|
|
|
|
Pharmaceutical Research Laboratory, Kirin Brewery Co., Gunma, Japan (H.O., Y.Y., T.W., M.Y., M.S., R.S., H.M., T.S., T.N.); Laboratory of Signal Transduction, Institute for Molecular and Cellular Regulation, Gunma University, Maebashi, Japan (K.S., N.M., A.D., E.M., J.K., T.K., M.T., H.T., F.O.); Laboratory of Pharmacology, College of Pharmacy, Pusan National University, Busan, Republic of Korea (D.I.); and Department of Microbiology, Faculty of Pharmaceutical Sciences, Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido, Japan (H.N., K.T.)
Received December 16, 2002; accepted July 16, 2003
| Abstract |
|---|
|
|
|---|
LPA3 » LPA2, whereas DGPP 8:0 preferentially inhibited the LPA3-induced actions. Ki16425 inhibited LPA-induced guanosine 5'-O-(3-thio)triphosphate binding as well as LPA receptor binding to membrane fractions with a same pharmacological specificity as in intact cells. The difference in the inhibition profile of Ki16425 and DGPP 8:0 was exploited for the evaluation of receptor subtypes involved in responses to LPA in A431 cells. Finally, Ki16425 also inhibited LPA-induced long-term responses, including DNA synthesis and cell migration. In conclusion, Ki16425 selectively inhibits LPA receptor-mediated actions, especially through LPA1 and LPA3; therefore, it may be useful in evaluating the role of LPA and its receptor subtypes involved in biological actions.
was recently demonstrated (McIntyre et al., 2003
Receptor antagonists are very useful tools for evaluating the role of LPA and its receptors in biological actions and for controlling specific diseases (Tigyi, 2001
). Based on their ability to inhibit Ca2+ response to LPA in A431 cells or LPA-responsive cells, we have screened 150,000 low-molecular-weight compounds developed by the Kirin Brewery Co. Ltd, for LPA receptor antagonists, and found that some isoxazole derivatives showed such an inhibitory activity against the LPA action. We therefore synthesized several isoxazole derivatives and finally selected Ki16425 as the best candidate compound (Ueno et al., 2001
). In the present study, we examined the pharmacological properties of Ki16425 and compared it with that of DGPP 8:0, a recently identified LPA antagonist (Fischer et al., 2001
). We found that Ki16425 inhibited LPA-induced actions in a manner highly specific to LPA and LPA receptor subtypes. Such differences in the selectivity of Ki16425 and DGPP 8:0 were successfully applied to discriminate the receptor subtypes in A431 cells. Thus, the novel antagonist Ki16425 seems to be a useful tool for investigating physiological and pathophysiological roles of LPA and its receptors.
| Materials and Methods |
|---|
|
|
|---|
-lysophosphatidylcholine palmitoyl (C16:0), L-
-lysophosphatidylcholine
-acetyl-
-O-alkyl (PAF), and 1-
-D-galactosylsphingosine (psychosine) were purchased from Sigma-Aldrich (St. Louis, MO); sphingosine 1-phosphate (S1P) was from Cayman Chemical Co. (Ann Arbor, MI); sphingosylphosphorylcholine (SPC) was from BIOMOL Research Laboratories, Inc. (Plymouth Meeting, PA); 2-arachidonoylglycerol and fatty acid-free BSA (Fraction V) were from Calbiochem-Novabiochem Co. (San Diego, CA); dioctyl glycerol pyrophosphate (DGPP 8:0) was from Avanti Polar Lipids, Inc. (Alabaster, AL); Fura 2/AM was from Dojindo (Tokyo, Japan); PTX was from List Biological Laboratories, Inc. (Campbell, CA); [myo-2-3H]inositol (23.0 Ci/mmol) was from American Radiolabeled Chemicals, Inc. (St. Louis, MO); [35S]GTP
S (1,200 Ci/mmol) was from Amersham Biosciences, Inc. (Piscataway, NJ); and [3H]LPA (48 Ci/mmol) was from PerkinElmer Life Science Products, Inc. (Boston, MA). Ki16425 was synthesized by Kirin Brewery Co. (Takasaki, Japan), and its chemical structure is shown in Fig. 1.
|
Preparation of LPA Receptor cDNA Plasmids and Expression. The entire coding regions of LPA1 (1,095 bp, GenBank accession number Y09479
[GenBank]
), LPA2 (1,149 bp, GenBank accession number AF011466
[GenBank]
), and LPA3 (1,148 bp, GenBank accession number AF127138
[GenBank]
) were amplified from human cDNA library by RT-PCR. The respective amplified fragment was subcloned into the EcoRI site of pEFneo eukaryotic expression vector (Kon et al., 1999
; Sato et al., 2000
), and each DNA sequence was confirmed. The primers used for the RT-PCR were as follows. The 5'primers contained an EcoRI site, a Kozak sequence (CCACC), and the N-terminal region of the respective receptor. The 3'-primers contained an EcoRI site and a stop codon in addition to the C-terminal region of the respective receptor. CHO cells or RH7777 cells were transfected with pEFneo empty vector alone or the pEFneo vector containing human LPA1, human LPA2, or human LPA3 by electroporation, and the neomycin-resistant cells (G418 sulfate at 1 mg/ml for CHO cells and 0.3 mg/ml for RH7777 cells) were selected. CHO cells resistant to G-418 were used in bulk, whereas RH7777 cells expressing the different LPA receptor subtypes were cloned by limiting dilution. Subsequently, clonal RH7777 cells expressing human LPA2 (C3) and human LPA3 (C5) were isolated. However, in the early stages of the experiments, we were unable to obtain stable human LPA1 RH7777 cells; therefore, we used a stable mouse LPA1-expressing clone of RH7777 cells, which was provided by Prof. Kevin R. Lynch of the University of Virginia School of Medicine (Im et al., 2000
). Human LPA1 cDNA was also subcloned into the HindIII/BamHI site of pcDNA3. Human and mouse orthologs of LPA1 subcloned into pcDNA3 vector (Im et al., 2000
), provided by Prof. Kevin R. Lynch, were transfected into HEK293T cells.
Cell Culture. THP-1, HL-60, and A431 cells were cultured in RPMI 1640 media supplemented with 10% (v/v) FBS (Sigma) (Okajima and Kondo, 1995
); Swiss 3T3 fibroblasts, S1P receptor-transfected CHO cells (Kon et al., 1999
), and LPA receptor-transfected CHO cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) FBS; and LPA receptor-transfected RH7777 cells and HEK293T cells were cultured in minimum essential medium supplemented with 10% (v/v) FBS. FRTL-5 thyroid cells and PC-12 cells were cultured as described previously (Sho et al., 1991
; Sato et al., 1997
). For cAMP assay, RH7777 cells were plated to dishes coated with rat tail collagen (400 µg/ml). Twenty-four hours before experiments, the medium was replaced with serum-free medium as specified containing 0.1% (w/v) BSA (fraction V). In the case of the inositol phosphate response, the medium was changed to TCM199 medium containing 20 µCi of [3H]inositol (in 6 ml) and 0.1% (w/v) BSA (fraction V). Where indicated, PTX (100 ng/ml) or its vehicle (final 2 mM urea) was added to the culture medium 24 h before experiments.
As for GTP
35S binding and [3H]LPA binding assays, each receptor plasmid DNA (6 µg) encoding mouse LPA1, human LPA1, human LPA2, or human LPA3 was mixed with plasmids encoding the C352G rat mutant of Gi2
(6 µg), bovine
1(6 µg), and
2 subunits (6 µg) (Tomura et al., 1997
), and transfected into HEK293T cells using calcium phosphate precipitate method (Im et al., 2000
). After 24 h, the medium was changed to fresh minimum essential medium supplemented with 10% (v/v) FBS and cells were cultured for an additional 24 h. The cells were maintained for about 6 h in the fresh medium (without serum) containing 0.1% (w/v) BSA (fraction V), and membranes were prepared as described previously (Kon et al., 1999
).
Measurements of [Ca2+]i. THP-1 and HL-60 cells were harvested by centrifugation (250g). RH7777 cells transfected with LPA receptors were washed with Ca2+- and Mg2+-free phosphate-buffered saline containing 4 mM EGTA at 37°C for
5 to 10 min and then harvested. Other cells were harvested with trypsin (0.05%) after washing with Ca2+- and Mg2+-free phosphate-buffered saline containing 4 mM EGTA. The cells were centrifuged at 250g, and pelleted cells were resuspended in Ham's 10 medium containing 0.1% BSA and incubated with 1 µM Fura 2/AM for 20 min. The cells were washed twice and resuspended in the HEPES-buffered medium. The HEPES-buffered medium was composed of 20 mM HEPES, pH 7.4, 134 mM NaCl, 4.7 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4, 2 mM CaCl2, 2.5 mM NaHCO3, 5 mM glucose, and 0.1% (w/v) BSA (fraction V). [Ca2+]i was estimated from the change in the fluorescence of the Fura 2-loaded cells, as described previously (Okajima et al., 1998
; Kon et al., 1999
). Unless otherwise stated, the cells were incubated for 1 min in the presence or absence of Ki16425 or DGPP 8:0, and indicated agonists were added to the incubation medium to monitor [Ca2+]i. The net [Ca2+]i change (peak value - basal value) at around 15 s was calculated.
Inositol Phosphate Production. Assays were performed essentially as described previously (Murata et al., 2000
). The cells were incubated for 1 min with or without test agents, and the inositol phosphates (sum of inositol bisphosphate and inositol trisphosphate) were measured. The results were normalized to 105 dpm of the total radioactivity incorporated into the cellular inositol lipids, and the radioactivity of trichloroacetic acid (5%)-insoluble fraction was considered as the total radioactivity.
cAMP Accumulation. The cells were washed once and preincubated for 10 min at 37°C in HEPES-buffered medium. FRTL-5 thyroid cells were incubated with LPA or other agonists in the presence or absence of Ki16425. Forskolin (10 µM), 100 µM Ro20-1724, and 0.5 units/ml adenosine deaminase were added to the medium. S1P1-transfected CHO cells were similarly incubated with test agents. In this case, the incubation medium contained 10 µM forskolin and 0.5 mM 3-isobutyl-1-methylxanthine. After a 10-min incubation, the reaction was terminated by adding 100 µl of 1 N HCl, and cyclic AMP was measured as described previously (Sho et al., 1991
).
GTP
35S Binding. Binding assay was performed by incubating the membranes with 0.1 nM GTP
35S (
2 x 105 dpm/ml) for 30 min at 30°C, as described previously (Im et al., 2000
).
[3H]LPA Binding. Membrane protein (40 µg) was incubated in 0.4 ml of the binding buffer (50 mM HEPES, 100 mM NaCl, 5 mM MgCl2, pH 7.5) containing 25 µg/ml of saponin, 0.05% BSA, 0.5 mM Na3VO4, 5 nM [3H]LPA (48 Ci/mmol), and different concentrations of Ki16425 and LPA for 60 min at 4°C. The reaction was terminated and binding activity was measured as for GTP
35S binding assay. Nonspecific binding was determined in the presence of 10 µM unlabeled LPA.
RNA Extraction and Northern Blot Analysis. Total RNA was prepared from the cells using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Total RNA (20 µg) was electrophoresed in a 1% agarose gel containing 3.7% formaldehyde in 20 mM MOPS buffer, and blotted to a nylon membrane (Hybond-N) with 20x standard saline citrate. The probes (20 ng) were labeled with [
-32P]dATP by random oligonucleotide priming and added to the blots at a concentration of about 5 x 106 dpm in 5 ml of hybridization buffer. The hybridization was carried out at 60°C. After hybridization, the blots were washed at 60°C with 0.2x standard saline citrate and 0.1% SDS, as described previously (Sato et al., 1999
).
RT-PCR Analysis. Single-strand DNA was synthesized using the SUPERSCRIPT II kit (Invitrogen). To ensure that no genomic DNA contamination was present, the reaction was performed in parallel without reverse transcriptase. The product was then subjected to amplification by PCR. Degenerate DNA primers were based on the cDNA sequences of the human LPA1 (GenBank accession number Y09479
[GenBank]
), human LPA2 (GenBank accession number AF011466
[GenBank]
), and human LPA3 (GenBank accession number AF127138
[GenBank]
), according to the previous study (Pages et al., 2001
) with slight modifications. The primers for LPA4 were synthesized according to the cDNA sequence of the human GRP23 (GenBank accession number NM005296). The primers used were: LPA1: forward, 5'-682ATCTTTGGCTATGTTCGCCA701-3'; reverse, 5'-1076TTGCTGTGAACTCCAGCCA1058-3; LPA2, forward, 5'-248TGGCCTACCTCTTCCTCATGTTCCA272-3'; reverse, 5'-716AGGCTGAGCGTGGTCTCTCGGTAGC692-3'; LPA3: forward, 5'-51AGTGTCACTATGACAAGC67-3'; reverse, 5'-563GAGATGTTGCAGAGGC548-3'; and LPA4: forward, 5'-567TGAAGGCTTCTCCAAACGTGTCTG590-3'; reverse, 5'-909GTTCAGAGTTGCAAGGCACAAGGT886-3'. The primer sequences in these regions were identical for the human and mouse, except for the reverse primer of mouse LPA2, which was 5'-AGGCTGAGTGTGGTCTCTCGGTAGC-3'. Primers for the human orthologs were effective for amplification of mouse (3T3 fibroblasts) and rat (PC-12 cells) LPA2 cDNA. Each PCR was carried out using 2.5 units of Taq DNA polymerase and 1 µl of reverse transcriptase reaction product in a 50-µl reaction mixture containing 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 200 µM dNTP, and 10 pmol of each primer. An extended denaturation at 94°C for 3 min was followed by 30 cycles, consisting of denaturation at 94°C for 45 s, annealing at 50°C (LPA1), 50°C (LPA2), 47°C (LPA3), and 52°C (LPA4) for 30 s, and elongation at 72°C for 1 min. After final extension at 72°C for 10 min, the PCR products were analyzed by agarose gel electrophoresis.
DNA Synthesis. Swiss 3T3 fibroblasts were pretreated for 10 min with Ki16425 in fresh Dulbecco's modified Eagle's medium containing 0.1% BSA and then cultured for 20 h with LPA, S1P, or PDGF, and with [3H]thymidine (0.5 µCi in 1 ml) for another 4 h. The radioactivity in trichloroacetic acid-insoluble fraction was measured as described previously (Kimura et al., 2000
).
Cell Migration. The migration experiment was performed using a Boyden chamber apparatus (Neuro Probe Inc., Gaithersburg, MD) as described previously (Tamama et al., 2001
). Cells remaining on the upper surface of the filters were removed, and the filters were then fixed in methanol and stained with Diff-Quik Solution II (International Reagents Corp., Kobe, Japan). The number of cells that had migrated to the lower surface was determined by counting the cells in four microscopic fields at 400x magnification.
Calculation of Ki Value. The Ki values for Ki16425 or DGPP 8:0 were estimated from inositol phosphate responses or Ca2+ responses, based on the following equation: Ki = (EC50 x B)/(EC50' - EC50), where B is the concentration of Ki16425 or DGPP 8:0, and EC50 and EC50' are the half-maximal effective concentration of LPA in the absence and presence of the antagonist, respectively. The half-maximal effective concentration was estimated as a value that graphically gives a 50% maximal response, unless otherwise specified. With regard to the Schild regressions, the half-maximal effective concentration was estimated from the Scatchard plots. The Ki value was determined by plotting the log of Dose Ratio-1 at each concentration of Ki16425 against the log concentration of Ki16425. The x-intercept of the linear transformation equals the inverse log of the Ki.
Statistical Analysis. All experiments were performed in duplicate or triplicate, and the results of multiple observations were presented as means ± S.E. of at least three independent experiments, unless otherwise stated. Statistical significance was assessed by Student's t test and values were considered significant at p < 0.05.
| Results |
|---|
|
|
|---|
0.1 to 1 µM concentration range of LPA. In all cases, Ki16425 showed a competitive inhibition pattern, and Ki values were estimated to be 0.34 µM for LPA1, 6.5 µM for LPA2, and 0.93 µM for LPA3, as shown in Table 1. A similar selectivity of Ki16425 was observed to the Ca2+ responses in RH7777 cells expressing the different receptor subtypes (data not shown).
|
|
|
S binding assays in membranes prepared from HEK293T cells transfected with cDNAs encoding the LPA receptors and G-protein subunits. In this experiment, we also compared the effects of Ki16425 on the mouse and human orthologs of LPA1. As shown in Fig. 3, LPA receptor transfection introduced an increase in GTP
S binding activity in response to LPA. Consistent with a previous study (Im et al., 2000
Next, we examined the effect of Ki16425 on LPA receptor ligand binding. Because of the high nonspecific binding to the membranes and uncharacterized (specific) binding of LPA, even in vector-transfected cell membranes, we were unable to obtain saturation curves for LPA binding. Nevertheless, specific LPA binding at 5 nM was increased after transfection of LPA1 or LPA2 (Fig. 4A), but not of LPA3 transfection (see legend to Fig. 4). Ki16425 at 10 µM clearly inhibited the LPA-specific binding in LPA1-expressing cell membranes and slightly inhibited it in LPA2-expressing cell membrane, whereas there was no detectable effect in membranes from vector-transfected cells (Fig. 4A). We tentatively attributed the increment in specific binding resulting from the receptor transfection to LPA receptor-dependent binding activity. The dose-dependent effect of Ki16425 on LPA receptor-dependent binding is shown in Fig. 4B. Ki16425 was 20 to 30 times more potent for LPA1 than for LPA2, and the Ki values were estimated to be 0.67 µM for LPA1 and 21.4 µM for LPA2, which were close to those estimated from the inositol phosphate responses and GTP
S binding (Table 1). In summary, Kil6425 preferentially inhibited LPA1- and LPA3-mediated responses but had only a moderate effect on LPA2.
|
Ki16425 Inhibition Is Selective for LPA Receptors. To investigate the compound's specificity and usefulness as an antagonist of LPA receptor, we applied Ki16425 to a variety of cell types and measured several cellular responses (Table 2 and Figs. 5, 6, 7). The dose-dependent [Ca2+]i increase elicited by LPA in THP-1 cells (Fig. 5A) and in 3T3 fibroblasts (Fig. 5B) was inhibited by Ki16425 in a competitive manner: the Ki value was estimated to be 0.17 µM in THP-1 and 0.54 µM in 3T3 fibroblasts. Likewise, in A431 cells, the LPA response was markedly inhibited by Ki16425 (Table 2). Thus, Ki16425 is a potent and reversible antagonist (Fig. 5C). In this experiment, 3T3 fibroblasts were incubated with or without 10 µM Ki16425 for the last 1 or 10 min during labeling time with Fura2/AM, the cells were washed with fresh medium three times, and the Ca2+ response to LPA was measured in the presence or absence of Ki16425. There was no significant effect of the pretreatment with Ki16425 on the LPA action, indicating that the compound could be washed out without leaving residual inhibition.
|
|
|
|
|
In PC-12 cells, Ki16425 had only a small, although significant, inhibitory effect on the Ca2+ response to LPA. In HL-60 cells, a small but significant [Ca2+]i increase by LPA was insensitive to Ki16425 (Table 2). Thus, Ki16425 inhibited the LPA-induced Ca2+ response in THP-1 cells, 3T3 fibroblasts, and A431 cells, but had only a marginal effect in PC-12 cells and HL-60 cells. On the other hand, the Ca2+ responses to ATP, PAF, and SPC in THP-1 cells, PDGF and S1P in 3T3 fibroblasts, EGF and PAF in A431 cells, and SPC, lysophosphatidylcholine, psychosine, and 2-arachidonoylglycerol in HL-60 cells were not significantly inhibited by Ki16425 (Table 2).
Figure 6 shows the effect of Ki16425 on the inositol phosphate response. This LPA-induced response in 3T3 fibroblasts (Fig. 6A) and A431 cells (Fig. 6C) was inhibited by Ki16425, and the mode of Ki16425 inhibition was consistent with competitive inhibition in 3T3 fibroblasts (the Ki value was 0.68 µM). In contrast, the responses to S1P in 3T3 fibroblasts (Fig. 6A, right), S1P3-expressing CHO cells, and S1P2-expressing CHO cells (Fig. 6B) were insensitive to Ki16425. Similarly, the response to PAF and bradykinin was not significantly affected by the inhibitor (Fig. 6C).
Figure 7 shows the effects of Ki16425 on the inhibition of the forskolin-induced cAMP accumulation in response to LPA and phenylisopropyladenosine, an A1 adenosine receptor agonist, and S1P. LPA inhibited cAMP accumulation in FRTL-5 thyroid cells in a PTX-sensitive manner (Fig. 7A), suggesting a Gi-mediated inhibition of the LPA action. This inhibition by LPA was significantly suppressed by Ki16425 even at 0.1 µM and almost completely at 10 µM. However, the phenylisopropyladenosine-induced inhibition was insensitive to even 10 µM Ki16425, although the inhibition was PTX-sensitive in the same cells (Fig. 7B), thus ruling out the possibility that Ki16425 might act on Gi-proteins. Likewise, the inhibition of cAMP accumulation by S1P in S1P1-expressing CHO cells was hardly affected by Ki16425 (Fig. 7C), and this S1P action was also reversed by PTX treatment (data not shown).
In summary, Ki16425 was found to specifically inhibit LPA-induced response without any appreciable effect on responses to other receptor agonists. However, the extent of the LPA-induced inhibition seemed to depend on the cell types; the inhibition was marginal in PC-12 cells and undetectable in HL-60 cells.
Differential Expression of LPA Receptor Subtypes May Explain the Susceptibility to Ki16425. mRNA expression of LPA receptor subtypes in the cells used (Figs. 5, 6, 7) was examined by Northern blotting and RT-PCR methods. Some of the results are summarized in Table 2. As seen in Fig. 8, A431 cells express all subtypes of EDG-family LPA receptor mRNAs but not LPA4/GPR23 mRNA; 3T3 fibroblasts and THP-1 cells express LPA1, LPA2, and LPA4 mRNAs; HL-60 cells express LPA2 and LPA4 mRNAs; FRTL-5 cells express LPA1 mRNA as a major band; and PC-12 cells express LPA2 mRNA as a major band. Although the size of LPA2 mRNA differed among the cell types, as shown by Northern blotting (Fig. 8A), a single band with a similar size was amplified by RT-PCR (Fig. 8B). This suggests the heterogeneity of LPA2 mRNA, possibly because of alternative splicing (An et al., 1998a
,b
). In the case of LPA3, a trace band with almost the same size as the band in A431 cells was detected in HL-60 and THP-1 cells by Northern blotting (Fig. 8A); however, no specific band was amplified by RT-PCR. Thus, the expression of LPA3 mRNA in HL-60 and THP-1 cells could not be confirmed. LPA1 mRNA was detected in Ki16425-sensitive A431 cells, FRTL-5 cells, 3T3 fibroblasts, and THP-1 cells. On the other hand, LPA2 and/or LPA4 were detected in Ki16425-insensitive or less-sensitive HL-60 cells and PC-12 cells as major bands (Fig. 8 and Table 2). Thus, cell sensitivity to Ki16425 seems to reflect the differential expression of LPA receptor subtypes, especially LPA1, and Ki16425 seems to be a useful tool for evaluating the involvement of specific LPA receptors in the short-term response to LPA.
Ki16425 Inhibits Long-Term DNA Synthesis and Cell Migration As Induced by LPA. We next examined whether Ki16425 was applicable for inhibiting long-term responses including DNA synthesis (24 h) and cell migration (4 h). As shown in Fig. 9A, the LPA-induced DNA synthesis in 3T3 fibroblasts was markedly inhibited by 1 µM Ki16425, but those induced by S1P and PDGF were not appreciably affected at this concentration of the compound. Significant inhibition of the LPA-induced action by Ki16425 was observed at
0.01 to 0.1 µM, but DNA synthesis induced by S1P or PDGF was not affected even at 3 µM (Fig. 9B). LPA maximally stimulated the migration of 3T3 fibroblasts at 100 nM, and the activity declined as the LPA concentration increased. The bell-shaped migration response to LPA was also observed in glioma cells (Manning et al., 2000
) and lymphocytes (Zheng et al., 2001
), although the mechanism has not yet been well characterized. One possible mechanism might be desensitization caused by high agonist concentration. Ki16425 at
0.1 to 1 µM significantly inhibited the peak migration activity (Fig. 9C), but PDGF-induced cell migration was not inhibited under these conditions (Fig. 9D), similar to the case of DNA synthesis (Fig. 9B).
|
Evaluation of LPA Receptor Subtypes Involved in LPA-Induced Actions. DGPP 8:0 has recently been reported as a selective antagonist of LPA1 and LPA3 (Fischer et al., 2001
). Therefore, we attempted to confirm the pharmacological specificity of DGPP 8:0 for LPA receptor subtypes. As shown in Fig. 10, this compound clearly inhibited the LPA3-mediated Ca2+ response and slightly but significantly inhibited the LPA1-mediated one. The competitive inhibition by DGPP 8:0 was also observed for the inositol phosphate response in LPA3-expressing CHO cells (data not shown). However, as originally proposed (Fischer et al., 2001
), this agent was ineffective for the LPA2-mediated Ca2+ response (Fig. 10B) and the inositol phosphate response (data not shown). Based on the ability to inhibit Ca2+ response, the Ki values of DGPP 8:0 were estimated to be 19.9 µM for LPA1 and 3.33 µM for LPA3. Thus, DGPP 8:0 was more effective for LPA3 than LPA1, whereas Ki16425 was slightly more effective for LPA1 than LPA3 (Table 1).
|
Finally, we explored the differences in the receptor selectivity of DGPP 8:0 and Ki16425 for the evaluation of the lipid receptor subtypes involved in the LPA response in A431 cells. A431 cells express three EDG-family LPA receptor subtypes but not LPA4 (Fig. 8 and Table 2). As shown in Fig. 11A, LPA induced inositol phosphate production in a dose-dependent manner and was partially inhibited by PTX. When the effects of Ki16425 were compared in A431 cells (Fig. 11B) and PTX-treated cells (Fig. 11C), 1 µM Ki16425 was inhibitory at the lower concentrations (
10-100 nM) of LPA in normal cells; the Ki value was 0.73 µM, which is comparable with that of the mean for LPA1 or LPA3 (Table 1). However, DGPP 8:0 was found to be ineffective (Fig. 11B, right). These results suggest that the LPA-induced inositol phosphate response is predominantly mediated by LPA1 in normal A431 cells. On the other hand, in the PTX-treated A431 cells, Ki16425, even at 10 µM, hardly affected the LPA-induced action (Fig. 11C), suggesting that LPA2, but neither LPA1 nor LPA3, might be a major receptor subtype in the PTX-treated A431 cells. Thus, in normal A431 cells, both LPA1 as a major route and LPA2 as a minor route may mediate the LPA-induced inositol phosphate response.
|
| Discussion |
|---|
|
|
|---|
10 min) (i.e., Ca2+, inositol phosphate response, and cAMP responses) and long-term responses (
4-24 h) (i.e., DNA synthesis and cell migration). Ki16425 did not exhibit any significant effects on the other receptor agonist-induced actions, including S1P, SPC, psychosine, 2-arachidonoylglycerol, PAF, lysophosphatidylcholine, ATP, A1-adenosine receptor agonist, bradykinin, EGF, and PDGF. Among the EDG-family LPA receptor subtypes analyzed in the present study, Ki16425 preferentially inhibited LPA1- and LPA3-mediated actions but only weakly inhibited those mediated by LPA2. Because GPR23 was reported as a fourth LPA receptor during the review process of this article, it remains to be elucidated whether Ki16425 affects LPA4/GPR23. The inhibition of the LPA-induced actions by Ki16425 showed a competitive pattern; Ki16425 least inhibited LPA binding to LPA1 but with a high potency, whereas to LPA2, it was inhibitory with a low potency, suggesting a competitive antagonist for LPA receptors with a preference for LPA1 and LPA3 over LPA2.
Recent studies suggest that ligands loosely classified as antagonists can be divided into at least two classes: neutral antagonists, which possess no intrinsic activity, and inverse agonists, which possess negative intrinsic activity (de Ligt et al., 2000
). Thus, inverse agonists can inhibit the basal activity without agonist stimulation. Ki16425 inhibited the basal activity of GTP
S binding (Fig. 3), suggesting that Ki16425 might be an inverse agonist. The basal activity in the inositol phosphate assay, however, was not changed by Ki16425 (Fig. 2). It remains to be elucidated whether the discrepancy of the results is caused by the differences in the time employed in these assays (i.e., 30 min in the GTP
S binding assay and 1 min in the inositol phosphate assay). Increasing the incubation time of inositol phosphate assay and the effects of other LPA receptor antagonists (mentioned below) on the Ki16425-induced GTP
S binding may help to conclude that Ki16425 is a neutral antagonist or an inverse agonist.
Recently, several agents have been shown to inhibit LPA-induced actions, although their effects on LPA binding have not yet been reported. DGPP 8:0 has been shown to have a preferential competitive property for LPA3 over LPA1 and was ineffective on LPA2 (Fischer et al., 2001
). Consistent with this, we also observed in the present study that this agent competitively inhibited the LPA-induced Ca2+ response; the Ki value was estimated to be 3.33 µM for LPA3 and 19.9 µM for LPA1, but no inhibitory effect was detected for LPA2. Based on the GTP
35S binding assay in HEK293 cells (Heise et al., 2001
), VPC12249 has been shown to exert a selective and competitive inhibitory effect on LPA1 (Ki value of 0.14 µM) and LPA3 (Ki value of 0.43 µM), but not on LPA2. Thus, DGPP 8:0 is selective for LPA3, whereas VPC12249 is selective for LPA1 and LPA3. Ki16425 seems to have a pharmacological specificity similar to that of VPC12249, but the effect of the former on LPA2 is not negligible. Thus, Ki16425 has a broad selectivity on LPA receptor subtypes compared with the previously described LPA antagonists, although its interaction on the recently identified LPA4 remains uncharacterized. Such a broad selectivity might be beneficial to the evaluation of the participation of LPA in the biological responses compared with strictly subtype-selective LPA antagonists.
The differential subtype selectivity of Ki16425 and DGPP 8:0 was successfully applied for the evaluation of the LPA receptor subtypes involved in biological responses. In the present study, we analyzed in detail the inositol phosphate response to LPA in A431 cells, which seem to express all three EDG-family LPA receptor subtypes but not LPA4 (Fig. 8). The LPA-induced action was sensitive to Ki16425 in normal cells (Fig. 11B) but insensitive to the antagonist in the PTX-treated cells (Fig. 11C). The change of susceptibility to Ki16425 may be explained as follows. In normal A431 cells, both LPA1 and LPA2 may couple to Gi and Gq, respectively, thereby mediating the LPA-induced inositol phosphate response; however, the minor LPA2/Gq pathway may be masked by the major LPA1/Gi pathway. When Gi was inactivated by PTX, however, the LPA2/Gq pathway was unmasked as a major route for the activation of phospholipase C. The Ca2+ and inositol phosphate responses to LPA in THP-1 cells and 3T3 fibroblasts seem to be mediated mainly by LPA1, as evidenced by their susceptibility to Ki16425 (Fig. 5) but not to DGPP 8:0 (data not shown). Although the effect of Ki16425 on LPA4 has not yet been examined, LPA4 might be insensitive to Ki16425, because the Ca2+ response to LPA in LPA4-expressing HL-60 cells was barely affected by Ki16425 (Table 2). The slight difference in the Ki value between THP-1 cells (0.17 µM for Ca2+ response) and 3T3 cells (0.54 µM for the Ca2+ response and 0.68 µM for the inositol phosphate response) might reflect the difference in the contribution of LPA2 or LPA4 to these responses. Concerning the inhibition of the cAMP response in FRTL-5 cells, it is likely that LPA1 is the major receptor subtype in this cell line. First, LPA-induced inhibition of cAMP accumulation was sensitive to Ki16425 (Fig. 7A), but not to DGPP 8:0 (data not shown). Second, only LPA1 among the subtypes was effective for inhibiting cAMP accumulation when transfected (Im et al., 2000
; Noguchi et al., 2003
). Finally, only LPA1 mRNA was detected in FRTL-5 cells (Fig. 8). Thus, these antagonists are potentially useful for discerning receptor subtypes involved in the given response, even when more than one LPA receptor subtypes is expressed.
Ki16425 was also effective in the long-term responses, including DNA synthesis and cell migration in Swiss 3T3 fibroblasts (Fig. 9). Although LPA-induced DNA synthesis is one of the well known actions of the lipid mediator, its mechanism has not been fully characterized. In NIH 3T3 cells and other cell types, LPA-induced DNA synthesis seems to be mediated through a tyrosine phosphorylation of EGF receptors (Daub et al., 1997
; Cunnick et al., 1998
). Thus, it is possible that Ki16425 inhibited the LPA-induced action by interacting with the EGF receptor. This mechanism is unlikely, however, because EGF was not a significant stimulator for DNA synthesis in Swiss 3T3 fibroblasts (data not shown), and EGF-induced Ca2+ response was not affected by Ki16425 in A431 cells (Table 2). In any event, Ki16425 maintained its specific property for a long period (
24 h), suggesting again that Ki16425 is a useful agent to evaluate the role of LPA and its receptors in long-term as well as short-term responses.
In conclusion, Ki16425 selectively inhibited the EDG-family LPA receptor-mediated actions with preference to LPA1 and LPA3 in vitro. This compound might also potentially serve as a therapeutic drug for diseases that involve LPA and its receptors in their initiation or progression (e.g., atherosclerosis and cancer).
| Acknowledgements |
|---|
| Footnotes |
|---|
H.O. and K.S. contributed equally to this work.
ABBREVIATIONS: LPA, 1-oleoyl-sn-glycero-3-phosphate or lysophosphatidic acid; Ki16425, 3-(4-[4-([1-(2-chlorophenyl)ethoxy]carbonyl amino)-3-methyl-5-isoxazolyl] benzylsulfanyl) propanoic acid; DGPP 8:0, dioctyl glycerol pyrophosphate; PAF, platelet activating factor; S1P, sphingosine 1-phosphate; SPC, sphingosylphosphorylcholine; EDG, endothelial differentiation gene; BSA, bovine serum albumin; AM, acetoxymethyl ester; PTX, pertussis toxin; GTP
S, guanosine 5'-O-(3-thio)triphosphate; Bp, base pair(s); RT, reverse transcription; PCR, polymerase chain reaction; CHO, Chinese hamster ovary; HEK, human embryonic kidney; FBS, fetal bovine serum; Ro 20-1724, 4-[(3-butoxy-4-methoxyphenyl)-methyl]-2-imidazolidinone; MOPS, 3-(N-morpholino)propanesulfonic acid; PDGF, platelet-derived growth factor; EGF, epidermal growth factor; VPC12249, N-oleoyl-2-(benzyl-4-oxybenzyl) ethanolamide phosphoric acid.
Address correspondence to: Fumikazu Okajima, Ph.D., Laboratory of Signal Transduction, Institute for Molecular and Cellular Regulation, Gunma University, 3-39-15 Showa-machi, Maebashi 371-8512, Japan. E-mail: fokajima{at}showa.gunma-u.ac.jp
| References |
|---|
|
|
|---|
An S, Bleu T, Zheng Y, and Goetzl EJ (1998b) Recombinant human G protein-coupled lysophosphatidic acid receptors mediate intracellular calcium mobilization. Mol Pharmacol 54: 881-888.
Bandoh K, Aoki J, Hosono H, Kobayashi S, Kobayashi T, Murakami-Murofushi K, Tsujimoto M, Arai H, and Inoue K (1999) Molecular cloning and characterization of a novel human G-protein-coupled receptor, EDG7, for lysophosphatidic acid. J Biol Chem 274: 27776-27785.
Contos JJ, Ishii I, and Chun J (2000) Lysophosphatidic acid receptors. Mol Pharmacol 58: 1188-1196.
Cunnick JM, Dorsey JF, Standley T, Turkson J, Kraker AJ, Fry DW, Jove R, and Wu J (1998) Role of tyrosine kinase activity of epidermal growth factor receptor in the lysophosphatidic acid-stimulated mitogen-activated protein kinase pathway. J Biol Chem 273: 14468-14475.
Daub H, Wallasch C, Lankenau A, Herrlich A, and Ullrich A (1997) Signal characteristics of G protein-transactivated EGF receptor. EMBO (Eur Mol Biol Organ) J 16: 7032-7044.[CrossRef][Medline]
de Ligt RA, Kourounakis AP and IJzerman AP (2000) Inverse agonism at G protein-coupled receptors: (patho)physiological relevance and implications for drug discovery. Br J Pharmacol 130: 1-12.[CrossRef][Medline]
Fischer DJ, Nusser N, Virag T, Yokoyama K, Wang D, Baker DL, Bautista D, Parrill AL, and Tigyi G (2001) Short-chain phosphatidates are subtype-selective antagonists of lysophosphatidic acid receptors. Mol Pharmacol 60: 776-784.
Hecht JH, Weiner JA, Post SR, and Chun J (1996) Ventricular zone gene-1 (vzg-1) encodes a lysophosphatidic acid receptor expressed in neurogenic regions of the developing cerebral cortex. J Cell Biol 135: 1071-1083.
Heise CE, Santos WL, Schreihofer AM, Heasley BH, Mukhin YV, Macdonald TL, and Lynch KR (2001) Activity of 2-substituted lysophosphatidic acid (LPA) analogs at LPA receptors: discovery of a LPA1/LPA3 receptor antagonist. Mol Pharmacol 60: 1173-1180.
Im DS, Heise CE, Harding MA, George SR, O'Dowd BF, Theodorescu D, and Lynch KR (2000) Molecular cloning and characterization of a lysophosphatidic acid receptor, Edg-7, expressed in prostate. Mol Pharmacol 57: 753-759.
Kimura T, Watanabe T, Sato K, Kon J, Tomura H, Tamama K, Kuwabara A, Kanda T, Kobayashi I, Ohta H, et al. (2000) Sphingosine 1-phosphate stimulates proliferation and migration of human endothelial cells possibly through the lipid receptors, Edg-1 and Edg-3. Biochem J 348: 71-76.
Kon J, Sato K, Watanabe T, Tomura H, Kuwabara A, Kimura T, Tamama K, Ishizuka T, Murata N, Kanda T, et al. (1999) Comparison of intrinsic activities of the putative sphingosine 1-phosphate receptor subtypes to regulate several signaling pathways in their cDNA-transfected Chinese hamster ovary cells. J Biol Chem 274: 23940-23947.
McIntyre TM, Pontsler AV, Silva AR, St Hilaire A, Xu Y, Hinshaw JC, Zimmerman GA, Hama K, Aoki J, Arai H, et al. (2003) Identification of an intracellular receptor for lysophosphatidic acid (LPA): LPA is a transcellular PPARgamma agonist. Proc Natl Acad Sci USA 100: 131-136.
Manning TJ Jr, Parker JC, and Sontheimer H (2000) Role of lysophosphatidic acid and rho in glioma cell motility. Cell Motil Cytoskeleton 45: 185-199.[CrossRef][Medline]
Maschberger P, Bauer M, Baumann-Siemons J, Zangl KJ, Negrescu EV, Reininger AJ, and Siess W (2000) Mildly oxidized low density lipoprotein rapidly stimulates via activation of the lysophosphatidic acid receptor Src family and Syk tyrosine kinases and Ca2+ influx in human platelets. J Biol Chem 275: 19159-19166.
Moolenaar WH (1999) Bioactive lysophospholipids and their G protein-coupled receptors. Exp Cell Res 253: 230-238.[CrossRef][Medline]
Murata N, Sato K, Kon J, Tomura H, Yanagita M, Kuwabara A, Ui M, and Okajima F (2000) Interaction of sphingosine 1-phosphate with plasma components, including lipoproteins, regulates the lipid receptor-mediated actions. Biochem J 352: 809-815.
Noguchi K, Ishii S, and Shimizu T (2003) Identification of p2y9/GPR23 as a novel G protein-coupled receptor for lysophosphatidic acid, structurally distant from the Edg family. J Biol Chem 278: 25600-25606.
Okajima F and Kondo Y (1995) Pertussis toxin inhibits phospholipase C activation and Ca2+ mobilization by sphingosylphosphorylcholine and galactosylsphingosine in HL60 leukemia cells. Implications of GTP-binding protein-coupled receptors for lysosphingolipids. J Biol Chem 270: 26332-26340.
Okajima F, Sato K, Tomura H, Kuwabara A, Nochi H, Tamoto K, Kondo Y, Tokumitsu Y and Ui M (1998) Stimulatory and inhibitory actions of lysophosphatidylcholine, depending on its fatty acid residue, on the phospholipase C/Ca2+ system in HL-60 leukaemia cells. Biochem J 336: 491-500.
Pages C, Daviaud D, An S, Krief S, Lafontan M, Valet P, and Saulnier-Blache JS (2001) Endothelial differentiation gene-2 receptor is involved in lysophosphatidic acid-dependent control of 3T3F442A preadipocyte proliferation and spreading. J Biol Chem 276: 11599-11605.
Sano T, Baker D, Virag T, Wada A, Yatomi Y, Kobayashi T, Igarashi Y, and Tigyi G (2002) Multiple mechanisms linked to platelet activation result in lysophosphatidic acid and sphingosine 1-phosphate generation in blood. J Biol Chem 277: 21197-21206.
Sato K, Tomura H, Igarashi Y, Ui M, and Okajima F (1997) Exogenous sphingosine 1-phosphate induces neurite retraction possibly through a cell surface receptor in PC12 cells. Biochem Biophys Res Commun 240: 329-334.[CrossRef][Medline]
Sato K, Tomura H, Igarashi Y, Ui M, and Okajima F (1999) Possible involvement of cell surface receptors in sphingosine 1-phosphate-induced activation of extracellular signal-regulated kinase in C6 glioma cells. Mol Pharmacol 55: 126-133.
Sato K, Ui M, and Okajima F (2000) Differential roles of Edg-1 and Edg-5, sphingosine 1-phosphate receptors, in the signaling pathways in C6 glioma cells. Brain Res Mol Brain Res 85: 151-160.[Medline]
Sho KM, Okajima F, Abdul Majid M, and Kondo Y (1991) Reciprocal modulation of thyrotropin actions by P1-purinergic agonists in FRTL-5 thyroid cells. Inhibition of cAMP pathway and stimulation of phospholipase C-Ca2+ pathway. J Biol Chem 266: 12180-12184.
Siess W, Zangl KJ, Essler M, Bauer M, Brandl R, Corrinth C, Bittman R, Tigyi G, and Aepfelbacher M (1999) Lysophosphatidic acid mediates the rapid activation of platelets and endothelial cells by mildly oxidized low density lipoprotein and accumulates in human atherosclerotic lesions. Proc Natl Acad Sci USA 96: 6931-6936.
Tamama K, Kon J, Sato K, Tomura H, Kuwabara A, Kimura T, Kanda T, Ohta H, Ui M, Kobayashi I, et al. (2001) Extracellular mechanism through the Edg family of receptors might be responsible for sphingosine-1-phosphate-induced regulation of DNA synthesis and migration of rat aortic smooth-muscle cells. Biochem J 353: 139-146.[CrossRef][Medline]
Tigyi G (2001) Selective ligands for lysophosphatidic acid receptor subtypes: gaining control over the endothelial differentiation gene family. Mol Pharmacol 60: 1161-1164.
Tokumura A, Majima E, Kariya Y, Tominaga K, Kogure K, Yasuda K, and Fukuzawa K (2002) Identification of human plasma lysophospholipase D, a lysophosphatidic acid-producing enzyme, as autotaxin, a multifunctional phosphodiesterase. J Biol Chem 277: 39436-39442.
Tomura H, Itoh H, Sho K, Sato K, Nagao M, Ui M, Kondo Y, and Okajima F (1997) 
subunits of pertussis toxin-sensitive G proteins mediate A1 adenosine receptor agonist-induced activation of phospholipase C in collaboration with thyrotropin. A novel stimulatory mechanism through the cross-talk of two types of receptors. J Biol Chem 272: 23130-23137.
Ueno A, Nagao R, Watanabe T, Ohta H, and Yagi M (2001), inventors; Kirin Brewery, assignee. Novel isoxazole and thiazole compounds and use thereof as drugs. European patent 1 258 484 A1.
Umezu-Goto M, Kishi Y, Taira A, Hama K, Dohmae N, Takio K, Yamori T, Mills GB, Inoue K, Aoki J, et al. (2002) Autotaxin has lysophospholipase D activity leading to tumor cell growth and motility by lysophosphatidic acid production. J Cell Biol 158: 227-233.
Xu Y, Gaudette DC, Boynton JD, Frankel A, Fang XJ, Sharma A, Hurteau J, Casey G, Goodbody A, Mellors A, et al. (1995) Characterization of an ovarian cancer activating factor in ascites from ovarian cancer patients. Clin Cancer Res 1: 1223-1232.[Abstract]
Xu Y, Xiao YJ, Baudhuin LM, and Schwartz BM (2001) The role and clinical applications of bioactive lysolipids in ovarian cancer. J Soc Gynecol Investig 8: 1-13.[Medline]
Ye X, Ishii I, Kingsbury MA, and Chun J (2002) Lysophosphatidic acid as a novel cell survival/apoptotic factor. Biochim Biophys Acta 1585: 108-113.[Medline]
Zheng Y, Kong Y, and Goetzl EJ (2001) Lysophosphatidic acid receptor-selective effects on Jurkat T cell migration through a Matrigel model basement membrane. J Immunol 166: 2317-2322.
This article has been cited by other articles:
![]() |
K. Yanagida, K. Masago, H. Nakanishi, Y. Kihara, F. Hamano, Y. Tajima, R. Taguchi, T. Shimizu, and S. Ishii Identification and Characterization of a Novel Lysophosphatidic Acid Receptor, p2y5/LPA6 J. Biol. Chem., June 26, 2009; 284(26): 17731 - 17741. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. P. Dunworth and K. M. Caron G Protein-Coupled Receptors as Potential Drug Targets for Lymphangiogenesis and Lymphatic Vascular Diseases Arterioscler. Thromb. Vasc. Biol., May 1, 2009; 29(5): 650 - 656. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Y. Xu, J. Porte, A. J. Knox, P. H. Weinreb, T. M. Maher, S. M. Violette, R. J. McAnulty, D. Sheppard, and G. Jenkins Lysophosphatidic Acid Induces {alpha}v{beta}6 Integrin-Mediated TGF-{beta} Activation via the LPA2 Receptor and the Small G Protein G{alpha}q Am. J. Pathol., April 1, 2009; 174(4): 1264 - 1279. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Komachi, H. Tomura, E. Malchinkhuu, M. Tobo, C. Mogi, T. Yamada, T. Kimura, A. Kuwabara, H. Ohta, D.-S. Im, et al. LPA1 receptors mediate stimulation, whereas LPA2 receptors mediate inhibition, of migration of pancreatic cancer cells in response to lysophosphatidic acid and malignant ascites Carcinogenesis, March 1, 2009; 30(3): 457 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lee, C.-T. Cheng, H. Zhang, M. A. Subler, J. Wu, A. Mukherjee, J. J. Windle, C.-K. Chen, and X. Fang Role of LPA4/p2y9/GPR23 in Negative Regulation of Cell Motility Mol. Biol. Cell, December 1, 2008; 19(12): 5435 - 5445. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Nakasaki, T. Tanaka, S. Okudaira, M. Hirosawa, E. Umemoto, K. Otani, S. Jin, Z. Bai, H. Hayasaka, Y. Fukui, et al. Involvement of the Lysophosphatidic Acid-Generating Enzyme Autotaxin in Lymphocyte-Endothelial Cell Interactions Am. J. Pathol., November 1, 2008; 173(5): 1566 - 1576. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nochi, H. Tomura, M. Tobo, N. Tanaka, K. Sato, T. Shinozaki, T. Kobayashi, K. Takagishi, H. Ohta, F. Okajima, et al. Stimulatory Role of Lysophosphatidic Acid in Cyclooxygenase-2 Induction by Synovial Fluid of Patients with Rheumatoid Arthritis in Fibroblast-Like Synovial Cells J. Immunol., October 1, 2008; 181(7): 5111 - 5119. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gustin, M. Van Steenbrugge, and M. Raes LPA modulates monocyte migration directly and via LPA-stimulated endothelial cells Am J Physiol Cell Physiol, October 1, 2008; 295(4): C905 - C914. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Shida, X. Fang, T. Kordula, K. Takabe, S. Lepine, S. E. Alvarez, S. Milstien, and S. Spiegel Cross-talk between LPA1 and Epidermal Growth Factor Receptors Mediates Up-regulation of Sphingosine Kinase 1 to Promote Gastric Cancer Cell Motility and Invasion Cancer Res., August 15, 2008; 68(16): 6569 - 6577. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Steeg, C. E. Horak, and K. D. Miller Clinical-Translational Approaches to the Nm23-H1 Metastasis Suppressor Clin. Cancer Res., August 15, 2008; 14(16): 5006 - 5012. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ishdorj, B. A. Graham, X. Hu, J. Chen, J. B. Johnston, X. Fang, and S. B. Gibson Lysophosphatidic Acid Protects Cancer Cells from Histone Deacetylase (HDAC) Inhibitor-induced Apoptosis through Activation of HDAC J. Biol. Chem., June 13, 2008; 283(24): 16818 - 16829. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Valentine, J. I. Fells, D. H. Perygin, S. Mujahid, K. Yokoyama, Y. Fujiwara, R. Tsukahara, J. R. Van Brocklyn, A. L. Parrill, and G. Tigyi Subtype-specific Residues Involved in Ligand Activation of the Endothelial Differentiation Gene Family Lysophosphatidic Acid Receptors J. Biol. Chem., May 2, 2008; 283(18): 12175 - 12187. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-U. Chen, C.-H. Chou, H. Lee, C.-H. Ho, C.-W. Lin, and Y.-S. Yang Lysophosphatidic Acid Up-Regulates Expression of Interleukin-8 and -6 in Granulosa-Lutein Cells through Its Receptors and Nuclear Factor-{kappa}B Dependent Pathways: Implications for Angiogenesis of Corpus Luteum and Ovarian Hyperstimulation Syndrome J. Clin. Endocrinol. Metab., March 1, 2008; 93(3): 935 - 943. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gustin, E. Delaive, M. Dieu, D. Calay, and M. Raes Upregulation of Pentraxin-3 in Human Endothelial Cells After Lysophosphatidic Acid Exposure Arterioscler. Thromb. Vasc. Biol., March 1, 2008; 28(3): 491 - 497. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Billon-Denis, Z. Tanfin, and P. Robin Role of lysophosphatidic acid in the regulation of uterine leiomyoma cell proliferation by phospholipase D and autotaxin J. Lipid Res., February 1, 2008; 49(2): 295 - 307. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Pradere, J. Klein, S. Gres, C. Guigne, E. Neau, P. Valet, D. Calise, J. Chun, J.-L. Bascands, J.-S. Saulnier-Blache, et al. LPA1 Receptor Activation Promotes Renal Interstitial Fibrosis J. Am. Soc. Nephrol., December 1, 2007; 18(12): 3110 - 3118. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Shumay, J. Tao, H.-y. Wang, and C. C. Malbon Lysophosphatidic Acid Regulates Trafficking of beta2-Adrenergic Receptors: THE G{alpha}13/p115RhoGEF/JNK PATHWAY STIMULATES RECEPTOR INTERNALIZATION J. Biol. Chem., July 20, 2007; 282(29): 21529 - 21541. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chen, L. N. Towers, and K. L. O'Connor LPA2 (EDG4) mediates Rho-dependent chemotaxis with lower efficacy than LPA1 (EDG2) in breast carcinoma cells Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1927 - C1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Damirin, H. Tomura, M. Komachi, J.-P. Liu, C. Mogi, M. Tobo, J.-Q. Wang, T. Kimura, A. Kuwabara, Y. Yamazaki, et al. Role of lipoprotein-associated lysophospholipids in migratory activity of coronary artery smooth muscle cells Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2513 - H2522. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, Z. Liu, and K. E. Meier Lysophosphatidic acid as a mediator for proinflammatory agonists in a human corneal epithelial cell line Am J Physiol Cell Physiol, November 1, 2006; 291(5): C1089 - C1098. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tanaka, S. Okudaira, Y. Kishi, R. Ohkawa, S. Iseki, M. Ota, S. Noji, Y. Yatomi, J. Aoki, and H. Arai Autotaxin Stabilizes Blood Vessels and Is Required for Embryonic Vasculature by Producing Lysophosphatidic Acid J. Biol. Chem., September 1, 2006; 281(35): 25822 - 25830. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-W. Lee, R. Rivera, S. Gardell, A. E. Dubin, and J. Chun GPR92 as a New G12/13- and Gq-coupled Lysophosphatidic Acid Receptor That Increases cAMP, LPA5 J. Biol. Chem., August 18, 2006; 281(33): 23589 - 23597. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Baker, Y. Fujiwara, K. R. Pigg, R. Tsukahara, S. Kobayashi, H. Murofushi, A. Uchiyama, K. Murakami-Murofushi, E. Koh, R. W. Bandle, et al. Carba Analogs of Cyclic Phosphatidic Acid Are Selective Inhibitors of Autotaxin and Cancer Cell Invasion and Metastasis J. Biol. Chem., August 11, 2006; 281(32): 22786 - 22793. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kotarsky, A. Boketoft, J. Bristulf, N. E. Nilsson, A. Norberg, S. Hansson, C. Owman, R. Sillard, L. M. F. Leeb-Lundberg, and B. Olde Lysophosphatidic Acid Binds to and Activates GPR92, a G Protein-Coupled Receptor Highly Expressed in Gastrointestinal Lymphocytes J. Pharmacol. Exp. Ther., August 1, 2006; 318(2): 619 - 628. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Boucharaba, C.-M. Serre, J. Guglielmi, J.-C. Bordet, P. Clezardin, and O. Peyruchaud The type 1 lysophosphatidic acid receptor is a target for therapy in bone metastases PNAS, June 20, 2006; 103(25): 9643 - 9648. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Lee, R. F. Swaby, Y. Liang, S. Yu, S. Liu, K. H. Lu, R. C. Bast Jr., G. B. Mills, and X. Fang Lysophosphatidic Acid Is a Major Regulator of Growth-Regulated Oncogene {alpha} in Ovarian Cancer. Cancer Res., March 1, 2006; 66(5): 2740 - 2748. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Fujiwara, V. Sardar, A. Tokumura, D. Baker, K. Murakami-Murofushi, A. Parrill, and G. Tigyi Identification of Residues Responsible for Ligand Recognition and Regioisomeric Selectivity of Lysophosphatidic Acid Receptors Expressed in Mammalian Cells J. Biol. Chem., October 14, 2005; 280(41): 35038 - 35050. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Q. Wang, J. Kon, C. Mogi, M. Tobo, A. Damirin, K. Sato, M. Komachi, E. Malchinkhuu, N. Murata, T. Kimura, et al. TDAG8 Is a Proton-sensing and Psychosine-sensitive G-protein-coupled Receptor J. Biol. Chem., October 29, 2004; 279(44): 45626 - 45633. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Anliker and J. Chun Lysophospholipid G Protein-coupled Receptors J. Biol. Chem., May 14, 2004; 279(20): 20555 - 20558. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hama, J. Aoki, M. Fukaya, Y. Kishi, T. Sakai, R. Suzuki, H. Ohta, T. Yamori, M. Watanabe, J. Chun, et al. Lysophosphatidic Acid and Autotaxin Stimulate Cell Motility of Neoplastic and Non-neoplastic Cells through LPA1 J. Biol. Chem., April 23, 2004; 279(17): 17634 - 17639. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-S. Im Discovery of new G protein-coupled receptors for lipid mediators J. Lipid Res., March 1, 2004; 45(3): 410 - 418. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamada, K. Sato, M. Komachi, E. Malchinkhuu, M. Tobo, T. Kimura, A. Kuwabara, Y. Yanagita, T. Ikeya, Y. Tanahashi, et al. Lysophosphatidic Acid (LPA) in Malignant Ascites Stimulates Motility of Human Pancreatic Cancer Cells through LPA1 J. Biol. Chem., February 20, 2004; 279(8): 6595 - 6605. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||