessing hematological toxicity, because it did not result in treatment-related deaths in either group and consistently decreased WBC count in Msh2+/+ and Msh2+/- mice by more than 50%. Cytotoxicity data were obtained from three independent studies using 14 mice in each group (Msh2+/+, Msh2+/-, and Msh2-/- mice) after treatment with MP (30 mg/kg/day) and 12 to 13 mice in each control group (treated with 0.9% NaCl). Msh2+/+ and Msh2+/- mice exhibited a significant drop in total leukocytes [median (quartiles): -53.6% (-64.5%, -41.0%) and -49.6% (-60.0%, -39.7%)] following 14 days of MP (30 mg/kg/day i.p.), compared with the Msh2-/- mice [median (quartiles): +16.3% (-25.9%, 48.6%)] (Fig. 3A, p < 0.002). It is noteworthy that similar changes were found in neutrophils [median: -72.5% and -68.7% in Msh2+/+ and Msh2+/- compared with +18.8% in Msh2-/- mice, p = 0.0025] and in lymphocytes [median: -50.8% and -50.53 in Msh2+/+ and Msh2+/- compared with -1.4% in Msh2-/- mice, p = 0.016], but no significant differences were found in monocytes [median: -8.7% and +45.2% in Msh2+/+ and Msh2+/- compared with +37.9% in Msh2-/- mice, p = 0.15]. Likewise, Msh2+/+ and Msh2+/- mice demonstrated a significantly greater decrease in erythrocyte count [median (quartiles): -54.0% (-62.2%, -44.7%) and -41.1% (-48.1%, -36.8%)] following MP treatment compared with -15.6% (-22.3%, -10.6%) [median (quartiles)] in Msh2-/- mice (Fig. 3B, p < 0.0001).



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. Hematological toxicity studies in Msh2+/+, Msh2+/-, and Msh2-/- mice. Changes of WBC count (A) and changes in RBC count (B) in mice after i.p. administration of MP (30 mg/kg/day, 14 days). Each point represents the result of three parallel experiments (mean ± S.E.).

 

As depicted in Fig. 4, MP doses of more than 50 mg/kg/day (50, 100, and 150 mg/kg/day with three mice in each group and three in each control group treated with 0.9% NaCl) for 14 days resulted in treatment-related deaths. However, Msh2-/- mice had a survival advantage compared with Msh2+/+ mice (Fig. 4A, p = 0.02). In addition, Msh2-/- mice tolerated significantly higher cumulative doses of MP after treatment with 50 mg/kg/day and 150 mg/kg/day (Fig. 4B, p < 0.05).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 4. Mortality of Msh2+/+ and Msh2-/- mice after daily treatment with high-dose MP (50, 100, or 150 mg/kg) by i.p. administration. A, Kaplan-Meier analysis of proportion surviving in Msh2+/+ and Msh2-/- mice. B, cumulative dose of MP and cumulative survival days for each group of mice with different doses of MP.

 

In Vitro Thiopurine Cytotoxicity. After 4 days of MP treatment (0.001–100 µM), only Msh2+/+ MEFs revealed cytotoxicity (IC50 = 31.4 ± 15.1 µM). After 5 to 6 days of MP treatment, Msh2-/- fibroblasts were 3- to 4-fold less sensitive, compared with MEFs from Msh2+/+ mice (IC50-day5 = 18.4 ± 6.8 versus 6.8 ± 1.9 and IC50-day6 = 11.9 ± 1.3 versus 3.8 ± 0.1, p = 0.0001). Cytotoxicity for MEFs with different Msh2 genotypes after 6 days of MP treatment are shown in Fig. 5.



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 5. Viability of Msh2-/- and Msh2+/+ MEFs after 6 days of mercaptopurine treatment, as determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium assay. Closed circles, Msh2+/+ cells; open circles, Msh2-/- cells. Each point represents the result of three parallel experiments (mean ± S.E.).

 

ThioG Incorporation in DNA and Nuclear Protein-DNA Interactions. Figure 6 shows the level of 6-thiodeoxyriboguanosine in genomic DNA after [14C]MP administration in a single dose (11.4 mg/kg) to mice with each Msh2 genotype, and in MEFs after 10 µM MP treatment. No statistically significant differences in GS-insert accumulations into genomic DNA were found between Msh2+/+ and Msh2-/- mice after treatment for 24, 72, or 168 h (p = 0.83, 0.08, and 0.28, respectively). Also, there were no significant differences in the activity of thiopurine-activating (i.e., HPRT, p = 0.6) or -inactivating (i.e., TPMT) enzymes in leukocytes (p = 0.17) and erythrocytes (p = 0.8) from Msh2+/+ and Msh2-/- mice (Table 2). HPRT activities are similar for MEFs from Msh2+/+ and Msh2-/- mice (p = 0.6). Note that TPMT activity was higher in MEFs from Msh2+/+ mice versus MEFs from Msh2-/- mice (26.2 ± 5.3 versus 6.1 ± 3.9 nmol/h/109 cells; Table 2; p = 0.043).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 6. Thioguanosine incorporation into genomic DNA. A, DNA extracted from bone marrow of mice (Msh2+/+, closed bars; or Msh2-/-, open bars) after treatment with a single dose of 11.4 mg/kg [14C]MP for 24, 72, and 168 h. B, DNA extracted from MEFs (Msh2+/+, closed bars; or Msh2-/-, open bars) after incubation with 10 µM MP for 72 h and 120 h. Each point represents the result of three parallel experiments (mean ± S.E.).

 

View this table:
[in this window]
[in a new window]
 
TABLE 2 TPMT and HPRT activity (mean ± S.E.M.) in RBC and WBC from untreated Msh2+/+, Msh2+/-, and Msh2-/- mice

 

Western blot analysis of Msh2 protein in nuclear extracts from Msh2-proficient and -deficient MEFs is shown in Fig. 8A. Using [32P]GT-duplex (positive control) and [32P]GC-duplex (negative control), we demonstrated that only nuclear proteins from Msh2+/+ MEFs interact with [32P]GT-duplex (Fig. 7), corroborating previously published data (Dewind et al., 1995Go). Likewise, a DNA-protein complex containing Msh2 protein was formed only with Msh2+/+ nuclear extracts and [32P]GST-duplex (Fig. 8B, lane 2, band a). This complex was attenuated by 2.5 mM ATP (Fig. 8B, compare lanes 1 and 2), had mobility similar to that of the GT-DNA-protein complex from human nuclear extract (Fig. 8B, band a, lane 6), and contained Msh2 protein as documented by Western analysis of the EMSA gel using anti-MSH2 antibody (Fig. 8C, lanes 1 and 2). Titration of the GST-DNA duplex with increasing amounts of total nuclear protein from Msh2+/+ MEFs resulted in an increase of Msh2-containing DNA-protein complex formation (Fig. 8E). In contrast, no such GST-DNA-protein complex was formed in the Msh2-/- MEFs (Fig. 8B, lanes 3 and 4). However, the increased formation of another DNA-protein complex was observed with Msh2-/- nuclear extracts (Fig. 8B, band b, lanes 1–2 versus 3–4; and Fig. 8D, open bars). The intensity of bands (percentage of total radioactivity) corresponding to complexes a and b is shown in Fig. 8D.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 8. DNA-protein complex formation in the presence of GST-DNA. A, Western blot analysis of nuclear protein extracts from Msh2+/+ or Msh2-/- MEFs using anti-MSH2 antibody and anti-GAPDH antibody. B, EMSA in the presence of 10 nM 5'-32P-labeled GST-DNA duplexes with protein extracts from Msh2+/+ or Msh2-/- MEFs (lanes 1–4) and 5'-32P-labeled GT-duplex with protein extract from human HeLa cells (lanes 5 and 6). C, Western blot analysis of EMSA gel transferred onto a polyvinylidene difluoride membrane and developed with anti-MSH2 antibody. Msh2-protein in complex "a" was found only in Msh2+/+ cells (lanes 1 and 2). D, quantification of DNA-protein complexes "a" and "b" (as indicated by arrows in B; percentage of total radioactivity). Closed bars depict Msh2-containing complexes; open bars depict complexes that do not contain Msh2 protein. E, GST-DNA-protein complex formation (percentage of total radioactivity) containing Msh2 protein in the presence of 10 nM 5'-32P-labeled GST-duplex and increasing amounts of nuclear proteins from Msh2+/+ MEFs.

 


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 7. DNA protein interactions by EMSA in the presence of nuclear extracts from Msh2+/+ and Msh2-/- MEFs and 32P-labeled GT-DNA (positive control, lanes 1–4) or GC-DNA (negative control, lanes 5 and 6). ATP treatment abrogates the GT-DNA-protein complex (compare lanes 1 and 2). Arrows indicate mobility of Msh2-containing DNA-protein complex and free DNA.

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Defects in apoptotic machinery or DNA repair can promote drug resistance by mechanisms downstream of drug-target interactions, permitting genotoxic agents to induce nonlethal genetic alterations, setting the stage for "damage without death" (Johnstone et al., 2002Go). This is consistent with the increased rate of secondary malignancies after treatment of ALL patients with topoisomerase II inhibitors following MP therapy (Blanco et al., 2001Go), which may be influenced by DNA repair competence.

In the current study, we initially established that MSH2 protein levels exhibit substantial interindividual differences in primary leukemia cells from children with newly diagnosed ALL, with the absence of detectable MSH2 protein in 17% of patients and more than a 10-fold range in MSH2 in ALL blasts with detectable MSH2 protein (Fig. 1). These findings are consistent with earlier studies in adults and children with ALL and acute myelogenous leukemia (Matheson and Hall, 1999Go; Zhu et al., 1999Go) and suggest that therapeutic effects could differ if MSH2 protein is an important determinant of cytotoxicity with genotoxic chemotherapy. There were no statistically significant differences in patient demographics, ALL lineage, or molecular subtypes, or MSH2 cDNA sequences between patients who had detectable versus undetectable MSH2 protein in ALL blasts (Table 1), although the relatively small number of patients limits the power of these comparisons.

In vitro experiments have indicated that cells with inactive components of the mismatch repair system (i.e., MSH2, MSH6, or MLH1), have greater resistance to thiopurines than do their MMR-proficient counterparts (Berry et al., 2000Go). To determine whether MSH2 was essential for hematopoietic toxicity in vivo, we performed cytotoxicity studies using an Msh2 knockout mouse model and mercaptopurine treatment. Thiopurines have been used for the treatment of human leukemia for more than 50 years (Elion, 1989Go), yet the molecular events underlying their therapeutic effects remain obscure. Both MP and TG are inactive prodrugs that require intracellular anabolism to nucleoside triphosphates, with subsequent incorporation of fraudulent nucleoside (dGS) into DNA, to induce cytotoxicity (Pennington and Bronk, 1995Go; McLeod et al., 2000Go; Chen et al., 2001Go). dGS-inserts in DNA-template result in an increased frequency of GST-mismatch pair formation compared with nonmodified DNA-template, although in vitro replication showed that formation of GSC-pairs was 300-fold preferential compared with GST-pairs (Ling et al., 1992Go; Rappaport, 1993Go; Krynetski et al., 2001Go). We recently showed that the presence of GSC-pairs in DNA results in local alterations of DNA structure (Somerville et al., 2003Go) distinct from DNA structural changes caused by GT-mismatches (Roongta et al., 1990Go). Nonenzymatic alkylation of the thio group in GS-DNA was hypothesized to convert thioguanosine to a highly toxic S-methylthioguanosine moiety (Swann et al., 1996Go; Waters and Swann, 1997Go), increasing the formation of GSmeT mismatch pairs during DNA replication across S-methyl deoxythioguanosine template (Spratt and Levy, 1997Go). In both scenarios, the MSH2-MSH6 complex plays an important role in detecting the mismatched base pair formed at the site of thioguanosine incorporation.

To study the role of MSH2 protein in determining thiopurine hematopoietic toxicity, we compared treatment-induced changes in leukocytes (i.e., neutrophils, lymphocytes, and monocytes) and erythrocytes in Msh2-deficient and -proficient mice. We found significantly greater reduction of total WBCs (Fig. 3A) including neutrophils and lymphocytes, and RBCs in MMR-proficient mice compared with Msh2-/- mice following MP treatment (30 mg/kg/day; Fig. 3B), but no changes were found with 2.5 to 20 mg/kg/day of MP for 21 days. These results indicate that MMR proficiency is important for cytotoxicity in hematopoietic cells at 30 mg/kg/day of MP. Likewise, in vitro experiments revealed a 3-fold difference in MP cytotoxicity in Msh2+/+ versus Msh2-/- murine embryo fibroblast cells (Fig. 5, p = 0.0001). No differences in nutrition or general well being were observed between the untreated or low-dose (2.5 to 30 mg/kg/day) MP-treated MMR-deficient and MMR-proficient mice. Furthermore, treatment with higher MP doses (50–150 mg/kg/day i.p.) resulted in mortality of mice with each Msh2 genotype (Fig. 4). However, MMR-deficient mice survived longer while receiving higher MP dosages (Fig. 4A, p = 0.02), and they tolerated higher cumulative doses of MP compared with MMR-proficient mice (Fig. 4B, p < 0.05).

Because the MMR system interacts with mismatches generated due to thioguanosine incorporation into DNA, we compared the level of GS-inserts in DNA of mice with both Msh2 genotypes. Fig.6 demonstrates accumulation of similar levels of GS-inserts in genomic DNA after MP treatment in mice and in MEFs with different genotypes, yet Msh2+/+ mice and Msh2+/+ MEFs had greater cytotoxicity compared with Msh2-/- mice and Msh2-/- MEFs after MP treatment (Figs. 3 and 5). It has been hypothesized that futile DNA repair of GST or GSmeT mismatches eventually triggers apoptosis via mechanisms that remain unknown (Fink et al., 1998Go; Berry et al., 2000Go). Our in vivo findings are consistent with the hypothesis that the MMR system is unable to remove GS-inserts from DNA in mice treated with MP.

To confirm that GST-DNA is recognized by MMR, we performed DNA-protein interaction studies using EMSA. These experiments demonstrated that nuclear proteins extracted from Msh2+/+ MEFs, but not Msh2-/-, recognized GT-as well as GST-mismatch pairs of DNA, forming DNA-protein complexes containing Msh2 (Figs. 7 and 8) No similar DNA-protein complexes were found in experiments with nuclear extracts from Msh2-/- MEF cells. However, another DNA-protein complex formed between GST-containing DNA duplex and nuclear proteins from Msh2-/- MEFs (Fig. 8B, lanes 3 and 4), indicating the existence of alternative proteins recognizing thioguanosine-modified DNA in Msh2-/- mice. An alternative GS-DNA-protein complex, distinct from the known DNA-mismatch repair protein complex, has recently been found in human MSH2- and MSH6-negative ALL cells (Krynetski et al., 2001Go; Krynetski et al., 2003Go).

In summary, the current studies have documented that a subgroup of patients (17%) have undetectable MSH2 protein in their ALL cells and revealed marked heterogeneity of MSH2 protein in leukemia cells from the remainder of children with newly diagnosed acute lymphoblastic leukemia. In vivo experiments with Msh2+/+ and Msh2-/- mice revealed a significant effect of MSH2 protein on the cytotoxicity of genotoxic thiopurine agents. Our in vivo findings indicate that MMR cannot repair newly synthesized DNA, consistent with the hypothesis that futile mismatch repair triggers apoptosis (Berry et al., 2000Go). The difference in thiopurine cytotoxicity and delayed mortality in Msh2-deficient mice indicates the in vivo importance of Msh2 in thiopurine hematopoietic toxicity and provides the first in vivo evidence that MMR deficiency attenuates, but does not abolish, the cytotoxicity of thiopurines.


    Acknowledgements
 
We gratefully acknowledge the St. Jude Hartwell Center, and patients and parents who participated in this study. We thank N. Kornegay, M. L. Hankins, Eve Su, N. Lenchik, A. Lenchik, M. de Tamano, YaQuin Chu, and M. Mane for excellent computational or technical assistance.


    Footnotes
 
This work was supported in part by National Institutes of Health Grant R37 CA36401, by Cancer Center Support Grant CA 21765, by the American Lebanese Syrian Associated Charities (ALSAC), and by the F. M. Kirby Clinical Research Professorship from the American Cancer Society.

ABBREVIATIONS: ALL, acute lymphoblastic leukemia; MMR, mismatch repair; MSH2, MutS homolog 2; MP, mercaptopurine; TG, 6-thioguanine; dGS, deoxythioguanosine; MEF, murine embryonic fibroblast; HPRT, hypoxanthine guanine phosphoribosyl transferase; TPMT, thiopurine methyltransferase; WBC, white blood cell; RBC, red blood cell; EMSA, electromobility shift assay; RU, relative unit(s).

Address correspondence to: Dr. William E. Evans, St. Jude Children's Research Hospital, 332 N. Lauderdale, Memphis, TN 38105. E-mail: william.evans{at}stjude.org


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Berry SE, Davis TW, Schupp JE, Hwang HS, de Wind N, and Kinsella TJ (2000) Selective radiosensitization of drug-resistant MutS homologue-2 (MSH2) mismatch repair-deficient cells by halogenated thymidine (DThd) analogues: Msh2 mediates DThd analogue DNA levels and the differential cytotoxicity and cell cycle effects of the DThd analogues and 6-thioguanine. Cancer Res 60: 5773–5780.[Abstract/Free Full Text]

Blanco JG, Dervieux T, Edick MJ, Mehta PK, Rubnitz JE, Shurtleff S, Raimondi SC, Behm FG, Pui CH, and Relling MV (2001) Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia. Proc Natl Acad Sci USA 98: 10338–10343.[Abstract/Free Full Text]

Branch P, Aquilina G, Bignami M, and Karran P (1993) Defective mismatch binding and a mutator phenotype in cells tolerant to DNA damage. Nature (Lond) 362: 652–654.[CrossRef][Medline]

Chen ZS, Lee K, and Kruh GD (2001) Transport of cyclic nucleotides and estradiol 17-beta-D-glucuronide by multidrug resistance protein 4. Resistance to 6-mercaptopurine and 6-thioguanine. J Biol Chem 276: 33747–33754.[Abstract/Free Full Text]

Chessells JM (1998) Relapsed lymphoblastic leukemia in children: a continuing challenge. Br J Haematol 102: 423–438.[CrossRef][Medline]

D'Argenio DZ and Schumitzky A (1997) ADAPT II User's Guide: Pharmacokinetic/ Pharmacodynamic Systems Analysis Software. Biomedical Simulations Resource, Los Angeles.

Das-Gupta EP, Seedhouse CH, and Russell NH (2000) DNA repair mechanisms and acute myeloblastic leukemia. Hematol Oncol 18: 99–110.[CrossRef][Medline]

Dewind N, Dekker M, Berns A, Radman M, and Riele HT (1995) Inactivation of the mouse Msh2 gene results in mismatch repair deficiency, methylation tolerance, hyperrecombination and predisposition to cancer. Cell 82: 321–330.[CrossRef][Medline]

Dignam JD, Lebovitz RM, and Roeder RG (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475–1489.[Abstract/Free Full Text]

Durant ST, Morris MM, Illand M, Mckay HJ, McCormick C, Hirst GL, Borts RH, and Brown R (1999) Dependence on RAD52 and RAD1 for anticancer drug resistance mediated by inactivation of mismatch repair genes. Curr Biol 9: 51–54.[CrossRef][Medline]

Elion GB (1989) The purine path to chemotherapy. Science (Wash DC) 244: 41–47.[Abstract/Free Full Text]

Fink D, Aebi S, and Howell SB (1998) The role of DNA mismatch repair in drug resistance. Clin Cancer Res 4: 1–6.[Abstract]

Flores-Rozas H and Kolodner RD (2000) Links between replication, recombination and genome instability in eukaryotes. Trends Biochem Sci 25: 196–200.[CrossRef][Medline]

Griffin S, Branch P, Xu YZ, and Karran P (1994) DNA mismatch binding and incision at modified guanine bases by extracts of mammalian cells: implications for tolerance to DNA methylation damage. Biochemistry 33: 4787–4793.[CrossRef][Medline]

Hara T, Makita T, Horiya N, Ozawa S, Ohba M, Naito J, and Shibuya T (1989) Micronucleus test with 6-mercaptopurine monohydrate administered intraperitoneally and orally. Mutat Res 223: 349–352.[CrossRef][Medline]

Iwaniec LM, Kroll JJ, Roethel WM, and Maybaum J (1991) Selective inhibition of sequence-specific protein-DNA interactions by incorporation of 6-thioguanine: cleavage by restriction endonucleases. Mol Pharmacol 39: 299–306.[Abstract]

Johnstone RW, Ruefli AA, and Lowe SW (2002) Apoptosis: a link between cancer genetics and chemotherapy. Cell 108: 153–164.[CrossRef][Medline]

Karran P and Bignami M (1996) Drug-related killings: a case of mistaken identity. Chem Biol 3: 875–879.[CrossRef][Medline]

Krynetskaia NF, Cai X, Nitiss JL, Krynetski EY, and Relling MV (2000) Thioguanine substitution alters DNA cleavage mediated by topoisomerase II. FASEB J 14: 2339–2344.[Abstract/Free Full Text]

Krynetskaia NF, Krynetski EY, and Evans WE (1999) Human RNaseH-mediated RNA cleavage from DNA-RNA duplexes is inhibited by 6-deoxyguanosine incorporation into DNA. Mol Pharmacol 56: 841–848.[Abstract/Free Full Text]

Krynetski EY, Krynetskaia NF, Bianchi ME, and Evans WE (2003) A nuclear protein complex containing high mobility group protein B1 and B2, heat shock cognate protein 70, ERp60 and glyceraldehyde-3-phosphate dehydrogenase is involved in the cytotoxic response to DNA modified by incorporation of anticancer nucleoside analogues. Cancer Res 63: 100–106.[Abstract/Free Full Text]

Krynetski EY, Krynetskaia NF, Gallo AE, Murti KG, and Evans WE (2001) A novel protein complex distinct from mismatch repair binds thioguanylated DNA. Mol Pharmacol 59: 367–374.[Abstract/Free Full Text]

Krynetski EY, Schuetz JD, Galpin AJ, Pui C-H, Relling MV, and Evans WE (1995) A single point mutation leading to loss of catalytic activity in human thiopurine S-methyltransferase. Proc Natl Acad Sci USA 92: 949–953.[Abstract/Free Full Text]

LePage GA (1963) Basic biochemical effects and mechanism of action of 6-thioguanine. Cancer Res 23: 1202–1206.

Ling YH, Chan JY, Beattie KL, and Nelson JA (1992) Consequences of 6-thioguanine incorporation into DNA on polymerase, ligase and endonuclease reactions. Mol Pharmacol 42: 802–807.[Abstract]

Matheson EC and Hall AG (1999) Expression of DNA mismatch repair proteins in acute lymphoblastic leukaemia and normal bone marrow. Drug Resist Leukemia Lymphoma 457: 579–583.

Maybaum J and Mandel HG (1983) Unilateral chromatid damage: a new basis for 6-thioguanine cytotoxicity. Cancer Res 43: 3852–3856.[Abstract/Free Full Text]

McLeod HL, Krynetski EY, Relling MV, and Evans WE (2000) Genetic polymorphism of thiopurine methyltransferase and its clinical relevance for childhood acute lymphoblastic leukemia. Leukemia (Baltimore) 14: 567–572.[CrossRef][Medline]

Olipitz W, Hopfinger G, Aguiar RC, Gunsilius E, Girschikofsky M, Bodner C, Hiden K, Linkesch W, Hoefler G, and Sill H (2002) Defective DNA-mismatch repair: a potential mediator of leukemogenic susceptibility in therapy-related myelodysplasia and leukemia. Genes Chromosomes Cancer 34: 243–248.[CrossRef][Medline]

Pennington AM and Bronk JR (1995) The absorption of 6-mercaptopurine from 6-mercaptopurine riboside in rat small intestine: effect of phosphate. Cancer Chemother Pharmacol 36: 136–142.[Medline]

Pieters R, Loonen AH, Huismans DR, Broekema GJ, Dirven MW, Heyenbrok MW, Hahlen K, and Veerman AJ (1990) In vitro drug sensitivity of cells from children with leukemia using the MTT assay with improved culture conditions. Blood 76: 2327–2336.[Abstract/Free Full Text]

Pui CH and Evans WE (1998) Acute lymphoblastic leukemia. N Engl J Med 339: 605–615.[Free Full Text]

Rappaport HP (1993) Replication of the base pair 6-thioguanine/5-methyl-2-pyrimidine with the large Klenow fragment of Escherichia coli DNA polymerase I. Biochemistry 32: 3047–3057.[CrossRef][Medline]

Reitmair AH, Redston M, Cai JC, Chuang TCY, Bjerknes M, Cheng H, Hay K, Gallinger S, Bapat B, and Mak TW (1996) Spontaneous intestinal carcinomas and skin neoplasms in Msh2-deficient mice. Cancer Res 56: 3842–3849.[Abstract/Free Full Text]

Reitmair AH, Schmits R, Ewel A, Bapat B, Redston M, Mitri A, Waterhouse P, Mittrucker HW, Wakeham A, Liu B, et al. (1995) Msh2 deficient mice are viable and susceptible to lymphoid tumors. Nat Genet 11: 64–70.[CrossRef][Medline]

Roongta VA, Jones CR, and Gorenstein DG (1990) Effect of distortions in the deoxyribose phosphate backbone conformation of duplex oligodeoxyribonucleotide dodecamers containing GT, GG, GA, AC and GU base-pair mismatches on P-31 NMR-spectra. Biochemistry 29: 5245–5258.[CrossRef][Medline]

Sambrook J, Fritsch EF, and Maniatis T (1989) Detection and analysis of proteins expressed from cloned genes, in Molecular Cloning: A Laboratory Manual (Nolan C ed) pp 18.32, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Somerville L, Krynetski EY, Krynetskaia NF, Beger RD, Zhang W, Marhefka CA, Evans WE, and Kriwacki RW (2003) Structure and dynamics of thioguanine-modified duplex DNA. J Biol Chem 278: 1005–1011.[Abstract/Free Full Text]

Spratt TE and Levy DE (1997) Structure of the hydrogen bonding complex of O6-methylguanine with cytosine and thymine during DNA replication. Nucleic Acids Res 25: 3354–3361.[Abstract/Free Full Text]

Swann PF, Waters TR, Moulton DC, Xu YZ, Zheng Q, Edwards M, and Mace R (1996) Role of postreplicative DNA mismatch repair in the cytotoxic action of thioguanine. Science (Wash DC) 273: 1109–1111.[Abstract]

Wang Y, Cortez D, Yazdi P, Neff N, Elledge SJ, and Qin J (2000) BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes Dev 14: 927–939.[Abstract/Free Full Text]

Waters TR and Swann PF (1997) Cytotoxic mechanism of 6-thioguanine: HMutS{alpha}, the human mismatch binding heterodimer, binds to DNA containing S6-methylthioguanine. Biochemistry 36: 2501–2506.[CrossRef][Medline]

Weinshilboum RM, Raymond FA, and Pazmino PA (1978) Human erythrocyte thiopurine methyltransferase: radiochemical microassay and biochemical properties. Clin Chim Acta 85: 323–333.[CrossRef][Medline]

Zhu YM, Das-Gupta EP, and Russell NH (1999) Microsatellite instability and P53 mutations are associated with abnormal expression of the MSH2 gene in adult acute leukemia. Blood 94: 733–740.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Br Med BullHome page
P. Karran
Thiopurines, DNA damage, DNA repair and therapy-related cancer
Br. Med. Bull., February 2, 2007; (2007) ldl020v1.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
I. C. Davis, E. R. Lazarowski, J. M. Hickman-Davis, J. A. Fortenberry, F.-P. Chen, X. Zhao, E. Sorscher, L. M. Graves, W. M. Sullender, and S. Matalon
Leflunomide Prevents Alveolar Fluid Clearance Inhibition by Respiratory Syncytial Virus
Am. J. Respir. Crit. Care Med., March 15, 2006; 173(6): 673 - 682.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Yamane and T. J. Kinsella
Casein Kinase 2 Regulates Both Apoptosis and the Cell Cycle Following DNA Damage Induced by 6-Thioguanine
Clin. Cancer Res., March 15, 2005; 11(6): 2355 - 2363.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. M. Brown, E. Y. Krynetski, N. F. Krynetskaia, D. Grieger, S. T. Mukatira, K. G. Murti, C. A. Slaughter, H.-W. Park, and W. E. Evans
A Novel CRM1-mediated Nuclear Export Signal Governs Nuclear Accumulation of Glyceraldehyde-3-phosphate Dehydrogenase following Genotoxic Stress
J. Biol. Chem., February 13, 2004; 279(7): 5984 - 5992.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Krynetskaia, N. F.
Right arrow Articles by Evans, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Krynetskaia, N. F.
Right arrow Articles by Evans, W. E.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition

Copyright © 2003 by the American Society for Pharmacology and Experimental Therapeutics