![]() |
|
|
CIIT Centers for Health Research, Research Triangle Park, North Carolina (M.E.W., E.B., L.Y.); Department of Biomedical Sciences, University of Rhode Island, Kingston, Rhode Island (H.Z., B.Y.); and National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina (A.U., M.N.)
Received January 23, 2003; accepted May 13, 2003
| Abstract |
|---|
|
|
|---|
-dihydroxytestosterone-induced transcriptional activity
(Kelce et al., 1995
|
DDE induces the expression of hepatic cytochrome P450 (P450) enzymes,
including the P450 isozymes CYP 2B1 and 3A1
(Nims and Lubet, 1995
;
You et al., 1999
). In rodent
liver, CYP 3A1 catalyzes 6
-hydroxylation of testosterone, and 2B1
catalyzes 16
- and 16
-hydroxylation, and 17
-hydroxysteroid
dehydrogenation of testosterone (Arlotto et
al., 1991
). The activities of hepatic testosterone
16
-hydroxylase and 17
-hydroxysteroid dehydrogenase, which oxidizes
testosterone to produce androstenedione, are increased in DDE-treated rats
(You et al., 1999
). Treatment
with DDE in utero also significantly induces hepatic 2B1- and 3A1-mediated
6
-, 16
-, and 16
-hydroxylase activities and the activity of
17
-hydroxysteroid dehydrogenation in 21-day-old male rats
(You et al., 1999
). These
increases in enzyme activities can be expected to alter the metabolism of
their substrates, including endogenous androgens.
Similar to DDE, exposure to phenobarbital (PB) increases the expression of
hepatic CYP 3A1 and 2B1 and induces reproductive dysfunction
(Gupta et al., 1982
;
Waxman and Azaroff, 1992
). The
effects of PB on the male reproductive tract are similar to those caused by
DDE and include reduced anogenital distance, delayed testicular descent,
delayed onset of puberty, and reduced seminal vesicle weights (Gupta et al.,
1980
,
1982
). These antiandrogen-like
effects are believed to be a consequence of decreased plasma testosterone
concentrations, resulting from increased hepatic steroid metabolism and
inhibition of gonadal testosterone synthesis
(Elias and Gwinup, 1980
;
Gupta et al., 1982
). In
contrast to DDE, PB does not inhibit AR transactivation (L. You, unpublished
observation). Thus, alterations in the activities of steroid-metabolizing
enzymes, including CYP 3A1 and 2B1, may change the bioavailability of
androgens and contribute to the reproductive toxicity of DDE and PB.
The expression of CYP 3A1 and 2B1 is regulated by the nuclear receptors
pregnane X receptor (PXR) and constitutive androstane receptor (CAR),
respectively (Honkakoski et al.,
1998a
,b
;
Kliewer et al., 1998
). PXR and
CAR are members of the nuclear receptor (NR) 1I subfamily of nuclear receptors
(Moore et al., 2002
). When
activated, both PXR and CAR form heterodimers with the retinoid X receptor,
bind to specific DNA sites, and function as transcriptional factors for target
gene regulation (Honkakoski et al.,
1998a
,b
;
Kliewer et al., 1998
). PXR,
once activated, binds to xenobiotic response elements in the promoter region
of the CYP 3A gene, and the potency of PXR activation is the main determinant
for the degree of CYP3A induction (Kliewer
et al., 1998
; Moore and
Kliewer, 2000
). CAR binds to NR binding sites in the
phenobarbital-responsive enhancer region in the CYP 2B gene (Honkakoski et
al.,
1998a
,b
).
CAR, which can transactivate its target genes in the absence of a ligand
(Baes et al., 1994
), is known
to reside in the cytoplasm and undergoes nuclear translocation upon activation
(Kawamoto et al., 1999
).
Although the expression of CYP 2B is primarily regulated by CAR and 3A by PXR,
CAR and PXR possess cross-regulation for their target genes, and some
compounds, such as PB, can activate both CAR and PXR
(Wei et al., 2002
;
Pascussi et al., 2003
). Based
on previous observations of CYP 3A1 and 2B1 induction by DDE
(You et al., 1999
), we
hypothesize that DDE, like PB, induces the expression of cytochrome P450 via
interaction with PXR and CAR. The aim of the current study was to characterize
the induction of CYP 3A1 and 2B1 by DDE in relation to activation of CAR and
PXR. The effects of DDE on hepatic CYP 3A1 and 2B1 expression were
characterized in male rats at prepubertal and adult stages. The
pharmacological action of DDE was investigated in reference to PB, a known CAR
and PXR activator, and pregnenolone 16-
-carbonitrile (PCN), a known PXR
activator.
| Materials and Methods |
|---|
|
|
|---|
To determine nuclear translocation of CAR and PXR, adult male Sprague-Dawley rats received a single i.p. injection of 40 mg of DDE/kg body weight or 100 mg of PB/kg body weight. Animals were killed by asphyxiation with CO2 at 3, 6, or 24 h after DDE treatment and 6 h after PB treatment. Control animals received no treatment. Livers were removed and weighed, and nuclear extracts were isolated as described below.
The effect of gestational and lactational DDE exposure on perinatal hepatic enzyme expression was determined in a separate experiment. Female Sprague-Dawley rats (28 days old) were fed diets containing nominal concentrations of DDE at 0, 2.5, 25, or 250 mg/kg feed, or ppm. Diets were prepared by mixing powdered NIH-07 diet and the appropriate amount of DDE. Feed concentrations of DDE were verified in hexane-extracts of the finished dietary samples by gas chromatography. After 8 weeks on the treatment diet, the female rats were mated with untreated young male Sprague-Dawley rats maintained on regular NIH-07 diet. The pregnant F0 females continued to receive DDE in the diet throughout gestation and lactation. On postnatal day (PND) 14, three F1 male nonlittermate pups from each group were killed by asphyxiation with CO2. The livers were removed, frozen in liquid nitrogen, and stored at -80°C until subsequent analysis. The remaining pups were all weaned on PND 21 and shifted onto regular NIH-07 diet without DDE. On PND 90, F1 male rats were killed by asphyxiation with CO2, and livers (n = 4) were removed and frozen in liquid nitrogen.
Primary Hepatocyte Culture and Treatment. Hepatocytes were isolated
by a two-step perfusion procedure as previously described
(You et al., 2001
). Hepatocyte
viability was determined by lactate dehydrogenase (LDH) release using Roche
Kit 43622 and a Cobas Fara II AutoAnalyzer (Roche Diagnostics, Branchburg,
NJ). Total LDH activity was determined by comparing an aliquot of cells
solubilized with 1% Triton X-100 to the amount of LDH leaking into the medium
from the cells. Only cell preparations with initial viability >90% (<10%
LDH leakage) were used for experiments.
The isolated hepatocytes were cultured at a density of 4.8 x 104 cells/cm in collagen-coated 6-cm plastic culture plates. Cells attached to culture plates in the presence of 5% fetal bovine serum for 90 min at 37°C in air/CO2 (95:5%, v/v). Cells were washed and cultured under the same incubation conditions in medium containing 3 ml of Williams' medium E supplemented with 2 mM L-glutamine, 10 ng/ml dexamethasone (DEX), 50 µg/ml gentamicin, 5 µg/ml insulin, 5 µg/ml transferrin, and 5 ng/ml selenium. At 24 h, the culture medium was removed and replaced with 3 ml of fresh medium of the same composition; at 48 h, the medium was removed again and replaced with 3 ml of the medium containing 0.05, 0.5, 5.0, or 50 µM DDE or 0.1 or 1.0 µM PB in dimethyl sulfoxide (DMSO). The final concentration of DMSO was 0.1% (v/v) in all groups. At 72 h, after 24 h of incubation with DDE or PB, the medium was removed, and the cells were harvested with a plastic spatula. Cells from three plates within the same treatment group were pooled and pelleted by centrifugation at approximately 1000g at 4°C. The cell pellet was washed twice with 1 ml of phosphate-buffered saline before being pelleted and frozen in microcentrifuge tubes at -20°C.
Preparation of Total Protein, Microsomes, and Nuclear Extracts.
Total protein and microsomal protein were prepared from cultured hepatocytes
and liver tissue as previously described (You et al.,
1999
,
2001
). Frozen cultured
hepatocytes were resuspended in NP40 lysis buffer (Amersham Biosciences UK,
Ltd., Little Chalfont, Buckinghamshire, UK) and homogenized in a glass and
Teflon homogenizer. Nuclear extracts were prepared by homogenizing 2 g of
liver tissue in 30 ml of homogenization buffer (10 mM Hepes, pH 7.6, 2 M
sucrose, 25 mM KCl, 1 mM EDTA, 10% glycerol, 0.15 mM spermidine, and 0.5 mM
spermine). Homogenized tissue was layered on a 10-ml cushion of homogenization
buffer and centrifuged at 15,000g at 4°C for 45 min. The nuclear
pellet was resuspended in lysis buffer (10 mM Hepes, pH 7.6, 10% glycerol, 0.1
M potassium chloride, 3 mM magnesium chloride, 0.1 mM EDTA, 1 mM sodium
orthovanadate, 1 µg/ml pepstatin, 1 µg/ml leupeptin, 0.5 µg/ml E-64,
0.1 mM phenylmethylsulfonyl fluoride, and 1 mM DTT). Sodium chloride (5 M) was
added, and the sample was mixed continuously at 4°C for 1 h. Samples were
centrifuged in an ultracentrifuge at 15,000g at 4°C for 1 h.
Supernatant was dialyzed against 1liter of dialysis buffer (10 mM Hepes, pH
7.6, 10% glycerol, 0.1 M potassium chloride, 3 mM magnesium chloride, 0.1 mM
EDTA, 1 mM sodium orthovanadate, 1 µg/ml pepstatin, 1 µg/ml leupeptin,
0.5 µg/ml E-64, 0.1 mM phenylmethylsulfonyl fluoride, 1 mM DTT) overnight
at 4°C. Samples were centrifuged in an ultracentrifuge at 15,000g
at 4°C for 30 min, and the nuclear extract supernatant was stored in
liquid nitrogen.
Protein Immunoblotting for CYP 3A1, 2B1, PXR, and CAR.
Immunoblotting for cytochrome P450 enzymes and nuclear receptors was performed
as previously described (You et al.,
1999
). Liver microsomes or total protein from cultured cells or
liver tissue were denatured and separated by SDS-polyacrylamide gel
electrophoresis (PAGE) with 12% polyacrylamide. Proteins were transferred to
nitrocellulose membranes, blocked for nonspecific binding, and incubated with
polyclonal primary antibodies for CYP3A1, CYP2B1, CAR, or PXR. After
incubation with primary antibody, membranes were incubated with horseradish
peroxidase-linked anti-rabbit (CYP3A1, PXR, and CAR) or anti-goat (CYP2B1) IgG
secondary antibodies and visualized on film exposed to enhanced
chemiluminescence (Hyperfilm-ECL; Amersham Biosciences UK, Ltd.). Goat
anti-rat CYP2B1 polyclonal antibodies were obtained from Daiichi Pure Chemical
Company (Tokyo, Japan). CYP3A1 antibodies were obtained from Research
Diagnostics (Flanders, NJ). PXR anti-peptide antibody was prepared and
purified as previously described (Zhu et
al., 2000
). Rabbit anti-CAR peptide antibodies were prepared as
previously described (Yoshinari et al.,
2001
).
Quantitative Reverse Transcriptase-PCR. To quantitate the amount of CYP 2B1 and 3A1 mRNA, cDNA was synthesized from total RNA isolated from liver tissue or cultured primary hepatocytes. Random hexamers and the TaqMan reverse transcription reagents (Applied Biosystems, Foster City, CA) were used according to the manufacturer's suggested protocol. The PCR primers were designed using Primer Express software (Applied Biosystems). Rat 3A1 (GenBank accession no. X64401 [GenBank] ) forward (ctcttcaccgtgatccacagcact) and reverse (atgctgcccttgttctccttgc) primers and 2B1 (GenBank accession no. J00719 [GenBank] ) forward (tgagaacctcatgatctccctgc) and reverse (aggaaaccatagcggagtgtgg) primers were designed with the following parameters: low Tm = 60°C, high Tm = 64°C, optimum Tm = 62°C, amplicon length = 80 to 150 bp, and primer length 20 to 24 bp with an optimum of 22 bp. The production of a single PCR product was confirmed by gel electrophoresis for each pair of PCR primers before quantification. Primer efficiency was determined according to the manufacturer's suggested protocol. Real-time quantitative PCR (Taqman) was performed on a 7700 PRISM Sequence Detector (Applied Biosystems) using SYBR Green according to the manufacturer's instructions for quantification of relative gene expression (User Bulletin 2: P/N 4303859).
Nuclear Receptor Transcriptional Activation Assays. The expression
plasmids encoding full-length rat PXR were prepared by a cDNA-trapping method
as described previously (Zhang et al.,
1999
). The reporter plasmids were constructed by inserting two
copies of rat PXR response element (IR6 and DR3) into the pGL-3 SV40 promoter
vector driving a firefly luciferase gene. The pRL-TK plasmid encoding a
Renilla luciferase was purchased from Promega (Madison, WI).
Activation of rat PXR was determined by cotransfection experiments. Cells
(CV-1) were plated in 24-well plates in Dulbecco's modified Eagle's medium
supplemented with 10% dilapidated fetal calf serum at a density of 8 x
104 cells per well. Transfection was conducted by lipofection with
LipofectAMINE (Invitrogen, Carlsbad, CA) with 100 ng of PXR plasmid, 100 ng of
reporter plasmid, and 10 ng of pRL-TK plasmid. After a 12-h incubation, the
transfected cells were treated with DDE at various concentrations for an
additional 24 h, washed once with phosphate-buffered saline, and collected.
The collected cells were subjected to two freeze-thaw cycles. The reporter
enzyme activities were assayed with a Dual-Luciferase Reporter Assay System
(Promega). The luminescence signal was internally normalized, and the ratio of
the normalized signal from DDE-treated cells over that from solvent-treated
cells was calculated and reported as a fold of activation. Assays to determine
the activation of CAR were performed as previously described by Kawamoto et
al. (2000
). HepG2 cells were
cultured in minimal essential medium (Sigma-Aldrich, St. Louis, Mo.) with 10%
fetal bovine serum (Atlanta Biologicals, Norcross, GA).
(NR1)5-tk-luciferase plasmid, pRL-SV40 and rat CAR plasmids were
cotransfected using the CellPhect Transfection Kit calcium phosphate
transfection method (Amersham Biosciences Inc., Piscataway, NJ). Cells were
treated with 1, 10, 25, or 50 µM DDE for 1 h, lysed, collected, and
measured for luciferase activity. Increased CAR activation resulted in
increased luciferase expression through increased NR1 enhancer element
activity. Luciferase activity was measured using the Dual-Luciferase Reporter
Assay System (Promega). Data were normalized to DMSO control values.
Statistics. All data are presented as means ± standard deviation. Significant differences were determined by analysis of variance (ANOVA) and pairwise comparisons by Fisher's least significant difference (p < 0.05). Significant differences between treated and control groups for PXR transcriptional transactivation activity were determined by Dunnett's test (p < 0.05).
| Results |
|---|
|
|
|---|
Immunoblot analysis demonstrated basal expression of CYP 3A1 and 2B1 proteins in the livers of adult male Sprague-Dawley rats (Fig. 2). Hepatic CYP 3A1 protein was higher in rats exposed to DDE, PB, or PCN compared with the levels in the control animals (Fig. 2A). Quantitative reverse transcriptase-PCR demonstrated that the amount of 3A1 mRNA was greater in treated animals than in controls (Fig. 2C). Levels of mRNA in the livers of rats exposed to DDE (100 mg/kg) were 11-fold greater than in controls, compared with 4.4- and 6.8-fold increases for PB (40 mg/kg) and PCN (40 mg/kg), respectively. Hepatic expression of 2B1 protein was higher in both DDE- and PB-treated rats compared with controls (Fig. 2B). The level of 2B1 mRNA was greater in the livers of DDE- and PB-treated animals compared with controls (Fig. 2D). The level of 2B1 mRNA was increased 130-fold in DDE-treated and 40-fold in PB-treated rats. PCN treatment did not affect either 2B1 protein or mRNA in rat liver (Fig. 2, B and D).
|
In cultured primary hepatocytes from male rats, the level of CYP 3A1 protein was increased in cells exposed to PB and to DDE at concentrations of 5 µM and 50 µM (Fig. 3A). The level of 3A1 mRNA was 8-fold higher at 5 µM DDE compared with controls (Fig. 3C). The 3A1 mRNA was increased 2.5- and 16-fold at 0.1 and 1.0 mM PB, respectively. However, the level of 3A1 protein appeared to be consistently lower in hepatocytes treated with 0.05 or 0.5 µM DDE than in the DMSO-treated cells (Fig. 3).
|
The level of CYP 2B1 protein and mRNA was increased in the primary hepatocytes treated with DDE at 5 µM and 50 µM (Fig. 3B). The level of 2B1 mRNA was increased 14-fold at 0.5 µM and 95-fold at the 5 µM DDE (Fig. 3D). The levels of 2B1 protein and mRNA were higher in PB-treated cells compared with the control. The level of 2B1 mRNA was increased 45- and 25-fold in cells treated with 0.1 mM and 1.0 mM PB, respectively.
To examine the effect of in utero and lactational exposure to DDE on perinatal hepatic enzyme expression, female Sprague-Dawley rats were exposed to dietary concentrations of 0, 2.5, 25, or 250 ppm DDE throughout pregnancy and lactation until pup weaning on PND 21. Pup exposure was largely limited to transplacental transfer during gestation and lactational exposure until postnatal day 14. In rats euthanized on postnatal day 14, hepatic expression of CYP 3A1 was significantly higher in pups from dams exposed to 25 or 250 ppm DDE as compared with pups from untreated dams (Fig. 4A). Hepatic expression of 2B1 was significantly increased in pups from the 2.5, 25, or 250 ppm DDE groups compared with pups from untreated dams (Fig. 4B). Additional F1 pups from each litter were shifted to regular diet at weaning on postnatal day 21 and maintained treatment free from postnatal day 21 to 90. Following the 69-day untreated recovery period, the expression of 3A1 remained elevated in the livers of rats exposed during gestation and lactation to maternally administered dietary DDE at concentrations of 2.5, 25, or 250 ppm compared with rats from untreated dams (Fig. 5A). No differences were observed in 2B1 expression between pups from treated and untreated dams following the same recovery period (Fig. 5B).
|
|
Immunoblot analysis showed that the expression of PXR in the livers of young adult male Sprague-Dawley rats was not altered after 7 days of treatment with DDE, PB, or PCN (Fig. 6A). However, the CAR protein level was lower in the liver tissue of rats treated with DDE, PB, or PCN compared with controls (Fig. 6B). In cultured hepatocytes, the level of PXR protein was not affected by DDE or PB treatment (Fig. 6C). No remarkable change in the level of CAR protein was seen in the primary hepatocytes treated with DDE, although its level appeared to be lower in the cells treated with 0.1 mM PB (Fig. 6D).
|
The ability of DDE to transactivate PXR and CAR was investigated in cells
transfected with CAR and PXR expression plasmids. Transactivation of PXR was
studied in COS7 cells transiently transfected with rat PXR and measured by
luciferase reporter gene expression. In DDE-treated cells, there was a
dose-dependent increase in PXR transactivation in the dose range of 1 to 50
µM (p < 0.05) (Fig.
7). PXR transactivation in cells exposed to 10 µM PCN, a known
PXR activator and CYP3A inducer (Kocarek
et al., 1995
; Moore and
Kliewer, 2000
), was far greater than that in DDE-treated cells.
The effect of DDE treatment on CAR activation was measured in the expression
of luciferase reporter gene in HepG2 cells transiently transfected with rat
CAR and an NR-1 reporter plasmid. In cells treated with DDE at 25 or 50 µM,
the transcriptional activity of CAR was significantly enhanced compared with
DMSO-treated cells (p < 0.05)
(Fig. 8). CAR transcriptional
activity was lower in cells treated with 20 or 50 µM PCN compared with
DMSO-treated controls (p < 0.05)
(Fig. 9), with 85 to 90%
transcriptional activity observed in cells treated with PCN in this dose
range.
|
|
|
A time-dependent change in nuclear translocation of CAR was observed through immunoblot analysis of nuclear fractions from the livers of DDE-treated male Sprague-Dawley rats. CAR protein was undetectable in liver nuclear extracts from untreated rats or 3 h after a single i.p. injection of 40 mg of DDE/kg (Fig. 10A). Nuclear presence of CAR became detectable at 6 h and, to a lesser extent at 24 h, after the injection of DDE. Higher content of CAR in the nucleus was also observed in rats at 6 h after an injection of PB at 100 mg/kg. No differences were observed in the level of PXR protein detected in nuclear fraction of liver tissue from DDE-treated rats of the different treatment groups (Fig. 10B).
|
| Discussion |
|---|
|
|
|---|
The expression of PXR protein in primary hepatocytes or in the livers of
male rats was not markedly affected by exposure to DDE, PB, or PCN. A
down-regulation of PXR expression was detectable in the livers of PB- and
PCN-treated rats. Similarly, the expression of hepatic CAR was decreased in
DDE-, PB-, and PCN-treated rats. Although the effects of xenobiotics on the
expression of CAR and PXR have not been extensively studied, it has been
demonstrated that the cytokine interleukin-6 down-regulates CAR and PXR
expression in primary human hepatocytes and decreases ligand-mediated
induction of CYP 2B and 3A enzyme expression (Pascussi et al.,
2000a
,b
).
In contrast, a different relationship was seen in the current study: the
expression of nuclear receptors was repressed, whereas the expression of their
target genes was enhanced. This relationship was seen in the cases of PXR with
CYP 3A1 in the PB- and PCN-treated rats and CAR with CYP 2B1 in the DDE-, PB-,
and PNC-treated rats (Fig. 6).
One possible explanation is that the levels of PXR and CAR might be affected
by interactions between the test compounds and glucocorticoid signals.
Glucocorticoids are known to change the expression of both CAR and PXR
(Pascussi et al.,
2000a
,b
).
Glucocorticoids also transactivate PXR, probably through recruiting a
transcriptional enhancer, CCAAT/enhancer binding protein
(Rodrigues et al., 2003
). In
vivo, DDE may have the potential to reduce the production of glucocorticoids
by inhibiting steroidogenesis in the adrenal
(Johansson et al., 2002
),
possibly resulting in repression of CAR and PXR expression. Phenobarbital is
also known to inhibit steroidogenesis. Repression of CAR and PXR, however, was
not observed in vitro in the current study.
The reduced CYP 3A1 in primary hepatocyte at low (submicromolar) DDE doses
(Fig. 3A) is similar to the
effect caused by another PXR agonist, mifepristone (RU486). The mechanism for
the reduction of 3A expression by PXR agonists at submicromolar dose range is
unclear (Pascussi et al.,
2003
). In our primary hepatocyte experiment, DEX was used in the
culture media at a concentration of approximately 25 nM. Since DEX is an
activator of PXR (Schuetz et al.,
2000
), a low dose of DDE may competitively inhibit DEX effects on
PXR, resulting in a decreased glucocorticoid effect on CYP 3A1 expression.
This inhibition could then be reversed when DDE reaches higher doses. Such
considerations regarding the potential role of glucocorticoid, however, are
not expected to affect the conclusion that DDE transactivates PXR and CAR and
induce CYP 2B1 and 3A1.
The characteristics of DDE transactivation of PXR and CAR are consistent
with other structurally diverse receptor activators that are regulators of CYP
2B and 3A families (Honkakoski et al.,
1998a
,b
;
Blizard et al., 2001
). CAR is
transcriptionally active in the absence of a ligand in cell-based assays
(Baes et al., 1994
;
Choi et al., 1997
;
Kawamoto et al., 1999
). In the
liver, CAR is sequestered in the cytoplasm of hepatocytes. Treatment with CAR
activators, such as phenobarbital or
1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, results in nuclear accumulation of
CAR in the hepatocytes (Kawamoto et al.,
1999
,
2000
;
Yoshinari et al., 2001
).
Disruption of nuclear translocation of CAR inhibits CAR-mediated regulation of
gene expression (Kawamoto et al.,
1999
). Therefore, nuclear translocation is an obligatory step for
CAR transactivation and CAR-mediated gene expression. Similar to previous
reports with PB, DDE caused nuclear accumulation of CAR within 6 h of dosing
that persisted for longer than 24 h
(Kawamoto et al., 1999
;
Yoshinari et al., 2001
).
Greater nuclear accumulation at 6 h than at 24 h after the DDE treatment is
consistent with the previously reported time course of nuclear accumulation of
CAR in PB-treated Wistar Kyoto rats
(Yoshinari et al., 2001
).
DDE-responsive nuclear accumulation of CAR, together with DDE-mediated CAR
transcriptional activation, suggests an interaction of DDE with CAR that is
similar to that of PB and other known CAR activators. DDE and PB treatment did
not result in detectable nuclear accumulation of PXR. Currently little is
known regarding the subcellular localization of PXR, which may differ from
that of CAR.
The manner in which DDE interacted with CAR was similar to that of PB,
whereas the interaction between DDE and PXR in inducing 3A1 was comparable to
that of PCN. The effects of DDE on CAR and PXR transactivation and CYP 3A1 and
2B1 expression indicate that DDE interacts with both CAR and PXR pathways.
Therefore, DDE belongs to the category of compounds that are common activators
of both CAR and PXR (Moore et al.,
2000
,
2002
).
Although DDE is not as potent as PCN in transactivating PXR, hepatic 3A1
mRNA levels were higher in DDE-treated rats than in PCN-treated rats. PXR
activity is known to correlate well with CYP 3A1 expression
(Moore and Kliewer, 2000
).
However, CAR and PXR can cross-regulate both 3A1 and 2B1 expression
(Honkakoski et al.,
1998a
,b
;
Xie et al., 2000b
;
Goodwin et al., 2001
). Our data
demonstrate that DDE activates both CAR and PXR and induces both CYP 3A1 and
2B1, whereas PCN activates PXR but not CAR and induces 3A1 but not 2B1. Thus,
the greater effects of DDE than of PCN on CYP 3A1 induction may be related to
cross-regulation of 3A1 through DDE-mediated activation of CAR.
Maternally administered DDE during gestation and lactation induced CYP 3A1
and 2B1 expression in the liver tissue of the offspring on postnatal day 14.
Induction of CYP 2B1 was observed at a lower dose of DDE (2.5 ppm) than 3A1
(25 ppm). Exposure to 2.5 ppm DDE is roughly equivalent to the World Health
Organization Daily Advisory Intake, which is 20 µg/kg/day of DDT, the
parent compound of DDE. This estimate is based on an assumption of an 80-kg
person consuming 800 g of food per day. Induction of 3A1 protein persisted
following cessation of lactational exposure on PND 21 and an untreated
recovery period of 69 days, whereas 2B1 protein expression returned to control
levels following the recovery period. The fact that DDE is slowly metabolized
and has a long half-life does not explain the more transient response in 2B1
expression. The current study indicated that CAR and PXR are likely targets
for environmental chemicals and that enzyme modulation may occur at dose
levels relevant to environmental exposure. CAR and PXR may function as
xenosensors with a broad range of ligands and regulate P450 enzymes and other
cellular modulators relevant to the metabolism of exogenous substrates
(Xie et al., 2000a
;
Moore et al., 2002
). In
addition to protecting the body against xenobiotics, there may be other
consequences associated with activating these receptors, however. Significant
induction of P450 enzymes by environmental chemicals may lead to activation of
protoxicants and alteration of the metabolism of drugs and endogenous
substances. In humans, the CYP3A family is responsible for the metabolism of
approximately 50% of all drugs (Thummel
and Wilkinson, 1998
), and chemical-drug interactions via induction
of metabolic enzymes may cause serious health consequences. Additionally, the
metabolism of endogenous substances, such as steroid hormones that are
substrates for CYP 3A1 and 2B1 and other hepatic enzymes, may affect normal
endocrine function via altered hormone biotransformation. PB, in this regard,
increases hepatic metabolism of androgens
(Elias and Gwinup, 1980
) while
inducing developmental abnormalities that reflect androgen deficiency
(Gupta et al., 1980
;
Dessens et al., 2001
). A
possible linkage between DDE effects on enzyme induction and its reproductive
effects deserves examination.
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: DDE,
1,1-dichloro-2,2-bis(p-chlorophenyl)ethylene; DDT,
1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane; AR, androgen receptor;
P450, cytochrome P450; PB, phenobarbital; PXR, pregnane X receptor; CAR,
constitutive androstane receptor; NR, nuclear receptor; PCN, pregnenolone
16-
-carbonitrile; PND, postnatal day; LDH, lactate dehydrogenase; DMSO,
dimethyl sulfoxide; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase
chain reaction; bp, base pair(s); ANOVA, analysis of variance; DEX,
dexamethasone.
Address correspondence to: Li You, Biological Sciences Division, CIIT Centers for Health Research, 6 Davis Drive, Research Triangle Park, NC 27709. E-mail: you{at}ciit.org
| References |
|---|
|
|
|---|
Baes M, Gulick T, Choi HS, Martinoli MG, Simha D, and Moore DD
(1994) A new orphan member of the nuclear hormone receptor
superfamily that interacts with a subset of retinoic acid response elements.
Mol Cell Biol 14:
15441551.
Blizard DT, Sueyoshi T, Negishi M, Dehal SS, and Kupfer D
(2001) Mechanism of induction of cytochrome p450 enzymes by the
proestrogenic endocrine disruptor pesticide-methoxychlor: interactions of
methoxychlor metabolites with the constitutive androstane receptor system.
Drug Metab Dispos 29:
781785.
Choi HS, Chung M, Tzameli I, Simha D, Lee YK, Seol W, and Moore DD
(1997) Differential transactivation by two isoforms of the orphan
nuclear hormone receptor CAR. J Biol Chem
272:
2356523571.
Dessens AB, Cohen-Kettenis PT, Mellenbergh GJ, Koppe JG, Poll NE, and Boer K (2001) Association of prenatal phenobarbital and phenytoin exposure with genital anomalies and menstrual disorders. Teratology 64: 181188.[CrossRef][Medline]
Elias AN and Gwinup G (1980) Effects of some clinically encountered drugs on steroid synthesis and degradation. Metabolism 29: 582595.[CrossRef][Medline]
Goodwin B, Moore LB, Stoltz CM, McKee DD, and Kliewer SA
(2001) Regulation of the human CYP2B6 gene by the nuclear
pregnane X receptor. Mol Pharmacol
60:
427431.
Gupta C, Shapiro BH, and Yaffe SJ (1980) Reproductive dysfunction in male rats following prenatal exposure to phenobarbital. Pediatr Pharmacol 1: 5562.
Gupta C, Yaffe SJ, and Shapiro BH (1982) Prenatal
exposure to phenobarbital permanently decreases testosterone and causes
reproductive dysfunction. Science (Wash DC)
216:
640642.
Honkakoski P, Moore R, Washburn KA, and Negishi M
(1998a) Activation by diverse xenochemicals of the 51-base pair
phenobarbital-responsive enhancer module in the CYP2B10 gene. Mol
Pharmacol 53:
597601.
Honkakoski P, Zelko I, Sueyoshi T, and Negishi M
(1998b) The nuclear orphan receptor CAR-retinoid X receptor
heterodimer activates the phenobarbital-responsive enhancer module of the
CYP2B gene. Mol Cell Biol
18:
56525658.
Johansson MK, Sanderson JT, and Lund BO (2002) Effects of 3-MeSO2-DDE and some CYP inhibitors on glucocorticoid steroidogenesis in the H295R human adrenocortical carcinoma cell line. Toxicol In Vitro 16: 113121.[CrossRef][Medline]
Kawamoto T, Kakizaki S, Yoshinari K, and Negishi M
(2000) Estrogen activation of the nuclear orphan receptor CAR
(constitutive active receptor) in induction of the mouse Cyp2b10 gene.
Mol Endocrinol 14:
18971905.
Kawamoto T, Sueyoshi T, Zelko I, Moore R, Washburn K, and Negishi M
(1999) Phenobarbital-responsive nuclear translocation of the
receptor CAR in induction of the CYP2B gene. Mol Cell
Biol 19:
63186322.
Kelce WR, Stone CR, Laws SC, Gray LE, Kemppainen JA, and Wilson EM (1995) Persistent DDT metabolite p,p'-DDE is a potent androgen receptor antagonist. Nature (Lond) 375: 581585.[CrossRef][Medline]
Kliewer SA, Moore JT, Wade L, Staudinger JL, Watson MA, Jones SA, McKee DD, Oliver BB, Willson TM, Zetterstrom RH, et al. (1998) An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell 92: 7382.[CrossRef][Medline]
Kocarek TA, Schuetz EG, Strom SC, Fisher RA, and Guzelian PS (1995) Comparative analysis of cytochrome P4503A induction in primary cultures of rat, rabbit, and human hepatocytes. Drug Metab Dispos 23: 415421.[Abstract]
Moore JT and Kliewer SA (2000) Use of the nuclear receptor PXR to predict drug interactions. Toxicology 153: 110.[CrossRef][Medline]
Moore LB, Maglich JM, McKee DD, Wisely B, Willson TM, Kliewer SA,
Lambert MH, and Moore JT (2002) Pregnane X receptor (PXR),
constitutive androstane receptor (CAR), and benzoate X receptor (BXR) define
three pharmacologically distinct classes of nuclear receptors. Mol
Endocrinol 16:
977986.
Moore LB, Parks DJ, Jones SA, Bledsoe RK, Consler TG, Stimmel JB,
Goodwin B, Liddle C, Blanchard SG, Willson TM, et al. (2000)
Orphan nuclear receptors constitutive androstane receptor and pregnane X
receptor share xenobiotic and steroid ligands. J Biol
Chem 275:
1512215127.
Nims RW and Lubet RA (1995) Induction of cytochrome P-450 in the Norway rat, Rattus norvegicus, following exposure to potential environmental contaminants. J Toxicol Environ Health 46: 271292.[Medline]
Pascussi JM, Gerbal-Chaloin S, Drocourt L, Maurel P, and Vilarem MJ (2003) The expression of CYP2B6, CYP2C9 and CYP3A4 genes: a tangle of networks of nuclear and steroid receptors. Biochim Biophy Acta 1619: 143153.
Pascussi J, Gerbal-Chaloin S, Pichard-Garcia L, Fabre J, Maurel P,
and Vilarem M (2000a) Dexamethasone induces pregnane X receptor
and retinoid X receptor-a expression in human hepatocytes: synergistic
increase of CYP3A4 induction by pregnane X receptor activators. Mol
Pharmacol 58:
361372.
Pascussi J, Gerbal-Chaloin S, Pichard-Garcia L, Fabre J, Maurel P, and Vilarem M (2000b) Dexamethasone enhances constitutive androstane receptor expression in human hepatocytes: consequences on cytochrome P450 gene regulation. Mol Pharmacol 58: 14411450.
Rodrigues E, Vilarem MJ, Ribeiro V, Maurel P, and Lechner MC (2003) Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus. Potential role in the glucocorticoid response. Eur J Biochem 270: 556564.[Medline]
Schuetz EG, Schmid W, Schutz G, Brimer C, Yasuda K, Kamataki T,
Bornheim L, Myles K, and Cole TJ (2000) The glucocorticoid
receptor is essential for induction of cytochrome P-4502B by steroids but not
for drug or steroid induction of CYP3A or P-450 reductase in mouse liver.
Drug Metab Dispos 28:
268278.
Thummel KE and Wilkinson GR (1998) In vitro and in vivo drug interactions involving human CYP3A. Annu Rev Pharmacol Toxicol 38: 389430.[CrossRef][Medline]
Waxman DJ and Azaroff L (1992) Phenobarbital induction of cytochrome P-450 gene expression. Biochem J 281: 577592.
Wei P, Zhang J, Dowhan DH, Han Y, and Moore DD (2002) Specific and overlapping functions of the nuclear hormone receptors CAR and PXR in xenobiotic response. Pharmacogenomics J 2: 117126.[CrossRef][Medline]
Xie W, Barwick JL, Downes M, Blumberg B, Simon CM, Nelson MC, Neuschwander-Tetri BA, Brunt EM, Guzelian PS, and Evans RM (2000a) Humanized xenobiotic response in mice expressing nuclear receptor SXR. Nature (Lond) 406: 435439.[CrossRef][Medline]
Xie W, Barwick JL, Simon CM, Pierce AM, Safe S, Blumberg B,
Guzelian PS, and Evans RM (2000b) Reciprocal activation of
xenobiotic response genes by nuclear receptors SXR/PXR and CAR.
Genes Dev 14:
30143023.
Yoshinari K, Sueyoshi T, Moore R, and Negishi M (2001)
Nuclear receptor CAR as a regulatory factor for the sexually dimorphic
induction of CYB2B1 gene by phenobarbital in rat livers. Mol
Pharmacol 59:
278284.
You L, Casanova M, Aarchibeque-Engle S, Sar M, Fan LQ, and Heck HA
(1998) Impaired male sexual development in perinatal
Sprague-Dawley and Long-Evans hooded rats exposed in utero and lactationally
to p,p'-DDE. Toxicol Sci
45:
162173.
You L, Chan SK, Bruce JM, Archibeque-Engle S, Casanova M, Corton JC, and Heck H (1999) Modulation of testosterone-metabolizing hepatic cytochrome P-450 enzymes in developing Sprague-Dawley rats following in utero exposure to p,p'-DDE. Toxicol Appl Pharmacol 158: 197205.[CrossRef][Medline]
You L, Sar M, Bartolucci E, Ploch S, and Whitt M (2001) Induction of hepatic aromatase by p,p'-DDE in adult male rats. Mol Cell Endocrinol 178: 207214.[CrossRef][Medline]
Zhang H, LeCluyse E, Liu L, Hu M, Matoney L, Zhu W, and Yan B (1999) Rat pregnane X receptor: molecular cloning, tissue distribution, and xenobiotic regulation. Arch Biochem Biophys 368: 1422.[CrossRef][Medline]
Zhu W, Song L, Zhang H, Matoney L, LeCluyse E, and Yan B
(2000) Dexamethasone differentially regulates expression of
carboxylesterase genes in humans and rats. Drug Metab
Dispos 28:
186191.
This article has been cited by other articles:
![]() |
N. Kiyosawa, J. C. Kwekel, L. D. Burgoon, K. J. Williams, C. Tashiro, B. Chittim, and T. R. Zacharewski o,p'-DDT Elicits PXR/CAR-, Not ER-, Mediated Responses in the Immature Ovariectomized Rat Liver Toxicol. Sci., February 1, 2008; 101(2): 350 - 363. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. Hernandez, W. Huang, L. M. Chapman, S. Chua, D. D. Moore, and W. S. Baldwin The Environmental Estrogen, Nonylphenol, Activates the Constitutive Androstane Receptor Toxicol. Sci., August 1, 2007; 98(2): 416 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. B. Okey An Aryl Hydrocarbon Receptor Odyssey to the Shores of Toxicology: The Deichmann Lecture, International Congress of Toxicology-XI Toxicol. Sci., July 1, 2007; 98(1): 5 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsubara, W. Noracharttiyapot, T. Toriyabe, K. Yoshinari, K. Nagata, and Y. Yamazoe Assessment of Human Pregnane X Receptor Involvement in Pesticide-Mediated Activation of CYP3A4 Gene Drug Metab. Dispos., May 1, 2007; 35(5): 728 - 733. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. Medina-Diaz, G. Arteaga-Illan, M. B. de Leon, B. Cisneros, A. Sierra-Santoyo, L. Vega, F. J. Gonzalez, and G. Elizondo Pregnane X Receptor-Dependent Induction of the CYP3A4 Gene by o,p'-1,1,1,-Trichloro-2,2-Bis (p-Chlorophenyl)ethane Drug Metab. Dispos., January 1, 2007; 35(1): 95 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sakai, H. Iwata, E.-Y. Kim, O. Tsydenova, N. Miyazaki, E. A. Petrov, V. B. Batoev, and S. Tanabe Constitutive Androstane Receptor (CAR) as a Potential Sensing Biomarker of Persistent Organic Pollutants (POPs) in Aquatic Mammal: Molecular Characterization, Expression Level, and Ligand Profiling in Baikal Seal (Pusa sibirica) Toxicol. Sci., November 1, 2006; 94(1): 57 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Faucette, T. Sueyoshi, C. M. Smith, M. Negishi, E. L. LeCluyse, and H. Wang Differential Regulation of Hepatic CYP2B6 and CYP3A4 Genes by Constitutive Androstane Receptor but Not Pregnane X Receptor J. Pharmacol. Exp. Ther., June 1, 2006; 317(3): 1200 - 1209. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lemaire, W. Mnif, J.-M. Pascussi, A. Pillon, F. Rabenoelina, H. Fenet, E. Gomez, C. Casellas, J.-C. Nicolas, V. Cavailles, et al. Identification of New Human Pregnane X Receptor Ligands among Pesticides Using a Stable Reporter Cell System Toxicol. Sci., June 1, 2006; 91(2): 501 - 509. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Tabb and B. Blumberg New Modes of Action for Endocrine-Disrupting Chemicals Mol. Endocrinol., March 1, 2006; 20(3): 475 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Wyde, S. E. Kirwan, F. Zhang, A. Laughter, H. B. Hoffman, E. Bartolucci-Page, K. W. Gaido, B. Yan, and L. You Di-n-Butyl Phthalate Activates Constitutive Androstane Receptor and Pregnane X Receptor and Enhances the Expression of Steroid-Metabolizing Enzymes in the Liver of Rat Fetuses Toxicol. Sci., August 1, 2005; 86(2): 281 - 290. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Mu, C. R. J. Stephenson, C. Kendall, S. P. S. Saini, D. Toma, S. Ren, H. Cai, S. C. Strom, B. W. Day, P. Wipf, et al. A Pregnane X Receptor Agonist with Unique Species-Dependent Stereoselectivity and Its Implications in Drug Development Mol. Pharmacol., August 1, 2005; 68(2): 403 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
|